Journal of Clinical Endocrinology & Metabolism
, doi:10.1210/jc.2007-0927
The Journal of Clinical Endocrinology & Metabolism Vol. 93, No. 3 661-665
Copyright © 2008 by The Endocrine Society
A Maternal Epimutation of GNAS Leads to Albright Osteodystrophy and Parathyroid Hormone Resistance
Virginie Mariot1,
Stéphanie Maupetit-Méhouas1,
Christiane Sinding,
Marie-Laure Kottler and
Agnès Linglart
Institut National de la Santé et de la Recherche Médicale U561 (V.M., S.M.-M., C.S., A.L.) and Paediatric Endocrinology (A.L.), Paris V University, St-Vincent de Paul Hospital, 75014 Paris, France; and Department of Genetic and Human Reproduction (M.-L.K.), Centre Hospitalier Universitaire, 14033 Caen, France
Address all correspondence and requests for reprints to: Agnès Linglart, Pediatric Endocrinology and Institut National de la Santé et de la Recherche Médicale U561, Hôpital St-Vincent de Paul, 82 avenue Denfert-Rochereau, 75014 Paris, France. E-mail: agnes.linglart{at}svp.aphp.fr.
 |
Abstract
|
|---|
Context: Pseudohypoparathyroidism (PHP) type Ia is a rare maternally transmitted disease due to maternal loss-of-function mutations of GNAS, the gene encoding G
s, the -stimulatory subunit of the G protein. Affected individuals display hormonal resistance (mainly PTH and TSH resistance) and Albright hereditary osteodystrophy. PHP type Ib (PHP-Ib), usually defined by isolated renal resistance to PTH and sometimes mild TSH resistance, is due to a maternal loss of GNAS exon A/B methylation, leading to decreased Gs expression in specific tissues.
Objective and Results: We report a girl with obvious Albright osteodystrophy features, PTH resistance, normal Gs bioactivity in red blood cells, yet no loss-of-function mutation in the GNAS coding sequence (exons 1–13). The methylation analysis of the four GNAS differentially methylated regions, i.e. NESP, AS, XL, and A/B, revealed broad methylation changes at all differentially methylated regions, including GNAS exon A/B, leading to a paternal epigenotype on both alleles.
Conclusions: This observation suggests that: 1) the decreased expression of Gs due to GNAS epimutations is not restricted to the renal tubule but may affect nonimprinted tissues like bone; 2) PHP-Ib is a heterogeneous disorder that should lead to studying GNAS epigenotype in patients with PHP and no mutation in GNAS exons 1–13, regardless of their physical features.
|
Introduction
|
|---|
The association of hypocalcemia, hyperphosphatemia, and elevated PTH levels in the absence of vitamin D deficiency defines PTH resistance and pseudohypoparathyroidism (PHP). The main form of PHP, PHP type Ia (PHP-Ia), is usually described as the association of Albright hereditary osteodystrophy (AHO) (a collection of physical features such as obesity, brachymetacarpy, brachymetatarsy, short stature, sc ossifications, and some degree of mental retardation) and resistance to hormones sharing a signaling pathway through G protein-coupled receptors (PTH, TSH) (1, 2). Most of the PHP-Ia affected patients carry a maternal loss of function of GNAS, the gene encoding Gs, the -stimulatory subunit of the G protein (3, 4). An approximate 50% decrease in Gs bioactivity was found in the cells of most of these patients (2). Few patients exhibit normal Gs bioactivity with GTP
S (the nonhydrolyzable guanine nucleotide analog) as a stimulant in red blood cells, despite a maternal loss of function mutation at the C terminal part of Gs, likely affecting exclusively the Gs-receptor interaction (4).
In contrast, PHP type Ib (PHP-Ib) is usually characterized by isolated hormonal resistance, mainly PTH and sometimes TSH resistance and the lack of AHO (5). In affected PHP-Ib individuals, Liu et al. (6) identified methylation changes at the GNAS differentially methylated regions (DMRs), including GNAS exon A/B (also referred to as exon 1A), as the cause of the decreased Gs expression in target tissues (renal proximal tubule, thyroid), therefore hormonal resistance. In addition, microdeletions within the STX16 gene (STXdel4–6mat, STXdel2–4mat), located 220-kb upstream of GNAS exon A/B, have been found in most of the patients affected with the autosomal dominant form of PHP-Ib and exhibiting loss of GNAS exon A/B methylation alone (7, 8). Deletions removing both NESP and AS exons (delNEPS55/ASdel3–4mat) of GNAS have been identified in affected individuals of two unrelated families with PHP-Ib and broad GNAS methylation changes (9). The mechanism underlying sporadic PHP-Ib with maternal broad GNAS methylation changes is yet undiscovered (Fig. 1
). Because PHP-Ib appears to be a heterogeneous disorder, we investigated the epigenetic structure of the GNAS gene in a girl presenting with PTH resistance, typical features of Albright osteodystrophy, normal Gs bioactivity with GTPS as a stimulant and no modification of the GNAS coding exons (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13).
View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1. Simplified map of the 20q13.3 region (STX16 and the GNAS locus) and the localization of the known microdeletions causing PHP-Ib. GNAS is a complex imprinted locus yielding, besides Gs, multiple alternative transcripts. These transcripts encode XLs, NESP55, the A/B transcript, and the antisense (AS) transcript. NESP55, XLs, and A/B differ from Gs only by their first exon. AS, XLs, and A/B are paternally derived transcripts, whereas NESP55 is a maternally derived transcript. Consistent with their monoallelic expression, the promoters of these imprinted transcripts are located within DMRs (18 ) (2 ). In contrast, the promoter giving rise to Gs is not methylated, and accordingly, transcripts are derived in most tissues from both parental GNAS alleles. STX16, encoding Syntaxin16, is located 220-kb upstream of GNAS exon A/B and biallelically expressed (8 ). Exons are depicted as blackened rectangles, and direct repeats are shown as striped arrowheads. The deleted regions lie between the brackets; the location of the four DMRs studied are shown (+, methylated; -, unmethylated). Arrows indicate the origin of transcription. cen, Centromeric; Mat or m, maternal; Pat or p, paternal; tel, telomeric; X, XLs.
|
|
|
Methods
|
|---|
The patient gave her informed consent for the genetic and epigenetic analyses.
Molecular analysis of the GNAS gene
Genomic DNA was extracted from blood lymphocytes. The GNAS gene (exons 2–13) was PCR amplified and sequenced as described previously (4). Since the 2002 report (4), we have been able to amplify and sequence the GNAS exon 1 using the following primers: forward, CCTCCCGGCCCGCGTGA, and reverse, CTGCGGGGCGCCCTTCGA. The NESP and A/B regions were amplified from genomic DNA: A/B, forward GTCCGAAGATACGAAACTCC and reverse GCTGCCTAAGAGTTAGCG; and NESP, forward CGAGTCTTAGGCTGCGGAA and reverse ACAAGGAGAATCTGGACGGC.
Characterization of the Gs transcripts
Total RNAs were extracted from blood lymphocytes. After RT, the Gs transcripts were amplified using different primer pairs (exons 1–13, forward GGACAAGCAGGTCTACCG and reverse AGGGTAGCAGTAGTGACGC; exons 4–13, forward CCTGAAAGAGGCGATTGAAA and reverse AAGGTGCATGCGCTGAAT; and exons 1–8, forward AGACCGAGGACCAGCGCAA and reverse AGTCAGGACACGGCAGCGAA) and sequenced. The exons 1–8 PCR products were subcloned in a pcR4-Topo Cloning vector (Invitrogen, Carlsbad, CA) and sequenced using a T7 primer.
Epigenetic characterization of the GNAS DMRs
GNAS DMRs were amplified by PCR from bisulfite-treated genomic DNA as described elsewhere (8). A/B was amplified using the primers: forward TTTTTTTGTTTTAGAGTTTTTAGGG and reverse TAAAAATACAAAACCTCCCCTACTC, then reamplified using the same primers. AS was first amplified using the primers: forward TGTGTATATATTAAGGTTATTAGGTG and reverse AAAAATTTTAATTAAAATTTAATACC, then reamplified using the primers: forward GGTGTGGGTATTTATTTTTGGTTAGT and reverse TAATCAATCAACTCCTTTAACCCC. XL was amplified using the primers: forward GGTAGTTTATTTTAAGAGGTTGTTAGATTT and reverse AAAAAAATACTTTTCCTCCCTCC. NESP was amplified using the primers: forward GAGGATAAAGATTTAAGGGATTT and reverse CTCAAACTCCCCAATTTAAC.
To assess the methylation status of the amplified regions, amplicons were submitted to BstUI digestion or sequenced. The NESP or XL amplicons were subcloned in a pcR4-Topo Cloning vector and sequenced using a T7 primer.
|
Case Report
|
|---|
When she was 10 yr old, the patient had generalized seizure revealing hypocalcaemia (1.4 mM, normal range 2.17–2.57). She was put on calcifediol, and 2 yr later, referred to our clinic for persistent hypocalcaemia. She was born from healthy nonconsanguineous African-American parents. Her siblings are healthy (Fig. 2A).
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2. Patient’s phenotype. A, Height, weight, and body mass index (BMI) of the patient (black circle) and her parents and siblings (white circle and squares, respectively). B, Brachymetacarpy of the fourth and fifth metacarpals.
|
|
She was obese (body mass index > 97th centile at 12 yr and thereafter) with a round face. She controlled her weight gain through dietary adaptation. Her growth and pubertal development were normal [final height of 165 cm (target height of 162.5 cm), corresponding to the mean height of women in France], she had bilateral obvious brachymetacarpia affecting both hands (fourth and fifth metacarpals), and the metatarsals were normal. The x-rays confirmed the brachymetacarpia, showed the absence of distance enlargement between the L1 and L5 vertebral pedicles, and the absence of bone resorption features (Fig. 2B
).
We did not observe ectopic ossification clinically or on hands, feet, and spine x-rays.
None of her siblings or parents had similar bone features.
When she was 12 yr old, her laboratory tests showed: calcemia 2.01 mM, phosphatemia 2.19 mM (normal range 0.8–1.6), and PTH 399 pg/ml (normal range 10–58). After exogenous PTH administration, the urinary cyclical AMP increased inadequately (0.19 nmol/100 ml glomerular filtrate, normal range 0.59–1.99), confirming the PTH resistance. She received alfacalcidol (1--25 (OH)2D3) to prevent convulsions and normalize her blood calcium, phosphorus, and PTH. Despite alfacalcidol, 2 µg daily, she never experienced elevated calciuria and maintained her PTH levels within or close to the normal range. Free T4 and TSH were measured at 12, 18, and 24 yr within the normal range.
Because of the association of Albright osteodystrophy and PTH resistance, PHP-Ia was suspected, the biological activity of Gs was assessed in her red blood cells, as described previously (4), and found identical to control (CTRL) subjects (88% of three CTRL values, normal range 75–100%).
|
Genetic and Epigenetic Findings
|
|---|
The GNAS gene (exons 1–13) was amplified and sequenced (genomic DNA from blood lymphocytes), including the GC-rich exon 1, and no mutation was detected. However, three polymorphisms were identified in the GNAS coding sequence: C/T, position 749 (exon 5) of NM000516; C/T, position 911 (exon 7) of NM000516; and C/T, position 1469 (exon 13) of NM000516 corresponding to the single nucleotide polymorphism rs8386.
In addition, the Gs transcripts were amplified by RT-PCR (exons 1–13) from the patient’s blood lymphocytes (Fig. 3). Direct nucleotide sequence of the Gs transcripts showed heterozygosity at the polymorphic nucleotides 749, 911, and 1469 of the Gs cDNA (the third is known as rs8386), indicating that two different alleles were amplified. Therefore, we have shown that both GNAS alleles are intact and expressed in the patient’s lymphocytes, excluding large scale deletions of the GNAS coding region (exons 1–13). The exons 1–8 PCR amplification of the Gs transcripts were subcloned and sequenced. Eight out of 14 clones carried the T and T (nucleotides 749 and 911 of NM000516, respectively). The remaining six clones carried the C and C nucleotides at the same location.
After bisulfite treatment, GNAS exon A/B, NESP, XL, and AS were amplified and either submitted to enzymatic digestion, or sequenced (Fig. 4). In the absence of methylation, the DNA sequence is modified by the bisulfite, removing the BstUI recognition sites (A/B, AS, NESP, and XL). Unlike the CTRL, and similarly to a PHP-Ib individual, the A/B, XL, and AS patient’s PCR products were not digested, indicating a loss of methylation of the A/B, XL, and AS patient’s maternal allele. Likewise, the NESP patient’s PCR product was almost fully digested, indicating a gain of methylation of the NESP patient’s maternal allele. Direct nucleotide sequencing of the PCR products confirmed these results. The reported patient and the PHP-Ib individual chromatograms showed unmethylated DNA sequences of the A/B, XL, and AS PCR products, and methylated DNA sequences of the NESP PCR products. In summary, we found broad methylation changes of the patient’s GNAS locus corresponding to a paternal epigenotype on both alleles (i.e. loss of GNAS exon A/B, XL, and AS methylation, and gain of NESP methylation).
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4. Characterization of the GNAS broad methylation changes. A, Enzymatic digestion (BstUI) of the PCR amplified bisulfite-treated genomic DNA. The arrow shows the uncut allele (unmethylated); the CH3 arrow shows the cut allele (methylated). The affected PHP-Ib individual as well as the reported patient (Pt) display a loss of exon A/B, AS, and XL methylation, and gain of NESP methylation. B, Chromatograms of the XL PCR products. The PHP-Ib individual and patient chromatograms show unmethylated DNA sequences. On the other hand, the CTRL DNA displays heterozygosity, indicating the presence of two different alleles, one methylated and one unmethylated. C, To quantify the methylation status of the NESP and XL DMRs, the PCR products were subcloned and sequenced (in red, the methylated cytosines). Full circles represent a methylated CpG, and empty circles designate unmethylated CpG. Each row of circles represents a clone. Of the PHP-Ib individual and patient NESP CpG, 99.2% are methylated, whereas only 41.7% of the CTRL NESP CpG are methylated. Of the patient and PHP-Ib individual XL CpG, 10.7 and 7.9% are methylated, respectively, whereas 46.4% of the CTRL XL CpG are methylated.
|
|
As expected, the patient did not carry the STXdel4–6 or the STXdel2–4. No polymorphisms were identified in the NESP and A/B regions of GNAS (59–1114 of NM016592, 1076–2054 of AF246983, respectively). Altogether, she was diagnosed as sporadic PHP-Ib.
|
Discussion
|
|---|
The current report identifies an epigenetic mutation of GNAS in one girl with typical PTH resistance and features of Albright osteodystrophy. Direct nucleotide sequencing of the 13 exons of GNAS as well as amplification of Gs transcripts issued from both alleles excluded the three types of defects usually associated with PHP-Ia: loss-of-function mutations, paternal unidisomy, or large deletions throughout the Gs coding sequence. Because we did not identify any polymorphisms in the A/B or NESP regions, we cannot exclude a deletion in these regions as the cause of the observed paternal epigenotype in this patient. Deletion of the NESP and AS exons, associated with GNAS epigenetic changes, likely removing a regulatory element of GNAS methylation, has been described previously by Bastepe et al. (9).
Findings similar to our patient are currently reported by de Nanclares et al. (10) in five individuals with mild features of Albright osteodystrophy, i.e. shortness of metacarpals, short stature, ectopic ossification, and obesity. Our report confirms that Albright osteodystrophy or at least brachymetacarpia and obesity are not specific symptoms of PHP-Ia, and that the epigenetic status of GNAS should be investigated in patients who show PTH resistance, normal Gs bioactivity in blood cells, and the absence of genetic alteration of the GNAS exons 1–13, regardless of their phenotype.
The imprinting defect observed in our patient results in both alleles having a paternal-specific epigenotype characterized by a dramatic decrease of methylation at exon A/B, XL, and AS promoter regions, therefore, likely biallelic expression of A/B, XL, and AS transcripts. Unfortunately, because XL is not expressed in blood lymphocytes, we were not able to amplify XL transcripts of this patient and identify their parental origin. The cause of this imprinting defect remains to be found. Because paternal expression of Gs is significantly reduced in the thyroid, mild TSH resistance may appear in some patients with imprinting defects of the GNAS gene (5). Our patient does not exhibit TSH resistance so far. In such patients, the residual Gs expression from both paternal imprinted alleles seems to allow a sufficient TSH signaling in thyroid cells. In addition, the potential increase in XLs expression, a GNAS product known to share with Gs the ability to increase cAMP production through the stimulation of the TSH receptor (11, 12), may compensate for the lack of Gs.
In addition, the NESP promoter region appears fully methylated in our patient and may result in a dramatic decrease of the NESP-specific transcripts. In humans, a specific role for the NESP transcript (expressed in adrenals and brain) has not yet been reported, and individuals with PHP-Ib do not seem to have detectable adrenal or neurological abnormalities (13, 14).
Animal studies show that Gs is biallelically expressed in chondrocytes and osteoblasts, and that despite the absence of bone phenotype in Gs-haploinsufficient mice (15, 16), chondrocytes with targeted monoallelic disruption of GNAS undergo premature hypertrophy (17). These data suggest that the PHP-Ia bone phenotype is related to a decrease of Gs expression in the growth plate. Some features of AHO, particularly brachydactyly and obesity, have now been observed in a small number of PHP-Ib patients, suggesting that imprinting defects of the GNAS gene may affect Gs expression in imprinted tissues (renal proximal tubule and thyroid) and in bone.
|
Acknowledgments
|
|---|
We thank the patient for her kind contribution to this report. We also thank Pr. Bougnères for his critical review and editorial help.
|
Footnotes
|
|---|
Disclosure Summary: The authors have nothing to declare.
First Published Online January 8, 2008
1 V.M. and S.M.-M. contributed equally to this work and should be regarded as joint first authors. 
Abbreviations: AHO, Albright hereditary osteodystrophy; CTRL, control; DMR, differentially methylated region; PHP, pseudohypoparathyroidism; PHP-Ia, PHP type Ia; PHP-Ib, PHP type Ib.
Received April 24, 2007.
Accepted December 20, 2007.
|
References
|
|---|
- Albright F, Burnett CH, Smith PH, Parson W 1942 Pseudohypoparathyroidism–an example of "Seabright-Bantam syndrome." Endocrinology 30:922–932
- Weinstein LS, Yu S, Warner DR, Liu J 2001 Endocrine manifestations of stimulatory G protein -subunit mutations and the role of genomic imprinting. Endocr Rev 22:675–705[Abstract/Free Full Text]
- Weinstein LS, Gejman PV, Friedman E, Kadowaki T, Collins RM, Gershon ES, Spiegel AM 1990 Mutations of the Gs-subunit gene in Albright hereditary osteodystrophy detected by denaturing gradient gel electrophoresis. Proc Natl Acad Sci USA 87:8287–8290[Abstract/Free Full Text]
- Linglart A, Carel JC, Garabedian M, Le T, Mallet E, Kottler ML 2002 GNAS1 lesions in pseudohypoparathyroidism Ia and Ic: genotype phenotype relationship and evidence of the maternal transmission of the hormonal resistance. J Clin Endocrinol Metab 87:189–197[Abstract/Free Full Text]
- Liu J, Erlichman B, Weinstein LS 2003 The stimulatory G protein -subunit Gs is imprinted in human thyroid glands: implications for thyroid function in pseudohypoparathyroidism types 1a and 1b. J Clin Endocrinol Metab 88:4336–4341[Abstract/Free Full Text]
- Liu J, Litman D, Rosenberg M, Yu S, Biesecker L, Weinstein L 2000 A GNAS1 imprinting defect in pseudohypoparathyroidism type Ib. J Clin Invest 106:1167–1174[Medline]
- Bastepe M, Fröhlich LF, Hendy GN, Indridason OS, Josse RG, Koshiyama H, Korkko J, Nakamoto JM, Rosenbloom AL, Slyper AH, Sugimoto T, Tsatsoulis A, Crawford JD, Jüppner H 2003 Autosomal dominant pseudohypoparathyroidism type Ib is associated with a heterozygous microdeletion that likely disrupts a putative imprinting control element of GNAS. J Clin Invest 112:1255–1263[CrossRef][Medline]
- Linglart A, Gensure RC, Olney RC, Juppner H, Bastepe M 2005 A novel STX16 deletion in autosomal dominant pseudohypoparathyroidism type Ib redefines the boundaries of a cis-acting imprinting control element of GNAS. Am J Hum Genet [Erratum (2007) 81:196] 76:804–814[CrossRef]
- Bastepe M, Fröhlich LF, Linglart A, Abu-Zahra HS, Tojo K, Ward LM, Jüppner H 2005 Deletion of the NESP55 differentially methylated region causes loss of maternal GNAS imprints and pseudohypoparathyroidism type Ib. Nat Genet 37:25–27[CrossRef][Medline]
- de Nanclares GP, Fernandez-Rebollo E, Santin I, Garcia-Cuartero B, Gaztambide S, Menendez E, Morales MJ, Pombo M, Bilbao JR, Barros F, Zazo N, Ahrens W, Juppner H, Hiort O, Castano L, Bastepe M 2007 Epigenetic defects of GNAS in patients with pseudohypoparathyroidism and mild features of Albright’s hereditary osteodystrophy. J Clin Endocrinol Metab 92:2370–2373[Abstract/Free Full Text]
- Bastepe M, Gunes Y, Perez-Villamil B, Hunzelman J, Weinstein LS, Jüppner H 2002 Receptor-mediated adenylyl cyclase activation through XLs, the extra-large variant of the stimulatory G protein -subunit. Mol Endocrinol 16:1912–1919[Abstract/Free Full Text]
- Linglart A, Mahon MJ, Kerachian MA, Berlach DM, Hendy GN, Juppner H, Bastepe M 2006 Coding GNAS mutations leading to hormone resistance impair in vitro agonist- and cholera toxin-induced adenosine cyclic 3',5'-monophosphate formation mediated by human XLs. Endocrinology 147:2253–2262[Abstract/Free Full Text]
- Ischia R, Lovisetti-Scamihorn P, Hogue-Angeletti R, Wolkersdorfer M, Winkler H, Fischer-Colbrie R 1997 Molecular cloning and characterization of NESP55, a novel chromogranin-like precursor of a peptide with 5-HT1B receptor antagonist activity. J Biol Chem 272:11657–11662[Abstract/Free Full Text]
- Plagge A, Isles AR, Gordon E, Humby T, Dean W, Gritsch S, Fischer-Colbrie R, Wilkinson LS, Kelsey G 2005 Imprinted Nesp55 influences behavioral reactivity to novel environments. Mol Cell Biol 25:3019–3026[Abstract/Free Full Text]
- Yu S, Yu D, Lee E, Eckhaus M, Lee R, Corria Z, Accili D, Westphal H, Weinstein LS 1998 Variable and tissue-specific hormone resistance in heterotrimeric Gs protein -subunit (Gs) knockout mice is due to tissue-specific imprinting of the Gs gene. Proc Natl Acad Sci USA 95:8715–8720[Abstract/Free Full Text]
- Germain-Lee EL, Schwindinger W, Crane JL, Zewdu R, Zweifel LS, Wand G, Huso DL, Saji M, Ringel MD, Levine MA 2005 A mouse model of albright hereditary osteodystrophy generated by targeted disruption of exon 1 of the Gnas gene. Endocrinology 146:4697–4709[Abstract/Free Full Text]
- Bastepe M, Weinstein LS, Ogata N, Kawaguchi H, Jüppner H, Kronenberg HM, Chung UI 2004 Stimulatory G protein directly regulates hypertrophic differentiation of growth plate cartilage in vivo. Proc Natl Acad Sci USA 101:14794–14799[Abstract/Free Full Text]
- Hayward B, Kamiya M, Strain L, Moran V, Campbell R, Hayashizaki Y, Bonthron DT 1998 The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins. Proc Natl Acad Sci USA 95:10038–10043[Abstract/Free Full Text]
Top
Abstract
Introduction
