| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Fundación IVI-Instituto Universitario IVI-University of Valencia (J.A.H., J.A.M.-C., M.M., C.S., A.P.), 46015 Valencia, Spain; Instituto Valenciano de Infertilidad (E.G., P.G., G.G., M.M., C.S., A.P.), 46015 Valencia, Spain; and Hospital Universitario Dr Peset (M.A.H., A.P.), University of Valencia, 46017 Valencia, Spain
Address all correspondence and requests for reprints to: A. Pellicer c/ Guadassuar, 1 Bajo. Valencia 46015, Spain. E-mail: apellicer{at}ivi.es.
| Abstract |
|---|
|
|
|---|
Objective: The objective of the study was to test the effect of intramural leiomyomas on endometrial function by comparing gene during the window of implantation and implantation in an oocyte donation program, in which the quality of the embryos replaced is similar and the endocrine environment of the endometrium is standardized by exogenous steroids.
Design: Human endometria of women with single intramural leiomyomas (group A, <5 cm and group B,
5 cm) and controls (group C) were collected on day LH+7 and processed for histology and gene expression analysis, using different methods and validated by quantitative RT-PCR. To compare in vitro fertilization outcome, a total of 1035 cases from our oocyte donation database were included, comprising patients with one fibroid less than 5 cm (A1, n = 532); two leiomyomas less than 5 cm (A2, n = 128); three or more leiomyomas less than 5 cm (A3, n = 125); one fibroid 5 cm or greater (B, n = 22); and two control groups: C1 (n = 93), women with previous myomectomy; and C2 (n = 135), women without uterine pathology treated on the same dates as C1.
Results: There was a strong positive and negative correlation in the expression profile of 69 genes according to the leiomyomass size, but only three of the 25 genes related to the window of implantation were dysregulated. Term pregnancy rates after oocyte donation were 36.9, 34.1, 39.0, 36.4, 39.2, and 42.6% (P = 0.769) among the established groups. Similarly, no correlation between implantation and miscarriage with leiomyoma number and size was found.
Conclusions: This study provides evidence that intramural leiomyomas not affecting the endometrial cavity alters the expression pattern of some endometrial genes, but the genes involved in implantation are not affected. This is confirmed by leiomyomas having no effect on oocyte donation outcome when the size and number of leiomyomas are analyzed.
| Introduction |
|---|
|
|
|---|
The reproductive impact of intramural leiomyomas that do not affect the endometrial cavity is more controversial because several parameters, namely size, number, and location of leiomyomas, together with other clinical parameters, need to be considered. Based on the model of in vitro fertilization (IVF) in which embryos are replaced into the uterine cavity, some authors have found an adverse effect on IVF outcome (2, 3), whereas others have not found any impact (4, 5, 6). Some authors have also found that the presence of small leiomyomas is associated with reduced ongoing pregnancy rates in IVF/intracytoplasmic sperm injection (3), whereas others reported that only 4- to 7-cm leiomyomas affect IVF outcome (5). Different authors have usually compared the presence of one vs. multiple leiomyomas, but the specific influence of one, two, or more leiomyomas has not been addressed (1, 6). Based on the actual knowledge, laparoscopic myomectomy in infertile patients with leiomyomas 5 cm or greater has become routine practice (1, 7).
Despite all this controversial information, the mechanism by which intramural leiomyomas not encroaching upon the endometrial cavity may affect endometrial receptivity has never been addressed. An inadequate blood supply to the endometrium has been suggested to interfere with implantation (4), but functional studies are lacking.
Different methods have been used over the years to study the ability of the endometrium to sustain a pregnancy. Histological evaluation of the endometrium has been the gold standard on the basis of the morphological observations of Noyes et al. (8) more than 50 yr ago. However, its accuracy and the functional relevance of this system based exclusively on histological observations as a predictor of receptivity have been questioned in recent randomized studies (9, 10). The development of microarray technology (11) has made it possible to analyze the expression of thousands of genes at the same time in a specific sample. This technology allows to address the functional genomics of endometrial development in a global manner. Studies have already characterized the human endometrium throughout the menstrual cycle using microarray technology (12, 13). Moreover, several studies focused on the gene profile of the endometrium during the window of implantation (14, 15, 16, 17, 18). By comparing three different situations, the natural cycle (17), the IVF-stimulated cycle (19), and the gene expression profile in non receptive conditions, such as the insertion of an intrauterine device (20), we were able to find 25 genes that seem to be relevant during the window of implantation (21).
We have acquired extensive experience in oocyte donation over the years (22, 23, 24), and our database contains patients with different types of leiomyomas, and women who underwent myomectomy before oocyte donation. Oocyte donation is the best approach to study a variable that could affect implantation, such as the presence of leiomyomas, because the quality of the embryos replaced is quite similar due to the age of the donors, and the endocrine environment of the endometrium is standardized by exogenous steroid replacement (22, 23, 24). Thus, we designed two studies to analyze the function of the endometrium in the presence of intramural leiomyomas that do not alter the anatomy of the uterine cavity. In the first study, we did a functional genomic analysis of the endometrium during the window of implantation in the presence and absence of leiomyomas. The second study analyzed the implantation rates in ovum donation. For this purpose, a retrospective controlled cohort study of our oocyte donation program was performed. The size and number of leiomyomas, as well as the effects of myomectomy, were considered.
| Materials and Methods |
|---|
|
|
|---|
Study design and tissue collection This study was conducted in accordance with the guidelines in the Declaration of Helsinki and has been approved by the Committee of Ethics and Clinical Investigation at the institution where the endometrial biopsies were obtained (Hospital Universitario Dr. Peset) and processed (Fundación IVI). Written informed consent was obtained from all patients. A total of 22 endometrial samples were collected using a Pipelle catheter (Genetics, Namont-Achel, Belgium) from women with single intramural leiomyomas of different sizes not encroaching the endometrial cavity: less than 5 cm, group A (2.9 ± 1.1 cm, range 1.8–4.5 cm, n = 7) and leiomyomas 5 cm or greater, group B (6.7 ± 1.2 cm, range 5.5–8.0 cm, n = 8). Healthy fertile normal-cycling women (n = 7) served as the control group (group C), at 7 d after an LH peak (LH+7), which is considered to be the representative day of the window of implantation.
Diagnosis of the uterine myoma, localization, and size were performed by transvaginal ultrasonography, magnetic resonance, and hysteroscopy or hysterosonography. Other gynecological pathologies were excluded, especially the presence of adenomyosis and/or endometriomas. To detect ovulation, patients were subjected to systematic transvaginal ultrasonography, starting in the early follicular phase of the cycle. Once a follicle sized 17–18 mm was detected, LH was searched in urine by using a commercially available kit (Felcontrol; Laboratorios Effik, Madrid, Spain).
After washing with PBS1X, around 80% of the endometrial biopsy was stored at –80 C for gene expression analysis. A small part of the piece was fixed with 4% formaldehyde and included in paraffin for histological studies. Endometrial dating was performed using the Noyes criteria (8). It was conducted by two independent pathologists, who were blinded to the day on which the specimen was obtained and to the patients clinical history. The remaining tissue was used for gene expression analyses.
Gene expression profiling
Total RNA was extracted from endometrial biopsies using Trizol reagent (Life Technologies, Paisley, UK) according to the manufacturers instructions, and it was treated with RQ1 DNase I (Promega, Southampton, UK) for 30 min at 37 C and then reextracted with Trizol. RNA quality was assessed by loading 300 ng of total RNA onto an RNA Labchip and analyzed in an A2100 bioanalyzer (Agilent Technologies, Santa Clara, CA). Only those samples with a very good RNA integrity number quality (RIN >7.5 in Agilent bioanalyzer) were included for microarray analysis. In total, 19 samples were analyzed in duplicate: six from group A, six from group B, and seven from group C. The data generated by the CodeLink Operating Software (Northbrook, IL) analysis of the scanned array images were imported into the Gene Expression Pattern Analysis Suite (GEPAS, Valencia, Spain) suite version 4.0 for analysis. The data files containing the probe level intensities were processed using the robust microarray analysis algorithm for background adjustment, normalization, and log2 transformation of perfect match values. Spots intensity of all microarrays ranged between the standards values for Codelink whole genome bioarrays. Extraction data were performed from 0 to 65,535 arbitrary units.
Array hybridization
The generation of the amplified labeled cDNA targets and chip hybridization were performed using the manufacturers recommended method. The fluorescence signal on the microarrays was acquired using a Genepix 4100 microarray scanner (Axon Instruments, Foster City, CA). Scanned images were processed using the GenePix Pro 3.0 software (Axon Instruments).
Data analysis
Bioinformatics analysis The microarray analysis was performed using the GEPAS version 3.1 (http://www.gepas.org) (25). The functional annotation of the analysis results was done using the Babelomics suite (http://www.babelomics.org).
Preprocessing
Output data originating from the microarray normalization process were preprocessed before performing the microarray analysis. Multiple probes mapping to the same gene were merged using the average as the summary of the hybridization values.
Sample clustering
The SOTA method was used to cluster expression profiles of different groups. SOTA is included in the GEPAS suite (25). For the visualization and the evaluation of the clusters quality, we used CATT, a module of the GEPAS suite. Functional enrichment of the clusters was studied with the FatiGO+ tool (26, 27).
Differential gene expression
A t test to find the difference in the mean expression among the three groups of arrays (classes) was applied. The gene expression pattern for samples in each group was analyzed, obtaining P values for each gene in the experiment. We also applied a t test among groups. To account for multiple testing effects, P values were corrected using the false discovery rate (28).
Functional analysis
To detect activations or deactivations in biological functions or pathways, we employed FatiScan (29), a variant of the gene set enrichment algorithm that detects significantly up- or down-regulated blocks of functionally related genes in lists of genes ordered by differential expression. FatiScan is part of the Babelomics suite. FatiScan can search blocks of genes that are functionally related by different criteria such as gene ontology terms, Kyoto Encyclopedia of Genes and Genomes pathways, and others.
Microarray validation: quantitative PCR (Q-PCR)
To verify the results obtained from the microarray, real-time PCR was performed for six selected genes: two up-regulated, tissue factor pathway inhibitor 2 (TFPI2) and transmembrane 4 L six-family member 4 (TM4SF4); and four down-regulated, glutathione peroxidase 3 (plasma) (GPx3), claudin 10 (CLDN10), FXYD domain-containing ion transport regulator 2 (FDXY2), and secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T lymphocyte activation 1) (SPP1). Statistical analysis of the PCR data were conducted using the relative expression software tool algorithm, which uses a pairwise-fixed reallocation and randomization test to determine significance. The oligonucleotides designed to be used as forward and reverse primers for Q-PCR are: TFPI2 (NM_006528), forward, 5'-AGATCTGTCTCCTGCCCCTA, reverse, 5'-AGCCGGCAAACTTTGGGAA; TM4SF4 (NM_004617), forward, 5'-CGACCACCTTTCCCAAGAGA, reverse, 5'-TATCCAGCTCCCAAGAATCCA; GPx3 (NM_002084), forward, 5'-GGTGGAGGCTTTGTCCCTAA, reverse, 5' AGCGCATGATGGGTATACCA; CLDN10 (NM_006984), forward, 5'-CTGGAAGGTGTCTACCATCGA, reverse, 5'-AAAGAAGCCCAGGCTGACA; FDXY2 (NM_001680), forward, 5'-AATGACTGGGTTGTCGATGGA, reverse, 5'-ACAGCGGAATCTTCTGCTGA; SPP1 (NM_000582), forward, 5'-TAAACCCTGACCCATCTCAGA, reverse, 5'-TGAGACTCATCAGACTGGTGA.
Retrospective study: impact of leiomyomas on implantation and pregnancy rates
Study design and data collection We conducted a retrospective hybrid design between a case-control and cohort study on patients undergoing oocyte donation at IVI-Valencia from April 1994 to August 2007. Searching through our database of 12,108 oocyte donation cycles, we were able to identify 807 first oocyte donation cycles in patients with ultrasonographically documented leiomyomas not affecting the endometrial cavity, as ascertained by hysteroscopy or hysterosonography. Patients suspected of, or diagnosed with, concomitant adenomyosis and/or endometriosis by ultrasound, magnetic resonance, and/or surgery were excluded, as were couples with severe oligozoospermia (<5 million/ml of sperm cells in the ejaculate). They were divided into four groups, depending on the size and number of leiomyomas. Group A was formed by women presenting leiomyomas less than 5 cm in diameter. The group was then divided in three subgroups according to the number of leiomyomas: group A1 [one single leiomyoma, 1.8 ± 0.9 cm (range 0.4–4.5 cm)] (n = 532) (similar to group A in the histological and molecular studies); group A2 [two leiomyomas, 1.9 ± 0.9 cm (range 0.3–4.4)] (n = 128); and A3 [three or more leiomyomas, 1.9 ± 0.9 cm (0.5–4.6)] (n = 125). Group B (n = 22) were patients undergoing egg donation in whom a single fibroid 5 cm or greater in size (mean 5.7 ± 0.9 cm, range 5.0–8.09), not encroaching into the endometrial cavity, was present at embryo replacement (similar to group B in the histological and molecular studies).
Two control groups were established. Group C1 (n = 93) was made up of cases in which a myomectomy was performed before attempting IVF. Most cases were patients with one or two medium-sized leiomyomas removed by laparoscopy, but no myoma was present at IVF. Before entering the oocyte donation program, an office hysteroscopy confirmed a normal endometrial cavity. Group C2 (n = 135) comprised patients undergoing oocyte donation on the same dates as those included in group C1. Care was also taken to include women in both C groups in whom the diagnosis of uterine leiomyomas, adenomyosis and/or endometriosis, and severe male factor could be ruled out. Thus, group C2 was similar to group C in the histological and molecular studies.
The variables analyzed and compared among groups included age, years of infertility, indication for oocyte donation, number of oocytes received, fertilization rates, quality of the embryos replaced, implantation, and pregnancy rates. Similarly, term pregnancies and those ongoing beyond wk 26 of gestation were also recorded in this analysis.
Statistical analysis of clinical data
A power calculation was done with the initial hypothesis that the presence of leiomyomas could reduce pregnancy rates in 20%. Keeping in mind that pregnancy rates are around 50% in our IVF program (risk = 50%) and the effect of leiomyomas could be around 20% (risk difference = 20%), the estimated sample size with a β-risk of 20% (power = 80%) and
-risk of 5%, should be more than 93 patients per group. ANOVA was performed for comparisons among the six groups established, despite most variables not following a normal distribution. However, none of them presented an important asymmetry and followed the central limit theorem.
2 tests, followed by Bonferronis correction (multiplying the P value by the number of comparisons performed) was used to compare pregnancy and miscarriage rates among groups.
We also performed a logistic regression analysis in which the effect of leiomyomas size on pregnancy and miscarriage rates was quantified. The significance of the model was calculated by the omnibus test (likelihood ratio) and the uncertainty explained by the model was evaluated by Negelkerke R2. The odds ratio of the effect of one cm more on the size of the fibroid on pregnancy outcome is expressed together with 95% confidence intervals (CIs), R2, and significance. Significance was assumed at P < 0.05. Statistical analysis was performed using the Statistical Package for the Social Sciences 14 (SPSS Inc., Chicago, IL).
| Results |
|---|
|
|
|---|
Histological endometrial dating Endometrial dating of the endometria at day LH+7 in group B showed a significant (P < 0.05) delay in dating (d 18.1 ± 1.9, mean ± SD), compared with group C (d 19.9 ± 2.2, mean ± SD). However, the group A leiomyomas showed no statistical difference with the control in histological dating (d 19.4 ± 3.1, mean ± SD).
Molecular studies
In total, comparative gene expression profile analysis was performed in 19 samples in duplicate: seven in group C, six in group B, and six in group A. All the experiments performed showed a good level of labeling and hybridization onto the Agilent biochips.
Real-time PCR validation of microarray data
Before the analysis of the microarray data, the microarray results of six selected genes were validated by Q-PCR. Figure 1
shows the fold change obtained for the four down-regulated genes (GPx3, CLDN10, FDXY2 and SPP1). No statistical difference was found between Q-PCR and the microarray data. Similar fold changes were also observed for the two up-regulated genes in groups A and B, TFPI2 and TM4SF4 (data not shown). Therefore, all the selected genes that dysregulated in the endometrium of leiomyomas were confirmed to demonstrate a statistically significant regulation in the same direction by real-time PCR (100% concordance).
|
The SOTA method was used for the unsupervised hierarchical clustering analysis of the 19 endometrial biopsies analyzed. This analysis revealed that endometrial samples from subjects with intramural uterine leiomyomas, regardless of their size, or from controls clustered irrespectively of their origin (data not shown). No difference was found in the global gene expression profiles among specimens.
Differential gene expression
The differential gene expression of the samples in each group was obtained with the P values for every gene in the experiment and with the fold change. A strong correlation (positive and negative) between the endometrial gene expression profile of some genes and the size of the myoma was found. Twenty-six genes showed a positive correlation greater than 70, and 43 presented a negative correlation greater than –0.70. More than 100 genes showed a weak positive and negative correlation (0.30 to 0–70 and –0.70 to –0.30, respectively). Figure 2
shows the intensity of the gene expression (color blue to red), the correlation values, and the codes of the 50 most correlated genes (positively and negatively). The names, symbol, and accession number of the most positive (>0.70) and negative (<–0.70) correlated genes are presented in Fig. 2
.
|
We searched activations or deactivations in biological functions or pathways employing the FatiScan of those genes with a positive or negative correlation with fibroid size greater than 0.50 or less than –0.50, respectively.
Among the genes that positively correlated with the size of the intramural fibroid, we found the following biological processes were overrepresented at level 4 of gene ontology: regulation of blood vessels size, mitotic cell cycle, response to DNA damage stimulus, macromolecule complex assembly, organelle organization and biogenesis, nucleic acids biosynthesis and biopolymer metabolic process. Similarly, those which were underrepresented were biological processes such as system development, cell-cell signaling, immune response, and response to wounding. Among the negatively correlated genes, the main overrepresented biological processes were signal transduction and sensory perception. All these biological terms are summarized in Fig. 3
.
|
The 25 genes that we consider are relevant to the window of implantation (21) were carefully analyzed. Only three, GPx,3 (–10.0-fold change), placental protein 14 (also called glycodelin) (–12.0-fold change) and aldehyde dehydrogenase 3 family, member B2 (–3.0-fold change) were dysregulated in group B (Table 1
) and one (GPx3, – 4.1-fold change) was dysregulated in group A (data not shown).
|
Table 2
presents several epidemiologic data of the patients included in the study. As observed, there was no difference among groups in age, years of infertility, body mass index, or indication for oocyte donation. The overall outcome of the first oocyte donation cycle analyzed in the patients included in the study is presented in Table 3
. The data show no statistical difference among the study groups and the controls for pregnancy rate (P = 0.735), implantation rate (P = 0.371), multiple pregnancies (P = 0.658), miscarriage rate (P = 0.752), and ongoing/term pregnancies (P = 0.769). Moreover, the logistic regression analysis revealed that neither the size of the largest fibroid nor the number of leiomyomas had a significant influence on the chances of pregnancy [odds ratio (OR) =1.083 (95% CI = 0.938–1.250) and OR = 0.951 (95% CI = 0.775–1.157), respectively] or miscarriage [OR = 0.979 (95% CI = 0.856–1.120) and OR = 1.065 (95% CI = 0.885–1.281), respectively].
|
|
| Discussion |
|---|
|
|
|---|
Histopathological dating, as a classical tool for endometrial evaluation, was the first analysis carried out with the endometrial biopsies of women with and without intramural myomas. The histological analysis revealed that the presence of large, but not small, intramural leiomyomas induced a delay in the development of the endometrium during the window of implantation. The relevance of this finding is probably insignificant as the initial description of Noyes et al. (8) required a delay of more than 2 d in endometrial maturation to consider it an out-of-phase endometrium. Moreover, this delay has also been reported in IVF cycles with controlled ovarian stimulation and was believed to be of benefit to embryo implantation as the transferred embryos arrive at the endometrial cavity 24–48 h earlier than in natural conception (30). When the delay exceeds 3 d, impaired implantation is observed (31), although this is not the case in the presence of leiomyomas.
Moreover, endometrial dating and histological examinations have inherent interobserver, intraobserver, and intercycle variations, which may account for their lack of usefulness (10). And it should not be forgotten that other studies have shown successful implantation during cycles in which the endometrium had exhibited maturational delay as assessed by histological criteria (32). On the other hand, functional genomics studies allow us obtain objective data about the global biological processes that take place in one organ, tissue, or group of cells.
The closest approach to our study has been recently reported. The effect of uterine leiomyomas on the endometrium using molecular markers of endometrial receptivity, such as homeo box A (HOXA)-10, HOXA11, leukemia inhibitory factor (LIF), and basic transcription element-binding protein 1 (BTEB1), has interestingly shown that endometrial HOXA10 and HOXA11 mRNA expressions significantly decreased in uteri with submucosal leiomyomas. However, no difference with controls was observed when intramural leiomyomas were studied (33). Nonetheless, no wide genomic analyses that focus on the effect of the presence of the fibroid in the window of implantation have been reported to date. Other genomic approaches to the effects of leiomyomas on the uterus relate to understanding of their pathogenesis or to the effect of different treatments. In this context, alterations in genes regulating retinoid synthesis and IGF metabolism in myoma tissue, as compared with the normal adjacent endometrium, have been described (34). Similarly, the expression of leptin and leptin receptor in myometrium and uterine leiomyomas of women treated with GnRH analogs has been also reported (35).
In the present study, we demonstrate that the gene expression profiles of samples obtained from women with small and intramural leiomyomas differ from those obtained from healthy women at LH+7. Furthermore, hierarchical sample clustering did not reflect any difference. By considering the global gene expression profiles of the samples, they were found to be very similar with no statistical difference among them (data not shown). However, the expression of 69 genes strongly correlated with the size of the myoma, and 26 genes did so positively, whereas 43 did so negatively. More than 100 genes were also correlated with a weak level of correlation (Fig. 2
). This clearly reflects that some genes are affected by the presence of the endometrial intramural leiomyomas in some way, but the clinical relevance of these changes seems to be negligible. However, it has to be also stated that both studies were performed in different conditions. Whereas the genomic study was done in natural cycles, oocyte donation requires exogenous steroid priming. Thus, it is possible that this medication could change the histological pattern and the gene expression profile and correct for an implantation defect that may be present in natural cycles with leiomyomas.
Among the genes that were up-regulated with the size of the intramural fibroid, we found an overrepresented regulation of blood vessel size, a feature that correlates well with the angiogenesis involved in fibroid vascular supply and growth (36). Similarly, immune response and response to wounding were under-represented when a fibroid was present. Interestingly, an impairment of maturation and a differentiation of lymphocytes in women with large leiomyomas suggested a decrease in the local immune response directly connected with the myoma growth rate have been reported (37). Other biological processes found to be over- and underrepresented in the correlated up- and down-regulated genes in this study seem to be unrelated to the endometrial function.
Given the current incomplete definition of a receptive endometrium, (14, 15, 16, 17, 18), we recently developed a user-friendly list of key genes that could be relevant to endometrial receptivity after comparing the gene expression profile of the natural cycle, the controlled ovarian stimulation cycle, and the endometrium containing an intrauterine device. Consequently, a list of 25 genes was generated (21). We found that only three genes of this list were down-regulated in the endometrium with large leiomyomas [GPx3, placental protein 14 (also called glycodelin), and aldehyde dehydrogenase 3 family, member B2] and only one gene in the presence of small leiomyomas (GPx3). These genes were also down-regulated during the window of implantation in other nonoptimal conditions such as in controlled ovarian stimulation with GnRH agonists (19) and in the presence of an intrauterine device (20). In the case of GPx3, its expression remained dysregulated after 1 yr of the intrauterine device removal when implantation rates are normal showing that this molecular is not vital for implantation (20). The other 22 genes of the list showed normal gene expression values in the presence of leiomyomas, suggesting that that endometrial receptivity, as a biological process, should not be affected.
Given the delay in child-bearing in our society, the number of infertile women with leiomyomas has increased because these tumors are more frequent with the percentage of advanced age (1). The clinical study confirmed these observations. It was carefully designed to analyze the impact of intramural leiomyomas not affecting the endometrial cavity on implantation as precisely as possible, provided that successful implantation is the best and unquestionable test of endometrial function. Thus, the oocyte donation model was selected because endometrial preparation with exogenous steroids allows to study a more homogeneous population in which the potential influence of controlled ovarian stimulation on the endometrial function is ruled out (19, 38). Care was also taken to exclude cases with documented or suspected adenomyosis. Also, those patients with concomitant endometriosis were excluded. We know that endometriosis does not affect oocyte donation outcome (39), but it is more frequently associated with adenomyosis than expected (40). Moreover, the quality of the embryo was another carefully scored parameter. For this reason, cases of severe male factor infertility were excluded.
As a result, we present herein the highest retrospective series of cases with intramural leiomyomas ever to be published from a single center. Moreover, we were able to divide leiomyomas by size and number to search for specific effects on implantation. The data showed similarities among the different groups compared in the different epidemiological data analyzed in Table 3
. The analysis did not reveal any effect of the presence of leiomyomas, regardless of size and number, on successful implantation, as ascertained by ongoing/term pregnancy rates. Similar conclusions were reached by Klatsky et al. (6), who performed a retrospective analysis of first recipient egg donation cycles. The study has the originality of being the first in which the oocyte donation model has been used, allowing to rule out an effect of ovarian stimulation on endometrial receptivity as well as a detrimental effect of age on oocyte quality. However, the size and number of leiomyomas and the effect of myomectomy were not analyzed in detail.
| Footnotes |
|---|
First Published Online June 17, 2008
1 J.A.H., E.G., and M.A.H. contributed equally to this study. ![]()
Abbreviations: CI, Confidence interval; CLDN10, claudin 10; FDXY2, FXYD domain containing ion transport regulator 2; GPx3, glutathione peroxidase 3; HOXA, homeo box A; IVF, in vitro fertilization; OR, odds ratio; Q-PCR, quantitative PCR; SPP1, secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T lymphocyte activation 1); TFPI2, tissue factor pathway inhibitor 2; TM4SF4, transmembrane 4 L six family member 4.
Received March 11, 2008.
Accepted June 11, 2008.
| References |
|---|
|
|
|---|
ski AJ 2003 Vascular system of intramural leiomyomata revealed by corrosion casting and scanning electron microscopy. Hum Reprod 5:1088–1093This article has been cited by other articles:
![]() |
S. Matsuzaki, M. Canis, C. Darcha, J.-L. Pouly, and G. Mage HOXA-10 expression in the mid-secretory endometrium of infertile patients with either endometriosis, uterine fibromas or unexplained infertility Hum. Reprod., December 1, 2009; 24(12): 3180 - 3187. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Sunkara, M. Khairy, T. El-Toukhy, Y. Khalaf, and A. Coomarasamy The effect of intramural fibroids without uterine cavity involvement on the outcome of IVF treatment: a systematic review and meta-analysis Hum. Reprod., November 12, 2009; (2009) dep396v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.O. Burney, A.E. Hamilton, L. Aghajanova, K.C. Vo, C.N. Nezhat, B.A. Lessey, and L.C. Giudice MicroRNA expression profiling of eutopic secretory endometrium in women with versus without endometriosis Mol. Hum. Reprod., October 1, 2009; 15(10): 625 - 631. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |