| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Obstetrics and Gynecology (H.I., K.M., T.H., M.F., S.A., S.H.K., M.T., Y.Y.), Keio University School of Medicine, Tokyo, Japan 160-8582; and Center for Reproductive Sciences (H.I., R.B.J.), Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556
Address all correspondence and requests for reprints to: Robert B. Jaffe, M.D., Center for Reproductive Sciences, 1450 HSW, Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556. E-mail: jaffer{at}obgyn.ucsf.edu.
| Abstract |
|---|
|
|
|---|
Objective: Our objective was to test the hypothesis that the periphery of the HFA is a site of angiogenesis.
Design: Studies were conducted involving RNA, frozen sections, and primary cell cultures from midgestation HFAs.
Main Outcome Measures: Immunofluorescence, laser capture microdissection, and real-time quantitative RT-PCR were used.
Results: Double immunostaining demonstrated that proliferating endothelial cells were limited to the DZ and DZ/FZ border. Ang2 mRNA was primarily expressed in the DZ, whereas Ang1 mRNA was primarily in the FZ. VEGF-A and FGF-2 mRNA levels were higher in the DZ. FGF-2 (10 ng/ml) induced Ang2 mRNA by 4-fold in both zones of cells (P < 0.01, at 24 h), but not Ang1 or VEGF-A mRNA.
Conclusion: Data suggest that angiogenesis occurs at the periphery of the HFA. The DZ-predominant expression of Ang2 may be explained, in part, by the parallel pattern of FGF-2 expression.
| Introduction |
|---|
|
|
|---|
The HFA undergoes a phase of rapid growth in midgestation. Although the central drive for the HFA growth appears to be provided by ACTH, the growth-stimulatory actions of ACTH may be mediated, at least in part, by locally produced growth factors such as fibroblast growth factor (FGF)-2 (basic FGF) and IGF-II, acting in an autocrine and/or paracrine fashion (5, 6, 7). Angiogenesis, the process of formation of new capillaries from preexisting blood vessels, likely is essential for the rapid growth of the HFA. In addition, the HFA requires the development of an extensive vasculature for delivery of steroid hormone precursors to the gland and secretion of hormone products into the peripheral circulation. A variety of factors are implicated in the regulation of angiogenesis. We have studied expression and regulation of the vascular endothelial cell-specific angiogenic factors, vascular endothelial growth factor (VEGF)-A (8), angiopoietins (Angs) 1 and 2 (9) in the midgestation HFA. We showed that these factors are expressed in the HFA and that ACTH up-regulates them in isolated HFA cortical cells, suggesting that these factors may be key local regulators of HFA angiogenesis. Thus, they may mediate the tropic action of ACTH, exerting parallel control over the vasculature. Of particular note, ACTH induces an altered Ang balance in which Ang2 predominates over Ang1. Furthermore, Ang2 protein is predominantly localized in the periphery of the HFA (i.e. the DZ and an outer region of the FZ). Ang2 expression has been restricted to sites of vascular remodeling, and it has been proposed that Ang2 renders endothelial cells responsive to angiogenic stimuli, such as VEGF-A and FGF-2 (10, 11, 12, 13). Viewed in this light, the outer zone-predominant Ang2 localization in the HFA may reflect the primary site of angiogenesis in the organ.
In this study we localized proliferating endothelial cells in the midgestation HFA, and investigated the zonal differential expression of Ang1, Ang2, VEGF-A, and FGF-2. In addition, we examined regulation of the vascular endothelial cell-specific angiogenic factors in isolated HFA cortical cells.
| Subjects and Methods |
|---|
|
|
|---|
HFA glands (15–24 wk gestation, n = 18) were obtained from women who opted for elective termination of pregnancy for social indications (i.e. no known fetal pathology) by dilatation and evacuation. Gestational age was estimated by foot length. The study protocol was approved by the Committee on Human Research, University of California, San Francisco. Adrenal glands were collected and placed in ice-cold medium for primary cell culture, in RNA Later (Ambion, Inc., Austin, TX) for RNA extraction, or in 4% paraformaldehyde in PBS for histological examinations, or snap frozen for laser capture microdissection (LCM) studies. Recombinant human FGF-2 was purchased from R&D Systems, Inc. (Minneapolis, MN). Recombinant human IGF-II was from Upstate Biotechnology, Inc. (Lake Placid, NY).
LCM
LCM was performed as described previously (14, 15). Captured cells from the DZ or FZ were immediately processed for RNA extraction.
RNA isolation and real-time quantitative RT (qRT)-PCR
Total RNA from primary culture cells and cells captured by LCM was isolated and purified as described previously (9). RT reactions with random primers were performed with Omniscript reverse transcriptase (QIAGEN, Inc., Valencia, CA) under conditions described by the supplier. Expression of Ang1, Ang2, FGF-2, VEGF-A, and 17
-hydroxylase/17, 20 lyase (P450c17) were analyzed using real-time TaqMan RT-PCR as we have described previously (9, 16, 17). The levels of expression of each gene were normalized using β-glucuronidase (GUS) levels after the comparative threshold cycle method (9, 16, 18). Sequences for the PCR primers and TaqMan fluorogenic probe for FGF-2 were: forward primer, ACCCCGACGGCCGA; reverse primer, TCTTCTGCTTGAAGTTGTAGCTTGA; and TaqMan probe, FAM (6-carboxy-fluorescein)-TCCGGGAGAAGAGCGACCCTCACATAMRA (6-carboxytetramethyl-rhodamine) (Integrated DNA Technologies, Coralville, IA) (19).
Immunofluorescence studies
Frozen sections were prepared from HFAs, and processed for immunofluorescence and subsequent imaging analysis as previously described (15). Primary antibody incubation was performed for 1 h at room temperature with the following antibodies: a 1:20 dilution of rabbit antihuman VEGF-A polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); a 1:15 dilution of mouse antihuman FGF-2 monoclonal antibody (BD Biosciences, San Jose, CA); a combination of a 1:10 dilution of rabbit antihuman Ki67 antibody (Zymed Laboratories, Inc., South San Francisco, CA) and a 1:10 dilution of sheep antihuman CD31 polyclonal antibody (R&D Systems); a combination of a 1:10 dilution of the Ki67 antibody and a 1:10 dilution of mouse antihuman CD31 monoclonal antibody (Dako Corp., Carpinteria, CA); or a combination of the anti-Ki67 antibody and a 1:20 dilution of rhodamine-labeled ulex europaeus agglutinin (UEA) I (Vector Laboratories, Burlingame, CA). After washing, incubation with Cy3-conjugated goat antirabbit or antimouse antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) was performed at room temperature for 30 min for VEGF-A or FGF-2 localization, respectively. For double-color immunohistochemical studies, Cy3- or FITC-conjugated, appropriate secondary antibodies (Jackson ImmunoResearch Laboratories) were used. After washing, slides were mounted with VectorShield mounting medium with or without 4, 6-diamidino-2-phenylindole (Vector Laboratories). Sections were visualized, and images were captured using a Nikon inverted fluorescence microscope (Nikon Corp., Tokyo, Japan) with MetaMorph software (Universal Imaging, Downingtown, PA). Confocal microscopy was performed using a Carl Zeiss (Jena, Germany) 510 META Laser Scanning Microscope. Negative controls were HFA sections incubated with unconjugated mouse IgG, or with rabbit or sheep serum. Background staining using these controls under the conditions described was minimal. The endothelium of vessels in the capsule of the HFA served as a positive control for CD31 and UEA I staining. The human fetal lung and kidney served as positive controls for VEGF-A and FGF-2 staining.
Calculating the proportion of Ki67-positive endothelial cells in all the Ki67-positive proliferating cells in the DZ was assessed in three sections per adrenal. The demonstration of a Ki67-positive endothelial cell depended on the identification of a Ki67-positive nucleus surrounded by a CD31-positive cell membrane.
Fetal adrenal cortical cell culture
The capsule with the adherent DZ was carefully peeled away from the HFA to separate the DZ from the FZ as described previously (20, 21). Briefly, cells in the separated zones were dispersed by enzymatic digestion and plated on plastic culture dishes at a density of approximately 25,000 cells/cm2. Culture medium consisted of a 1:1 (vol/vol) mixture of DMEM H-16 and Hams F-12 with 10% fetal calf serum, 2 mM glutamine, and antibiotics. Cells were incubated at 37 C in a humidified environment consisting of 5% CO2 in air. After 48 h in culture, the medium was changed to one containing 2% fetal calf serum, and nonadherent cells were removed. At the initiation of experiments (usually 96 h after plating), the medium was renewed, and IGF-II (100 ng/ml) or FGF-2 (10 ng/ml) was added to the cells. These concentrations of IGF-II and FGF-2 were chosen because they represent the concentrations used in previous studies of human adrenal cortical cells and are effective in inducing various biological activities (6, 21, 22, 23). All experiments were replicated on adrenal cortical cells obtained from at least three different fetuses.
Statistical analysis
Data are presented as means ± SE, and were analyzed by ANOVA, followed by the Dunnetts test for multiple comparisons. Differences were considered significant at P < 0.05.
| Results |
|---|
|
|
|---|
Zonal differential mRNA expression of Ang1, Ang2, VEGF-A, and FGF-2 was investigated by LCM and qRT-PCR. Ang2 mRNA was primarily expressed in the DZ, whereas Ang1 mRNA was primarily in the FZ (Fig. 1A
). Because Ang1 and Ang2 can have opposing effects, the arbitrary ratio of Ang2 to Ang1 mRNA was calculated. The Ang2/Ang1 mRNA ratio was 9.3 ± 2.3 and 1.2 ± 0.2, in the DZ and FZ, respectively (P < 0.05) (Fig. 1B
). Levels of VEGF-A and FGF-2 mRNA were 1.4- and 2.5-fold higher, respectively, in the DZ than in the FZ of the HFA at midgestation (Fig. 1A
).
|
We evaluated zonal differential mitotic activity in the midgestation HFA by staining tissue sections with an antibody against the proliferation marker, Ki67. Ki67 immunoreaction was almost exclusively restricted to cell nuclei at the periphery of the HFA. Proliferating endothelial cells were detected by double immunofluorescence with Ki67 and the endothelial cell markers, CD31 or UEA I. Double immunostaining demonstrated that proliferating endothelial cells were limited to the DZ and DZ/FZ border (Fig. 2C
) but that the endothelium located in the more central portion of the gland was quiescent (Fig. 2D
). Similar results were obtained from HFAs studied (i.e. 17–24 wk). In the DZ, the mean percentage of proliferating endothelial cells was 4.7 ± 0.4% (n = 5) of total Ki67-positive cells. The percentage of proliferating endothelial cells does not appear to change over the age range studied (i.e. 17–24 wk).
|
We further localized VEGF-A and FGF-2 proteins in the midgestation HFA. Immunoreactive VEGF-A and FGF-2 had a zonal expression pattern similar to those of VEGF-A and FGF-2 mRNAs (Fig. 3
). Predominant staining for FGF-2 was evident in the periphery of the gland. Immunoreactive VEGF-A was detected throughout the gland. There was no apparent effect of gestational age on the pattern of staining for FGF-2 and VEGF-A over the age range studied (i.e. 17–24 wk).
|
Because FGF-2 and IGF-II appear to be locally produced growth factors implicated in HFA development (5, 6), and both have regulated expression of vascular endothelial cell-specific angiogenic factors in certain cell types (24, 25), we examined whether FGF-2 or IGF-II can regulate mRNA expression of VEGF-A, Ang1, and Ang2 in cultured HFA cells. Treatment of isolated FZ cells with FGF-2 (10 ng/ml) for 24 h increased Ang2 mRNA by 4-fold, but not Ang1 or VEGF mRNA (Fig. 4
). In contrast, IGF-II (100 ng/ml) did not significantly change mRNA levels of Ang1, Ang2, or VEGF, whereas the action of IGF-II on FZ cells was confirmed by assessing its effect on the abundance of mRNA encoding P450c17, which is up-regulated by IGF-II (22, 26) (Fig. 4
). Similarly, treatment of cultured DZ cells with FGF-2, but not IGF-II, selectively increased Ang2 mRNA, as shown in Fig. 5
.
|
|
| Discussion |
|---|
|
|
|---|
Angiogenesis is considered an integral process for organ growth that is mediated in part by pro-angiogenic factors, including FGF-2 and VEGF-A, both of which are potent mitogens for endothelial cells (13, 28). Ang1 and Ang2 belong to a more recently identified family of endothelial cell-specific growth factors that also play a key role in angiogenesis (12, 13, 29). Ang1 is expressed in a wide variety of tissues, whereas Ang2 expression is found primarily at sites of vascular remodeling, including the reproductive tract and placenta (10, 16, 30, 31). Both Ang1 and Ang2 bind their Tie2 receptor with high affinity. The currently accepted hypothesis is that Ang1 signals via Tie2 and promotes vessel stabilization and maturation, whereas Ang2 antagonizes Ang1/Tie2 signaling and destabilizes vessels, leading to either angiogenesis or vessel regression, depending on the presence of angiogenic stimuli such as VEGF-A and FGF-2 (11, 12, 13). In the present study, we sought to investigate the zonal pattern of mRNA expression of the angiogenic factors in the midgestation HFA. To address this in a sensitive, quantitative, and spatially accurate fashion, we used LCM and qRT-PCR, which demonstrated that Ang2 mRNA levels in vivo were higher in the DZ than in the FZ, consistent with our previous immunohistochemical findings of Ang2 localization predominantly in the outer zone (9). In contrast, Ang1 mRNA levels were lower in the DZ than in the FZ. VEGF-A and FGF-2 mRNA levels were higher in the DZ than in the FZ. Immunoreactive VEGF-A and FGF-2 exhibited a zonal pattern similar to that of their mRNA. Therefore, given the presumed roles of the angiogenic factors discussed previously, the outer-zone predominant expression of Ang2, along with abundant VEGF-A and FGF-2, likely indicates that angiogenesis in the midgestation HFA occurs primarily in the periphery of the gland. The higher Ang2 to Ang1 mRNA ratios in the DZ further support this observation. Conversely, increased Ang1 expression in the FZ implies greater vessel maturity. We speculate that a stable vasculature is necessary for the FZ because of the early initiation of hormone synthesis and sustained production of dehydroepiandrosterone and its sulfate in the zone. Further studies are required to explore this tenet.
The localization of VEGF protein throughout the midgestation HFA indicates its roles not only in the DZ but the FZ. Vittet et al. (32) reported that VEGF-A was strongly expressed in both glomerulosa and fasciculata cells of the adult bovine adrenal cortex where the endothelium is quiescent, suggesting a role for VEGF-A in the maintenance of the dense fenestrated vascular bed. Similarly, we have data that VEGF-A mRNA levels in human adult adrenals are comparable to those in midgestation HFAs (data not shown). Vittet et al. (32) also demonstrated that mRNA expression of the signaling VEGF receptors VEGFR-1 and VEGFR-2 was restricted to endothelial cells of the adult bovine adrenal cortex. In our hands, qRT-PCR analysis revealed that VEGFR-2 mRNA was expressed in both the DZ and FZ, and that VEGFR-2 mRNA expression relative to CD31 (an index of abundance of endothelial cells) was higher in the inner FZ than the outer DZ (data not shown). Because VEGF-A is known to exert antiapoptotic effects on endothelial cells and induce endothelial fenestration (28), very likely via VEGFR-2 on the fetal adrenal endothelium, it may play an important role in maintaining vascular homeostasis in the midgestation HFA, an active endocrine organ.
We demonstrate, for the first time, that proliferating endothelial cells were limited to the periphery of the HFA (i.e. the DZ and DZ/FZ border) during midgestation. The DZ may benefit from a more plastic vascular state to accommodate its proliferative phenotype. In a previous study using microcorrosion casts and scanning electron microscopy, a dense network of irregular capillaries at the periphery of the HFA was described (33). The dense vascularization enables proximity between adrenocytes and endothelial cells. Thus, we hypothesize that interactions between adrenal cortical and endothelial cells ensure a coordinate expansion of the vascular network as DZ cells proliferate and the organ grows. A similar coordination of growth of the vasculature and organ has been demonstrated in murine embryonic lung morphogenesis (34).
Because Ang2 often plays a pivotal role in vessel destabilization, the initial step in angiogenesis (12, 13), understanding the mechanisms that regulate Ang2 expression, is of significant importance. In most tissues, the primary source of Ang2 is endothelial cells (10, 35). Ang2 expression is almost absent in the quiescent vasculature and is related to endothelial activation (29). Environmental cues such as hypoxia and several different endotheliotropic cytokines, including FGF-2 and VEGF-A, can up-regulate expression of Ang2 mRNA in endothelial cells (24, 36). Therefore, Ang2 may act in an autocrine manner to control endothelial responsiveness. On the other hand, several investigators have described nonendothelial expression of Ang2 in certain tissues (9, 16, 37, 38). For example, in the human corpus luteum, Ang2 mRNA was detected in luteal cells as well as endothelial cells (37). Recently, we showed that Ang2 is expressed in the periphery of the midgestation HFA, whereas the Tie2 receptor is exclusively in endothelial cells throughout the gland (9). We also demonstrated that isolated HFA cortical cells produce Ang2 and VEGF-A, particularly in response to ACTH stimulation, indicating that fetal adrenal cortical cells can be a paracrine source to trigger angiogenesis (8, 9). In the current investigation, FGF-2 up-regulated mRNA encoding Ang2, but not Ang1, in isolated DZ and FZ cells. Of particular interest, FGF-2 expression exhibited a DZ-predominant pattern similar to that of Ang2. Thus, Ang2 may be partly under the control of FGF-2 in vivo. Because FGF-2 is one of the most potent mitogens for HFA cells as well as for endothelial cells (5, 28), this suggests an efficient mechanism by which FGF-2 can promote angiogenesis directly and indirectly through inducing Ang2 to support the vascular supply proportionate to organ growth. Furthermore, because both FGF-2 and Ang2 are regulated by ACTH (5, 9), these results are consistent with a concept, proposed by us and other investigators, that ACTH coordinates adrenal organ growth and angiogenesis (9, 39, 40).
In summary, the present study shows that endothelial cell proliferation occurs at the outer region of the HFA gland. This outer-zone predominance is parallel to localization of the key angiogenic factors, Ang2, FGF-2, and VEGF-A. Moreover, the parallelism observed in the in vivo expression patterns of Ang2 and FGF-2 may in part be explained by the up-regulation of Ang2 mRNA by FGF-2 in HFA cortical cells. This study highlights the importance of coordinated organ and vasculature growth by interactions between adrenal cortical cells and endothelial cells in which FGF-2 and the vascular endothelial-specific growth factors, Ang2 and VEGF-A, are likely involved.
| Acknowledgments |
|---|
| Footnotes |
|---|
Results from this work were presented in part at the 85th Annual Meeting of The Endocrine Society, Philadelphia, Pennsylvania, June 19–22, 2003, and the 54th Annual Scientific Meeting of The Society for Gynecologic Investigation, Reno, Nevada, March 14–17, 2007.
Disclosure Statement: The authors have nothing to disclose.
First Published Online March 25, 2008
Abbreviations: Ang, Angiopoietin; DZ, definitive zone; FGF, fibroblast growth factor; FZ, fetal zone; GUS, β-glucuronidase; HFA, human fetal adrenal; P450c17, 17
-hydroxylase/17, 20 lyase; LCM, laser capture microdissection; qRT, real-time quantitative RT; UEA, ulex europaeus agglutinin; VEGF, vascular endothelial growth factor.
Received November 12, 2007.
Accepted March 17, 2008.
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |