|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2009-0994 Copyright © 2009 by The Endocrine Society Maternal Smoking and Developmental Changes in Luteinizing Hormone (LH) and the LH Receptor in the Fetal TestisPaul A. Fowler, Siladitya Bhattacharya, Jörg Gromoll, Ana Monteiro and Peter J. O'ShaughnessyDivisions of Applied Medicine (P.A.F.) and Applied Health Sciences (S.B.), Institute of Medical Sciences, University of Aberdeen, Aberdeen AB25 2ZD, United Kingdom; Centre of Reproductive Medicine and Andrology (J.G.), University of Münster, 48149 Münster, Germany; and Division of Cell Sciences (A.M., P.J.O.), Institute of Comparative Medicine, University of Glasgow Veterinary School, Glasgow G61 1QH, United Kingdom Address all correspondence and requests for reprints to: Professor Paul A. Fowler, Ph.D., Division of Applied Medicine, Centre for Reproductive Endocrinology and Medicine, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen AB25 2ZD, United Kingdom. E-mail: p.a.fowler{at}abdn.ac.uk.
Context: The LH receptor (LHCGR) drives fetal testosterone secretion, which is vital for human masculinization. Maternal smoking is associated with defective masculinization, but the relationship between smoking, tropic hormones, testosterone, and functional LHCGR expression is poorly understood. Objective: This study aimed to investigate developmental changes in fetal gonadotropins, human chorionic gonadotropin (hCG), and expression of fetal testicular LHCGR isoforms and the effects of maternal cigarette smoking. Design: We conduced an observational study of the male fetus, comparing pregnancies in which the mothers did or did not smoke. Setting: The study was conducted at the Universities of Aberdeen and Glasgow. Patients/Participants: Testes and blood were collected from 54 morphologically normal human male fetuses of women undergoing elective termination of normal second-trimester pregnancies. Main Outcome Measures: We measured circulating testosterone, hCG, LH, prolactin, FSH, and testicular LHCGR isoform expression. Results: Fetal testosterone and hCG, but not LH, significantly declined between 11 and 19 wk gestation with no significant change in testicular responsiveness. The proportion of nonfunctional LHCGR transcript in fetal testes was 2.3-fold lower than in adults. Fetal hCG was reduced 38% (P = 0.021) and the ratio of inactive vs. active LHCGR isoforms lowered by smoking. Conclusions: Falling second-trimester fetal testosterone is probably due to declining maternal hCG because Leydig cell LH/hCG responsiveness remains constant. Although maternal cigarette smoking reduces fetal hCG, the ratio of inactive LHCGR isoforms is reduced and gonadotropin drive maintains testosterone production near control levels. The lower relative abundance of inactive isoforms compared with the adult testis reflects the importance of LHCGR.
The LH receptor (LHCGR) is fundamentally important for normal reproductive development and function in men (1). In the human, fetal LH and maternal human chorionic gonadotropin (hCG) act on testicular LHCGR to stimulate both testosterone and insulin-like-hormone-3 secretion (2, 3), which drive testis development, masculinization, and testis descent. Mutations and polymorphisms reducing LHCGR activity impair normal reproductive development, leading to a hypogonadal phenotype (4, 5, 6). The developmental importance of the LHCGR is underscored by the phenotype of the LHCGR knockout mouse (7). In these animals the testes show little postnatal development and testosterone levels are markedly reduced. Whereas inactivation of LHCGR reduces testosterone and impairs Leydig cell development, excess LHCGR action, manifesting in prematurely elevated testosterone levels, also impairs Leydig cell differentiation in mice (8). The finding of a primate-specific exon [6A (6)] within the LHCGR gene, and the potential generation of inactive forms of the receptor, offers the possibility of novel control mechanisms of fetal Leydig cell development. The principal isoform of LHCGR generated in the adult human testis is a truncated, inactive species terminating in exon 6A and only about 15% of isoforms encode functional receptors (6). In adult men LHCGR expression is 10% of that seen in the rodent (9) with much lower levels of associated testosterone secretion. If this relative insensitivity in the adult human is also true of the fetus, it may be particularly important with respect to endocrine disruption, either through endocrine-disrupting compounds, such as phthalates (10) or maternal cigarette smoking during gestation (11). Testosterone production by the human fetal testis is essential for masculinization of the fetus and testosterone itself is important for fetal testis development (12). In the human fetus, testosterone levels peak at around 12–14 wk (13), driving Wolffian duct development. Despite the importance of fetal testicular androgen production, the hormonal drivers that maintain production remain uncertain. During the first trimester, testicular androgen production is dependent on maternal hCG production, which peaks at about 9 wk and then starts to decline (14). At the same time, as hCG levels are declining, the fetal hypothalamic-pituitary axis develops and fetal LH is released into the circulation (15, 16, 17, 18). It is possible therefore that fetal LH starts to play an important role in fetal androgen production during the second trimester, but measurements of circulating fetal LH levels are currently lacking. To examine therefore the relationship between LH, hCG, and testosterone production in the second term human fetus, we have measured levels of these hormones in the fetal circulation. We therefore aimed to determine whether fetal human testicular LHCGR gene expression patterns were different from those in the adult and to determine whether maternal cigarette smoking affected LHCGR transcript expression.
Study design This study was designed, specifically, to investigate the relationship between gonadotropin drive, LHCGR isoforms expression and testicular responsiveness in the fetal testis and to test the hypothesis that maternal smoking affects these parameters in utero. All eligible women (see Sample collection) were recruited prospectively, with maternal and fetal morphological data recorded during consent and sample processing. In total, 46 fetuses were used to determine circulating hormones and cotinine levels from cardiac blood. In a subset of 22 fetuses, the transcript expression levels of LHCGR isoforms transcripts (6) were determined. Cases were matched for gestational stage between smoking and control (nonsmoking) groups. Sample collection The collection of fetal material was approved by the National Health Service Grampian Research Ethics Committees (REC 04/S0802/21). [For a detailed explanation, see (13)]. Women seeking elective, medical, terminations of pregnancy were recruited with full written, informed, consent by nurses working independently at Aberdeen Pregnancy Counseling Service. There was no change in patient treatment or care and women were able to withdraw from the study at any point. Only normally progressing pregnancies from women over 16 yr of age and between 11 and 21 wk of gestation were collected. Fetuses were transported to the laboratory within 30 min of delivery, weighed, crown-rump length recorded, and sexed. The gonads were either snap frozen in liquid nitrogen and stored at –85 C or fixed overnight in neutral buffered formalin, transferred to 70% ethanol, and processed for histology. Endocrine and cotinine assays Testosterone, a key marker of masculinization, was determined using a DELFIA kit (PerkinElmer Life Sciences, Cambridge, UK) with a detection limit of 0.3 nmol/liter and intra- and interassay coefficients of variation 3.2 and 8.6%, respectively. Before testosterone assay, fetal plasma samples were extracted on C18 spin columns (GE Healthcare, Bucks, UK; C18 self-pack POROS 10 R2; Applied Biosystems Ltd., Warrington, UK) to avoid interference caused by hemolysis. The recovery of testosterone was 122 ± 9.7% (13). LH, FSH, prolactin (PRL), and intact hCG were measured using DELFIA kits robust for hemolysis, with detection limits and inter- and intraassay coefficients of variation of 0.05 U LH/liter, 2.4 and 4.2%, 0.5 U FSH per liter, 2.8 and 2.0%, 0.04 mU PRL per liter, 2.0 and 3.0%, and 0.5 U hCG per liter, 4.1 and 4.6% (11). There was a 0.02% cross-reaction of intact hCG in the LH assay. Cotinine, a metabolite of nicotine and a marker of smoking, was determined with a kit (Cozart P.L.C., Abingdon, Kent, UK) giving semiquantitative determination with values between 0 and 12 ng cotinine per milliliter being considered negative. Real-time quantitative PCR For quantification of specific mRNA species in fetal testes (see supplemental Table S1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://jcem.endojournals.org), real-time PCR was used after reverse transcription of the isolated RNA (detailed in Ref. 13). To allow specific mRNA levels to be expressed per testis and control for RNA extraction efficiency, RNA degradation, and the reverse transcription step, 5 ng external standard (luciferase mRNA; Promega UK, Southampton, UK) was added to each ovary at the start of the RNA extraction. Testicular RNA was extracted using TRIzol (Life Technologies, Paisley, UK) and reverse transcribed using random hexamers and Moloney murine leukemia virus reverse transcriptase (Superscript II; Life Technologies). The real-time PCR approach used the SYBR green method in a 96-well plate format using a MX3000 cycler; (Stratagene, Amsterdam, The Netherlands). Reactions contained 5 µl 2x SYBR master mix (Stratagene), primer (100 nM), and template in a total volume of 10 µl, and a melting curve analysis was carried out on the products formed. The quantity of each measured cDNA from the real-time PCR was expressed relative to the standard luciferase cDNA in the same sample. This method allows direct comparison of expression levels per testis between different samples (19). All primers were designed by Primer Express 2.0 (Applied Biosystems) using parameters previously described (20). Primers used to measure LHCGR isoforms are detailed elsewhere (6) with the exception of primers designed to measure exons 9-11, which were forward, gctgtgcttttagaaacttgccaacaa and reverse, ttcatagtcccagccactcagttcact, and terminal exon 6A, which were forward, acataaccaccatacc aggaaatgctttt and reverse, tgctctgtattcttttgattgcattaatctgag. Different primers were used for one of the LHCGR isoforms in this study (terminal exon 6A) to allow the amplicon to cross an intron-exon boundary. The efficiency of the quantitative PCR was similar to the previous primer set, which therefore allows comparison between adult (6) and fetal (present study) tissues. Statistical analysis Analyses were performed using JMP (version 7.0.1; Thompson Learning, London, UK). Normality of data distribution was tested with the Shapiro-Wilk test and nonnormally distributed data were log transformed and rechecked for normality before analysis. To avoid bias, care was taken to ensure that no comparison involved groups with any difference between smokers and nonsmokers in terms of stage of gestation. Because LHCGR transcripts showed changes in expression across the second trimester, two-way ANOVA was used to test the combined effects of gestational age (weeks) and maternal smoking (yes/no) on the data. Relationships between variables were explored by linear regression. For the cotinine assay, values between 0 and 50 ng/ml were expressed at the detected values, whereas all values less than 0 ng/ml were expressed as 0 ng/ml and values greater than 50 ng/ml were expressed as 51 ng/ml for the purposes of statistical analysis.
Activity of the fetal human LH/hCG-testosterone axis
Concentrations of circulating fetal LH did not change significantly during the second trimester (Fig. 1A
Leydig cell numbers increase over the second trimester (13), and we used these data, which were derived from the same population of fetuses as in the present study, to normalize testosterone levels. When testosterone levels were normalized in this way to Leydig cell numbers (Fig. 2  , A and B), the fall in testosterone output per Leydig cell was marked (8.8-fold) and highly significant. This change in testosterone per Leydig cell was also highly correlated with LH+hCG (r = 0.490, P = 0.005) or hCG alone (r = 0.536, P = 0.002), but there was no significant relationship with fetal LH alone (r = 0.037, P = 0.843). The testicular responsiveness to hCG+LH remained unchanged through the second trimester as did responsiveness calculated in terms of hCG alone, whereas there was a significant (5.05-fold) decline in responsiveness per Leydig cell calculated relative to LH alone at 17–19 wk (Fig. 2, C and D). Taken altogether, these data suggest that maternally derived hCG is the main driver for fetal human testicular testosterone production during the second trimester despite relatively high levels of circulating fetal LH.
Fetal testis LHCGR isoforms expression
The transcript measured by another report (13) and the transcript equivalent to complete no. 6A reported by Kossack et al. (6) reflect the full, active LHCGR. Both transcripts (Fig. 3
Effects of maternal cigarette smoking on LHCGR isoforms expression and endocrine activity
As can be seen in Table 2
In the absence of functional LHCGR in the human, there is a marked underdevelopment of the Leydig cells and androgen-dependent structures such as the mesonephric duct derivatives fail to develop in utero (4, 5, 6). This highlights the essential role of the LHCGR in regulating human fetal masculinization and shows that fetal Leydig cells in the human are absolutely dependent on hormonal stimulation of the LHCGR. Human fetal Leydig cells are exposed to two different hormones, LH and hCG, which can act through the LHCGR, and in studies reported here, we examined changes in the components of the hormone-receptor drive regulating testosterone secretion by the fetal Leydig cells during the second trimester. In this study and our other recent studies of the human fetal testis (11, 13), we used fetal plasma to measure fetal hormones, not cord blood as is commonly the case. The latter, at least at term, shows a variable agreement with maternal circulating and amniotic fluid steroid concentrations (21), indicating that it is a mix of maternal and fetal blood. This is an important point because fetal plasma will reflect the degree of accumulation of maternal hormones, such as hCG, and overall levels of exposure to these hormones as well as levels of fetal hormone production. The levels of hCG and testosterone per Leydig cell, but not LH and testosterone per Leydig cell, were strongly correlated. Together with the declining Leydig cell sensitivity expressed relative to hCG, but not LH, this suggests that fetal testosterone falls during the second trimester simply because of the decline in maternal hCG. Clearly changes in LHCGR function could modify this conclusion. Earlier data showing that in individuals lacking functional LH, there is normal masculinization in utero, which must be largely through hCG stimulation of the fetal Leydig cells (22, 23, 24), also support our conclusion. This clearly begs the question why fetal LH does not contribute more to the androgen secretion by the fetal testis, given that the fetal circulation at the end of the second trimester contains up to 30 U LH per liter. In contrast, circulating LH in men ranges between 1 and 7 IU per liter, far lower than in the fetal circulation (25). In presenting the data, we made no assumptions about respective gonadotropin activity. The half-lives of hCG and LH are greater than 30 h, and around 20 min, respectively, there is no apparent marked difference in their affinity for the LHCGR (26, 27). Indeed, in vivo, there is disagreement as to whether hCG is more effective at stimulating testosterone secretion than recombinant human LH in men (28, 29). Similarly, whereas in short-term human fetal testis cultures, 1000 IU hCG per liter appears to stimulate twice the release of testosterone, relative to constitutive output than 1000 IU LH per liter (10, 30), the fact that these exposures were done in different laboratories means that this conclusion should be viewed with caution.
Other androgens are known to be produced by the fetal human testis (31), but all show a similar pattern of secretion with testosterone the highest of the C19 steroids measured. The study by Tapanainen et al. (32) did not measure levels of 5 In the human LHCGR, there is an additional exon, which permits further levels of control of functional LHCGR in the Leydig cells (6). The higher relative expression of functional LHCGR in the fetal testis compared with the adult testis is interesting, although it should be viewed with caution because the data come from different studies. Nevertheless, it suggests that correct transduction of the LH/hCG signal is important in the fetus. It has long been recognized that LHCGR in the neonatal rodent testis, and the second trimester human testis, do not down-regulate on prolonged exposure to LH/CG (35, 36). Therefore, if the fetal testis has a higher ratio of active LHCGR isoforms and is exposed to much higher levels of LHCGR stimulus (LH+hCG) than the adult testis, it would be expected that it would respond strongly to stimulation in terms of testosterone output. This is not the case because the LH/testosterone ratio in men is in the region of 0.02–1.08 (25), dramatically different from the LH+hCG to testosterone ratio of 14–22, we observed in the second trimester human fetus (present study). It appears therefore that the fetal human testis is actually relatively insensitive to stimulation of LHCGR, at least in terms of testosterone secretion. Reports that cultured human fetal testes (24 h cultures) showed only a 50% increase above constitutive testosterone secretion in response to 10 IU of highly purified human LH, and at 1000 IU, testosterone reached 200–250% of basal output (30) supports this suggestion. Our understanding of the relative drives to the testis is complicated by the changing gonadotropin titers during the second trimester, together with the increase in Leydig cell numbers across the same period. At the start of the second trimester, there is 11.2-fold more hCG than LH in the fetal circulation, and this falls to only 1.1-fold more hCG than LH at 17–19 wk. Therefore, up to 16 wk, maternal hCG must be the primary drive to the Leydig cells, with fetal LH making a more important contribution at 17–19 wk. Despite gonadotropin titers in excess of the adult male human, the fetal Leydig cells nevertheless secrete progressively less testosterone per cell as the second trimester continues. Teasing out the relative roles of these parameters in dictating circulating testosterone in the human fetus will require further research.
In many studies maternal cigarette smoking is associated with disturbed reproductive development and subsequently reduced fertility in the male offspring (37, 38, 39). Furthermore, we demonstrated that maternal cigarette smoking halves expression of the desert hedgehog (DHH) gene, a key component in testicular hedgehog signaling (11). Cigarette smoke contains many potentially bioactive chemicals, including metals, nicotine, and polycyclic aromatic hydrocarbons, among others, which reach the fetus [e.g. (11)]. Some components of cigarette smoke such as arsenic can reduce androgen receptor activity (40), which might be expected to affect circulating LH. Instead, we observed reduced hCG, which could be due to either lowered maternal hCG or reduced transplacental hCG transport when the mother continued to smoke cigarettes. Interestingly, this drop in hCG was not matched by a decline in testosterone in fetuses whose mothers smoked during pregnancy (as seen in Table 2 We conclude that maternal hCG reaching the fetal circulation is the main driver of testosterone secretion, despite levels of circulating LH more than twice those seen in men. The fetal testis appears relatively insensitive to LH/hCG with a testosterone to hCG+LH ratio 23-fold higher than in men, even though the fetal testis expresses a 2-fold higher ratio of active LHCGR isoforms than the adult. Maternal cigarette smoking has subtle effects on fetal testicular LHCGR isoforms and testosterone output remains similar despite a significant lowering in maternal hCG reaching the fetal circulation.
The impartial help of the staff of the Pregnancy Counseling Service was essential for the collection of the fetuses. We are grateful to Ms. Margaret Fraser and Gillian Moir for their expert technical assistance.
This work was supported by grants from the Chief Scientist Office (Scottish Executive, CZG/1/109), the Wellcome Trust (063552), and the German Research Foundation (DFG-GR 1547/6-1). Disclosure Summary: All authors have nothing to declare. First Published Online October 16, 2009 Abbreviations: FSHR, FSH receptor; hCG, human chorionic gonadotropin; LHCGR, LH receptor; PRL, prolactin; PRLR, PRL receptor. Received May 12, 2009. Accepted September 9, 2009.
This article has been cited by other articles:
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
-reduced steroids, although the fetal testis does not have high levels of 5
