This Article Abstract Full Text (PDF) Supplemental Data Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pigny, P. Articles by Caron, P. Search for Related Content PubMed PubMed Citation Articles by Pigny, P. Articles by Caron, P. Related Collections Adrenal and Hypertension Cardiovascular Endocrinology Endocrine Oncology

Paraganglioma after Maternal Transmission of a Succinate Dehydrogenase Gene Mutation

Laboratoire de Biochimie and Hormonologie (P.P., M.C., N.P.), Centre de Biologie et Pathologie, Service d’Endocrinologie and Maladies Métaboliques (C.C.B.), Clinique Marc Linquette, Centre Hospitalier Régional & Universitaire, 59037 Lille cedex, France; Institut National de la Santé et de la Recherche Médicale U837 (P.P., A.V., N.P.), Centre de Recherche Jean Pierre Aubert, 59045 Lille cedex, France; Service d’Endocrinologie and Maladies Métaboliques (M.B., P.C.), Hôpital de Rangueil, Centre Hospitalier Universitaire de Toulouse, 31059 Toulouse cedex, France; and Service d’Anatomie Pathologique (V.T.d.M.), Centre Chirugical Marie Lannelongue, 92350 Le Plessis Robinson, France

Address all correspondence and requests for reprints to: Pascal Pigny, Ph.D., Laboratoire de Biochimie et Hormonologie, Centre de Biologie et Pathologie, Centre Hospitalier Régional & Universitaire, F-59037 Lille cedex, France. E-mail: p-pigny{at}chru-lille.fr.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Context: Inactivating mutations of SDHD, which is mapped to 11q23 and encodes the cybS subunit of succinate dehydrogenase, predispose to hereditary paraganglioma (PGL) and/or pheochromocytoma. So far no disease was shown to occur in case of maternal transmission of a SDHD mutation, suggesting the existence of genomic imprinting. A hypothetic model, involving the loss of the maternal copy of a tumor suppressor gene mapped to 11p15 in the tumoral tissue, has been proposed to explain this mode of inheritance.

Objective: Our objective was to investigate the possibility of maternal transmission of SDHD-linked PGL.

Design: A three-generation family carrying the SDHD W43X mutation was studied at the clinical, pathological, and genetical levels.

Results: The germline’s mutation was probably inherited from the grandfather. In the second generation, three carriers (two females and one male), who had the same at risk 11q13-q23 haplotype, developed multiple cervical PGLs. In the third generation, one boy received the mutation from his mother and developed a glomus tympanicum PGL at 11 yr. He shared only the 11q23 haplotype with the other affected members of the family. Methylation analysis of the differentially methylated region upstream of the maternally expressed H19 gene, mapped to 11p15, showed that the seventh CTCF binding site is hypermethylated in the germline of the affected boy suggesting a gain of imprinting.

Conclusion: Our data show that maternal transmission of a SDHD-linked PGL, even if a rare event, can occur. Therefore, we propose that children who inherited a pathogenic mutation from their mother should be considered as at risk of PGL.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Head and neck paraganglioma (HNP) are rare, highly vascularized tumors that develop from the paraganglia of the parasympathetic autonomous nervous system, with the carotid body as the most common site. Usually HNP do not produce catecholamines and are therefore diagnosed late when a mass effect syndrome on the neighborly organs occurs. The proportion of hereditary paragangliomas (PGLs, MIM 168000, 115310, and 605373) varies from 10 to 50% according to the geographic origin of the population and the extent of the molecular analysis (1). Three susceptibility genes for hereditary PGLs have been described so far, i.e. SDHD mapped in 11q23 (PGL1 locus), SDHB mapped in 1p35 (PGL4), and SDHC mapped in 1q21 (PGL3). These genes encode three of the four protein subunits of succinate dehydrogenase that forms the complex II of the mitochondrial electron transport chain. Germline mutations of SDHD causing hereditary PGL were first described in 2000 (2) and were thereafter found in patients with apparently sporadic pheochromocytomas (3). SDHD appears to act as a tumor suppressor gene (TSG) because: 1) the mutated allele leads to a loss of function of mitochondrial complex II and a defect in oxygen-sensing leading to an hypoxic response (4, 5); and 2) the wild-type allele is completely lost in the tumor (2, 6). SDHD-associated PGLs are transmitted in an autosomal dominant fashion in case of paternal transmission, whereas no disease occurs if the mutated allele is inherited from the mother. This unusual mode of inheritance suggests the existence of genomic imprinting (7), a hypothesis that has not been violated in any kindred to date (8). However, several studies argued against a direct imprinting of SDHD because: 1) it does not belong to an imprinted region (9); 2) its promoter is not methylated in pheochromocytoma or normal adrenal tissues (10); and 3) the two alleles of SDHD are expressed in several tissues such as kidney, brain, or lymphoblastoid cell lines (2). Thus, another hypothetic model has been proposed to explain the genomic imprinting in SDHD-linked PGL, i.e. loss of a maternally expressed TSG mapped to the 11p15.5 region in the tumoral tissue (11), but a clear demonstration is still lacking.

Here we report the first description of a SDHD-linked PGL kindred in whom the disease is inherited from the mother.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Subjects

The pedigree of the family is shown in Fig. 1. Patient II.2 born in 1946 is the propositus of this kindred. In 1975, at the age of 29 yr, a left PGL originating in the glomus jugulare and glomus tympanicum was removed in this patient. The surgical treatment was followed by an embolization of the tumor. Meanwhile, a hypertension was also discovered. During the follow-up that extends on 30 yr, several other PGLs were found. In 2005 she suffered from multicentric tumors affecting the left glomus jugulare with an extension to the petrous part of temporal bone, tympanic cavity, jugular foramen, the sphenoid bone, and the cavernous sinus. A bilateral vagal PGL extending to the retrostyloid region and a bilateral PGL of the carotid body were also found. Since 1995 she had pulmonary metastasis and she is treated with somatostatin analog octreotide (30 mg of the long-acting formulation every 28 d). The abdominal computed tomography scan is negative. In this patient HNPs are associated with a moderate increase of the urinary excretion of dopamine [varying from 594 to 1300 µg/d (Table 1)].

View larger version (25K): [in this window] [in a new window]   FIG. 1. Family pedigree showing the unaffected (in white) and affected (in gray) patients, the presence or absence of the germline SDHD W43X mutation, and the microsatellites used to perform chromosome 11 haplotype across the three generations. Alleles were designed by their size. A common disease haplotype (red lines) for the 11q13-q23 region was found in three patients of the second generation, which was probably inherited from the father I.1. The distal part of this haplotype was also identified in patient III.3. Non-at-risk haplotype is shown in black or green lines according to the generation level. Alleles of the 11p13-p15 region common to different patients are shown in italics. Alleles lost in the tumor DNA of patient I.1. are shown by a dotted line. *, Haplotype of individual I-1 is reconstructed. Black arrow corresponds to a recombination point.

In 2001 a 2 x 4 cm right cervical PGL originating in the carotid body was removed in the 51-yr-old propositus’ brother (patient II.1). In June 2004 the [¹¹¹In] octreotide scintigraphy showed a mediastinal increased uptake under the aortic cross and the nuclear magnetic resonance revealed a right adrenal mass (1.5 x 1.3 cm) compatible with a pheochromocytoma. Pulmonary nonspecific nodules were also noticed. Urinary catecholamines levels were within the normal range and serum chromogranin A level was moderately increased (Table 1). One year later there was no evidence of ongoing tumor growth.

Their father (patient I.1) died at 75 yr of a colonic neoplasia. No cervical tumor was suspected. Their mother born in 1922 (patient I.2) was free of any symptoms, suggesting a PGL or pheochromocytoma at 73 yr. Patient III.3, son of patient II.3, born in 1981, had a history of recurrent epistaxis at the age of 11 yr. At this time (1992), a pulsatile cervical mass was suspected by palpation. Because of the familial history, an angiography was performed, revealing the absence of a right PGL and the presence of a left PGL located in the glomus jugulotympanicum (Fig. 2A). An embolization was performed, which led to a clear radiological regression of the vascular mass (Fig. 2B). Fifteen years after this treatment (age 26 yr), no residual tumoral tissue in the head and neck region was found by magnetic nuclear imaging (Fig. 3). The urinary excretion of norepinephrine and epinephrine were normal (Table 1). This patient lived at a mean altitude of 600 m above sea level. These patients were referred to us for optimizing the clinical and genetic follow-up.

View larger version (128K): [in this window] [in a new window]   FIG. 2. A, Angiography performed in patient III.3 after catheter cannulation of the ascending external carotid artery showed a bulky highly vascular mass extending to the foramen jugulare region, the tympanic cavity (lateral view). Imaging data are highly suggestive of a glomus jugulotympanicum tumor. B, Angiography performed in patient III.3 after embolization; a great reduction of the vascular blush is noticed.

View larger version (61K): [in this window] [in a new window]   FIG. 3. Magnetic nuclear imaging performed in patient III.3 in December 2007. A, Arterial time after gadolinium injection. B, T1 coronal view after gadolinium. C, T1 axial view after gadolinium.

Germline DNA was prepared from peripheral blood leukocytes collecting on EDTA using a commercial kit (EZ1 DNA Blood 350; QIAGEN, Courtaboeuf, France) according to the manufacturer’s instructions. Somatic DNA was prepared from a 10-µm section of the paraffin-embedded tumor of patient II.1 (removed in 2001) after deparaffinization with xylene. Archival paraffin-embedded tumors of patient II.2 (removed in 1975) were unfound, whereas the left carotid PGL (removed in 1987) from this patient was available. Unfortunately the acid fixative used in this last case was detrimental to the DNA quality. The search for germline or somatic mutations of SDHD, SDHB, or SDHC was carried out using nucleotide sequencing of PCR products as previously described (12).

Microsatellite analysis

Microsatellites markers mapped to chromosomes 11p15 (D11S1363, D11S4046, and D11S1984), 11p13 (D11S1758, D11S4154, and D11S4200), 11q13 (D11S1219, D11S4946, and XG3), and 11q23 (D11S1647, D11S1347, and D11S3178) regions were analyzed using a fluorescent forward primer. PCR products were run on an ABI 3130 XL DNA sequencer with ROX-400 HD size standards and analyzed with Genemapper v.3.5 software (Applied Biosystems, Courtaboeuf, France). Haplotypes were determined for eight individuals across three generations, whereas those of patient I.1 is deduced. Chromosome 11p15-p13 allele loss in the tumor of patient II.1 was assessed by analyzing the six microsatellites listed above in the tumor and germline DNA. Five additional microsatellites were studied to refine genotyping in a subset of this kindred as shown in supplemental Fig. S1, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://jcem.endojournals.org.

Methylation analysis of the differentially methylated region (DMR) upstream of H19

The human H19 DMR contains seven CTCF binding sites (CTS) that are differentially methylated on the two parental chromosomes. Methylation status at this locus was studied by PCR amplification of the seven CTS as previously described (13). Bisulfite-modified DNA was obtained as previously shown (14) and used as a template for PCR. PCR products were digested with BstUI restriction enzyme before being separated by polyacrylamide gel electrophoresis. The methylated allele is cut by the enzyme, whereas the unmethylated allele is not because of the bisulfite modification. The methylation status of the three CpG dinucleotides of CTS7 was determined by nucleotide sequencing, as previously described (14). Long-range PCR amplification of the H19 DMR was carried out in leukocyte DNA using external primers as previously described (13) except for the forward primer, which was as follows: CGCTGTGGCTGATGTGTAGTAGAG (located upstream of CTS1: nucleotides 4491–4513 of nucleotide sequence GenBank AF125182). The PCR product expected length is 4392 bp (Sparago, A., personal communication).

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Because the clinical data of the family were highly suggestive of a hereditary HNP, a germline DNA analysis was performed in the propositus (II.2). Nucleotide sequencing revealed a nucleotide variation of SDHD (c.129G>A), resulting in the nonsense mutation W43X. This mutation was not associated with other nucleotide variants of SDHD. Moreover, no germline mutation was found in SDHB and SDHC. This mutation is pathogenic because it leads to a loss of function of the succinate dehydrogenase complex by the production of a SDHD truncated protein, and it has already been described in another patient with paraaortic and carotid body PGLs (15). Therefore, patient II.2 suffered from SDHD-linked PGLs. Patients II.1 and II.3 also had the W43X mutation in accordance with their phenotype. The mutation was probably inherited from the father (patient I.1) because the alive mother (I.2, born in 1922) does not have the mutation and is free of the disease at age 73 yr. In the third generation, patients III.1 and III.2 did not inherit the mutation and accordingly had no HNP. On the contrary, patient III.3 received the SDHD W43X mutation from his mother and had a HNP discovered at age 11 yr. No germline mutation of SDHB or SDHC and no other nucleotide variants of SDHD were found in patient III.3.

To track the origin of the mutated allele and the 11p15 region in patient III.3, we decided to analyze microsatellites covering the q23, q13, p13, and p15 regions of chromosome 11 in this kindred. Patients II.1, II.2, and II.3 shared a common haplotype for markers covering the 11q13-q23 region (Fig. 1, red line). This haplotype was probably inherited from their father (I.1) because five of six alleles were absent in the mother I.2. In the third generation, patient III.3 shared the haplotype only for markers located in the 11q23 region (nearby SDHD) with his mother, uncle, and aunt, thus demonstrating a maternal transmission of a recombined 11q region carrying the SDHD mutation in this patient. In the same way, his brother III.2 and his cousin III.1 received a different recombined allele from their respective parents (Fig. 1). Five additional microsatellites mapped between D11S4946 and D11S1647 were studied to refine genotyping in these two brothers (Fig. S1). The recombination hotspot is located between D11S1887 and D11S4118 at a 21-Mb distance upstream of SDHD. Moreover, three recombination events occurred during six meiosis in this kindred within a 46-Mb region (between 4946 and 1647). The recombination rate is thus of 1.09 cM/Mb.

Concerning the 11p15-p13 region (Fig. 1), the three affected patients of generation II shared only three genotypes for the telomeric marker D11S1984, and centromeric markers D11S4154 and D11S4200 at the germline level (in italics). The genotype at D11S1984 was also found in patient III.3’s germline who probably inherited it from his grandfather. Somatic DNA was prepared from the only available paraffin-embedded PGL (patient II.1). Nucleotide sequencing showed the presence of a heterozygous mutation with a decrease of the normal G, suggesting a partial loss of the wild-type allele or tumor heterogeneity as previously demonstrated (16). We performed a loss of heterozygosity analysis of the 11p15 region to check the model of Hensen et al. (11). As expected, a partial loss of the 11p15 region between markers D11S1984 (1.5 Mbp) and D11S1758 (4.7 Mbp) was observed in the tumor DNA of patient II.1. Whether the loss extended to both centromeric and/or telomeric sides could not be confirmed because the two surrounding microsatellites are homozygous in patient II.1’s germline. Nevertheless, this lost region is located nearby markers D11S2362 (4.86 Mbp) and D11S1338 (5.9 Mbp) that were previously shown to be lost in about 75% of SDHD-linked PGLs (6, 11). The lost alleles were of maternal origin, as previously shown (2, 11). Interestingly, the telomeric marker D11S1984 is mapped near the paternally imprinted H19 (2.0 Mbp) that encodes an untranslated RNA with tumor suppressor function (17).

Expression of H19 depends on the upstream DMR that is methylated on the paternal allele and unmethylated on the maternal allele, allowing H19 expression from the latter. Therefore, we investigated the methylation status of the H19 DMR at the germline level in several patients (Fig. 4A). Results obtained by restriction digestion of bisulfite-treated DNA suggest that CTS4 and -7 are hypermethylated in patient III.3’s germline, in contrast with his parents and brother’s germlines, whereas no difference was noticed for CTS3 and -6. Unfortunately, results were not interpretable for CTS1, -2, and -5 (not shown). By bisulfite genomic sequencing, we observed intense hypermethylation of two CpG dinucleotides that belong to CTS7 in patient III.3 but normal allele-specific methylation in his father (Fig. 4B). For CTS3, six clones were obtained for patient III.3 and his father, showing a methylcytosine percentage of 66% for both patients, in accordance with their similar restriction patterns. Unfortunately, for CTS4, no clones were obtained for patient III.3.

View larger version (51K): [in this window] [in a new window]   FIG. 4. A, Methylation status of CTS3, CTS4, CTS6, and CTS7 of the H19 DMR. Analysis was carried out by bisulfite treatment coupled with BstUI digestion on leukocyte DNA of patients II.3, III.2, III.3, and the father (F) (see Fig. 1 for details). The full-length fragment correspond to the unmethylated allele and the shorter fragments to the methylated allele. The percentage under each lane corresponds to the extent of methylation determined after densitometry analysis of the bands. The ratio was set at 50% for the father (F), who is unaffected and not consanguineous with his wife. B, DNA methylation profile of CTS7 determined by bisulfite genomic sequencing. Results of the patient III.3 and his father (F) are shown. Each line corresponds to a single cloned DNA molecule. Methylated CpG are shown as filled circles and unmethylated ones as open circles. Numbers above each circle indicate the position of each cytosine as documented in GenBank (accession no. AF125183). The three CpG dinucleotides belonging to the CTS7 are underlined. C, A search for H19 DMR partial or complete deletion in patient III.3’s germline was carried out by long-range PCR using primers upstream of CTS1 and nearby CTS7 (see Subjects and Methods for details). The PCR product expected length is 4392 bp.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Because no maternal transmission of a SDHD-linked PGL has been reported in the literature so far, it is admitted that this disease occurred only when the mutation is paternally transmitted. This mode of inheritance is consistent with genomic imprinting (7). However, it seems that SDHD is not directly imprinted because it belongs to a chromosomal region (11q23) not known to be concerned by genomic imprinting (9) and also because SDHD showed a biallelic expression in several tissues (2). Regarding imprinting, the 11p15 region is a more convincing pathogenic region because it contains several loci regulated by genomic imprinting such as H19/IGF2 (9) and because several studies demonstrated a loss of a whole copy of chromosome 11 in 100% of SDHD-linked PGL (2, 11). Moreover, in 16 informative tumors, the allele lost was of maternal origin (2, 11). Hensen et al. (11) thus proposed that a paternal imprinted TSG mapped to the 11p15 region promoted tumorigenesis of the paraganglia in synergy with a SDHD mutation.

In our kindred, the mode of transmission of PGL at the second generation fits well with this model. All affected patients shared the same haplotype in the 11q13-q23 region coinherited with the pathogenic mutation of SDHD from their father. At this generation, the mean age of first tumor occurrence was 38 yr, not different from those reported in large series of SDHD-mutation carriers (18). In the third generation, the model is violated because one boy who inherited the SDHD mutation from his mother developed a cervical tumor at age 11 yr. Young age at occurrence strongly argues in favor of a familial tumor because age of onset for sporadic HNP is around 50 yr (18). One can hypothesize that this young age at diagnosis results from the severity of the mutation (non sense) that leads to a loss of function of SDHD and to a defect of oxygen sensing that was exacerbated by the moderate high level of residence of this patient. However, Astrom et al. (19) previously demonstrated that altitude did not influence the age of onset of SDHD-linked PGLs. Interestingly, the recombination rate for the 11q region reaches 1.09 cM/Mb in this family, thus 25% higher than those reported for the surrounding 11q13 region (around MEN1 gene) or 11q23 region (around SDHD (20). Whether this trend is significant is currently unknown. If the model of Hensen et al. (11) holds true, it means that the maternally active TSG mapped to the 11p15 region has been inactivated by a gain of imprinting in this patient. One can hypothesize that erasure of the paternal imprinting around D11S1984, which was inherited from the grandfather I.1, was partial in the mother’s ovocyte (II.3), explaining that this allele carried paternal marks. We thus decided to focus on H19, which is a TSG mapped nearby D11S1984, regulated by genomic imprinting and whose expression is reduced in pheochromocytomas (21), which are PGL-related tumors also deriving from neural-crest cells. Our results showed an altered methylation profile of H19 DMR in patient III.3’s germline, suggesting a gain of imprinting. Whether this event could lead, as previously demonstrated (22), to a down-regulation of H19 awaits further demonstration. Nevertheless, our data suggest that H19 could be the TSG of the model of Hensen et al. (11) that is inactivated during paraganglioma formation by either loss of one allele or methylation of its promoter.

Our report is thus the first demonstrating the occurrence of PGL in case of maternal transmission of the SDHD-mutated allele. Such a transmission had already been suggested, but the final diagnosis was not confirmed in the offspring (7). Even if it is a rare event, it should be kept in mind when performing genetic counseling. We thus propose to consider that, in kindred with SDHD-linked PGL, children who harbored the mutation are at risk of PGL, whatever the origin (maternal or paternal) of the allele. Large studies of children from female SDHD mutation carriers are warranted before recommendations on medical follow-up could be formulated.

	Acknowledgments

 
We thank A. Leclercq, C. Mouton, and T. Lovecchio for their expert technical assistance; Dr. F. Escande for her help with loss of heterozygosity analysis; and Dr. F. Dubrulle for her expert advice on the imaging data. We are indebted to Drs. A. Sparago and A. Riccio for their constructive suggestions and help with methylation analysis of the H19 DMR.

	Footnotes

 
This work was supported by a public grant from the Canceropôle Nord-Ouest (phases précoces du cancer). Our laboratory is supported by the French Ministry of Health (DHOS/Plan Cancer/Soutien aux Laboratoires d’Oncogénétique Constitutionnelle). A.V. is a recipient of a Conseil Régional Nord Pas de Calais and Institut National de la Santé et de la Recherche Médicale PhD fellowship.

Disclosure Information: The authors have nothing to disclose.

First Published Online January 22, 2008

Abbreviations: CTS, CTCF binding site; DMR, differentially methylated region; HNP, head and neck paraganglioma; PGL, paraganglioma; TSG, tumor suppressor gene.

Received September 5, 2007.

Accepted January 14, 2008.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Baysal BE 2003 On the association of succinate dehydrogenase mutations with hereditary paraganglioma. Trends Endocrinol Metab 14:453–459[CrossRef][Medline]
2. Baysal BE, Ferrell RE, Willett-Brozick JE, Lawrence EC, Myssiorek D, Bosch A, van der May A, Taschner PEM, Rubinstein WS, Myers EN, Richard 3rd CW, Cornelisse CJ, Devilee P, Devlin B 2000 Mutations in SDHD, a mitochondrial complex II gene, in hereditary paraganglioma. Science 287:848–851[Abstract/Free Full Text]
3. Gimm O, Armanios M, Dziema H, Neumann HPH, Eng C 2000 Somatic and occult germ-line mutations in SDHD, a mitochondrial complex II gene, in non familial pheochromocytoma. Cancer Res 60:6822–6825[Abstract/Free Full Text]
4. Gimenez-Roqueplo AP, Favier J, Rustin P, Mourad JJ, Plouin PF, Corvol P, Rotig A, Jeunemaitre X 2001 The R22X mutation of the SDHD gene in hereditary paraganglioma abolishes the enzymatic activity of the complex II in the mitochondrial respiratory chain and activates the hypoxia pathway. Am J Hum Genet 69:1186–1197[CrossRef][Medline]
5. Dahia PLM 2006 Evolving concepts in pheochromocytoma and paraganglioma. Curr Opin Oncol 18:1–8[Medline]
6. Riemann K, Sotlar K, Kupka S, Braun S, Zenner HP, Preyer S, Pfister M, Pusch CM, Blin N 2004 Chromosome 11 monosomy in conjunction with a mutated SDHD initiation codon in non familial paraganglioma cases. Cancer Genet Cytogenet 150:128–135[CrossRef][Medline]
7. Van der Mey AGL, Maaswinkel-Mooy PD, Cornelisse CJ, Schmidt PH, van de Kamp JJP 1989 Genomic imprinting in hereditary glomus tumours: evidence for new genetic theory. Lancet 2:1291–1294[CrossRef][Medline]
8. Baysal BE 2004 Genomic imprinting and environment in hereditary paraganglioma. Am J Med C Semin Med Genet 129:85–90
9. Morison IA, Ramsay JP, Spencer HG 2005 A census of mammalian imprinting. Trends Genet 21:457–465[CrossRef][Medline]
10. Cascon A, Ruiz-Llorent S, Fraga MF, Leton R, Telleria D, Sastre J, Jose Diez J, Martinez Diaz-Guerra G, Diaz-Perez JA, Benitez J, Esteller M, Robledo M 2004 Genetic and epigenetic profile of sporadic pheochromocytomas. J Med Genet 41:e30
11. Hensen EF, Jordanova ES, van Minderhout IJHM, Hogendoorn PCW, Taschner PEM, van der Mey AGL, Devilee P, Cornelisse CJ 2004 Somatic loss of maternal chromosome 11 causes parent-of-origin-dependent inheritance in SDHD-linked paraganglioma and phaeochromocytoma families. Oncogene 23:4076–4083[CrossRef][Medline]
12. Bauters C, Vantyghem MC, Leteurtre E, Odou MF, Mouton C, Porchet N, Wemeau JL, Proye C, Pigny P 2003 Hereditary phaechromocytomas and paragangliomas: a study of five susceptibility genes. J Med Genet 40:e75
13. Sparago A, Russo S, Cerrato F, Ferraiuolo S, Castorina P, Selicorni A, Schwienbacher C, Negrini M, Ferrero GB, Silengo MC, Anichini C, Larizza L, Riccio A 2007 Mechanisms causing imprinting defects in familial Beckwith-Wiedemann syndrome with Wilms’ tumour. Hum Mol Genet 16:254–264[Abstract/Free Full Text]
14. Vincent A, Perrais M, Desseyn JL, Aubert JP, Pigny P, Van Seuningen I 2007 Epigenetic regulation (DNA methylation, histone modifications) of the 11p15 mucin genes (MUC2, MUC5AC, MUC5B, MUC6) in epithelial cancer cells. Oncogene 26:6566–6576[CrossRef][Medline]
15. Cascon A, Ruiz-Llorente S, Cebrian A, Telleria D, Rivero JC, Diez JJ, Lopez-Ibarra PJ, Jaunsolo MA, Benitez J, Robledo M 2002 Identification of novel SDHD mutations in patients with phaeochromocytomas and /or paraganglioma. Eur J Hum Genet 10:457–461[CrossRef][Medline]
16. Simi L, Sestini R, Ferruzzi P, Gagliano MS, Gensini F, Mascalchi M, Guerrini L, Pratesi C, Pinzani P, Nesi G, Ercolino T, Genuardi M, Mannelli M 2005 Phenotype variability of neural crest derived tumours in six Italian families segregating the same founder SDHD mutation Q109X. J Med Genet 42:e52
17. Gabory A, Ripoche MA, Yoshimizu T, Dandolo L 2006 The H19 gene: regulation and function of a non-coding RNA. Cytogenet Genome Res 113:188–193[CrossRef][Medline]
18. Schiavi F, Boedecker CC, Bausch B, Peczkowska M, Gomez CF, Strassburg T, Pawlu C, Buchta M, Salzmann M, Hoffmann MM, Berlis A, Brink I, Cybulla M, Muresan M, Walter MA, Forrer F, Valimaki M, Kawecki A, Szutkowski Z, Schipper J, Walz MK, Pigny P, Bauters C, Willet-Brozick JE, Baysal BE, Januszewicz A, Eng C, Opocher G, Neumann HP; European-American Paraganglioma Study Group. 2005 Predictors and prevalence of paraganglioma syndrome associated with mutations of the SHDC gene. JAMA 294:2057–2063[Abstract/Free Full Text]
19. Astrom K, Cohen JE, Willett-Brozick JE, Aston CE, Baysal BE 2003 Altitude is a phenotypic modifier in hereditary paraganglioma type 1: evidence for an oxygen-sensing defect. Hum Genet 113:228–237[CrossRef][Medline]
20. Baysal BE, Willett-Brozick JE, Lawrence EC, Drovdlic CM, Savul SA, McLeod DR, Yee HA, Brackmann DE, Slattery 3rd WH, Myers EN, Ferrell RE, Rubinstein WS 2002 Prevalence of SDHB, SDHC and SDHD germline mutations in clinic patients with head and neck paragangliomas. J Med Genet 39:178–183[Abstract/Free Full Text]
21. Liu J, Kahri AR, Heikkila P, Voutilainen R 1997 Ribonucleic acid expression of the clustered imprinted genes, p57kip2, IGF-II and H19 in adrenal tumors and cultures adrenal cells. J Clin Endocrinol Metab 82:1766–1771[Abstract/Free Full Text]
22. Sparago A, Cerrato F, Vernucci M, Ferrero GB, Silengo MC, Riccio A 2004 Microdeletions in the human H19 DMR result in loss of IGF2 imprinting and Beckwith-Wiedemann syndrome. Nat Genet 36:958–960[CrossRef][Medline]

This article has been cited by other articles:

				A. Cascon, G. Pita, N. Burnichon, I. Landa, E. Lopez-Jimenez, C. Montero-Conde, S. Leskela, L. J. Leandro-Garcia, R. Leton, C. Rodriguez-Antona, et al. Genetics of Pheochromocytoma and Paraganglioma in Spanish Patients J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1701 - 1705. [Abstract] [Full Text] [PDF]

				H. P.H. Neumann, Z. Erlic, C. C. Boedeker, L. A. Rybicki, M. Robledo, M. Hermsen, F. Schiavi, M. Falcioni, P. Kwok, C. Bauters, et al. Clinical Predictors for Germline Mutations in Head and Neck Paraganglioma Patients: Cost Reduction Strategy in Genetic Diagnostic Process as Fall-Out Cancer Res., April 15, 2009; 69(8): 3650 - 3656. [Abstract] [Full Text] [PDF]

				M. Peczkowska, Z. Erlic, M. M. Hoffmann, M. Furmanek, J. Cwikla, A. Kubaszek, A. Prejbisz, Z. Szutkowski, A. Kawecki, K. Chojnowski, et al. Impact of Screening Kindreds for SDHD p.Cys11X as a Common Mutation Associated with Paraganglioma Syndrome Type 1 J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4818 - 4825. [Abstract] [Full Text] [PDF]

				B E Baysal Clinical and molecular progress in hereditary paraganglioma J. Med. Genet., November 1, 2008; 45(11): 689 - 694. [Abstract] [Full Text] [PDF]

				H. P.H. Neumann and Z. Erlic Maternal Transmission of Symptomatic Disease with SDHD Mutation: Fact or Fiction? J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1573 - 1575. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pigny, P. Articles by Caron, P. Search for Related Content PubMed PubMed Citation Articles by Pigny, P. Articles by Caron, P. Related Collections Adrenal and Hypertension Cardiovascular Endocrinology Endocrine Oncology