help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2007-1918
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giordano, M.
Right arrow Articles by Momigliano-Richiardi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giordano, M.
Right arrow Articles by Momigliano-Richiardi, P.
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 93, No. 3 1005-1012
Copyright © 2008 by The Endocrine Society

A Functional Common Polymorphism in the Vitamin D-Responsive Element of the GH1 Promoter Contributes to Isolated Growth Hormone Deficiency

Mara Giordano, Michela Godi, Simona Mellone, Antonella Petri, Daniela Vivenza, Luigi Tiradani, Yari Carlomagno, Daniela Ferrante, Teresa Arrigo, Ginevra Corneli, Simonetta Bellone, Francesca Giacopelli, Claudio Santoro, Gianni Bona and Patricia Momigliano-Richiardi

Department of Medical Sciences and Interdisciplinary Research Center of Autoimmune Diseases (M.Gi., M.Go., S.M., L.T., Y.C., D.F., C.S., P.M.-R.), and Unit of Pediatrics (A.P., D.V., G.C., S.B., G.B.), Department of Medical Sciences, University of Eastern Piedmont, 28100 Novara, Italy; Department of Pediatrics (T.A.), University of Messina, 98100 Messina, Italy; and Laboratory of Molecular Genetics (F.G.), Institute G. Gaslini and Department of Pediatrics and Center of Excellence for Biomedical Research, University of Genova, 16100 Genova, Italy

Address all correspondence and requests for reprints to: Mara Giordano, Laboratory of Human Genetics, Department of Medical Sciences, University of Eastern Piedmont, Via Solaroli 17, 28100 Novara, Italy. E-mail: mara.giordano{at}med.unipmn.it.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Causal mutations have been detected only in a minority of isolated GH deficiency (IGHD) patients. Idiopathic IGHD might be the result of the interaction between several low-penetrance genetic factors and the environment.

Objective: The aim of this study was to test the contribution to IGHD of genetic variations in the GH1 gene regulatory regions.

Design and Patients: A case-control association study was performed including 118 sporadic IGHD patients with a nonsevere phenotype (height –4/–1 SD score and partial GH deficiency) and two control groups, normal stature (n = 200) and short-stature individuals with normal GH secretion (n = 113). Seven single-nucleotide polymorphisms in the GH1 promoter, one in the IVS4 region, and two in the locus control region were analyzed.

Results: The –57T allele within the vitamin D-responsive element showed a positive significant association when comparing patients with normal (P = 0.006) or short stature (P = 0.0011) controls. The genotype –57TT showed an odds ratio of 2.93 (1.44–5.99) and 2.99 (1.42–6.31), respectively. The functional relevance of the –57 variation was demonstrated by the luciferase assay in the presence of vitamin D. The vitamin D-induced inhibition of luciferase activity was significantly (P = 0.012) stronger for the promoter haplotype carrying the associated variation –57T [haplotype #1 (hp#1)] with respect to hp#2, bearing –57G. Replacement of the T with a G at –57 on hp#1 abolished the repression, demonstrating that the T at position –57 is necessary to determine the greater vitamin D-induced inhibitory effect of hp#1. EMSA experiments showed a different band-shift pattern of the T and G sequences.

Conclusion: The common –57G->T polymorphism contributes to IGHD susceptibility, indicating that it may have a multifactorial etiology.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
High-penetrance mutations in the GH1 gene have been found in severe and in familial forms of isolated GH deficiency (IGHD) (1, 2). However, most IGHD subjects present with a nonsevere GH deficiency (GHD) (3), no family history, and no deleterious mutations in the GH1 coding sequence or in other genes known to be involved in GH production (e.g. GHRHR) (4). The pathogenic mechanisms for this idiopathic IGHD have not as yet been clarified. In the present paper, we considered the hypothesis that IGHD, especially when excluding extreme phenotypes, can be determined by the interaction of several low-penetrance genetic factors and the environment rather than by the presence of a major-effect mutation, thus behaving as a multifactorial trait.

GH secretion is dependent on a complex network of intracellular and extracellular signals that regulate the hormone synthesis and release. The regulation of GH1 gene expression has been characterized in detail, and both ubiquitous and pituitary-specific cis/trans elements have been identified in the GH1 proximal promoter (Fig. 1Go). Transcriptional factors controlling the GH1 basal expression include nuclear factor-1 (NF-1) (5), specific protein-1 Sp1 (6), Zn-15 (7), vitamin D receptor, (8), and cAMP response element-binding protein CREB, a protein that interacts with cAMP-responsive elements (9). The pituitary-restricted GH1 expression is mainly controlled by the pituitary-specific factor Pit-1 (10), a POU-homeodomain protein, which binds to two highly conserved elements in the GH1 proximal promoter. Three additional Pit-1 binding sites in a locus control region (LCR) located 14.5 kb upstream the GH1 gene are necessary to confer high-level somatotropic-specific GH expression (11).


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 1. Location and pairwise LD values of the SNPs in the GH1 gene and the 14.5-kb upstream LCR tested for association with IGHD. The promoter SNPs are numbered considering +1 the first transcribed nucleotide and the IVS4 SNP is the IVS4 90th nucleotide (according to the sequence with accession number M13438, http://www.ncbi.nlm.nih.gov/). The LCR SNPs are numbered according to the sequence AF010280. The position of the binding sites for transcriptional factors is shown. Reported LD values were calculated in normal-stature controls. D' values are shown in the boxes. D' values = 100 are indicated as empty boxes. The r2 value is indicated by the box color intensity.

 
The GH1 proximal promoter is highly polymorphic, with 15 single-nucleotide polymorphisms (SNPs) in the 500 bp upstream of the transcription initiation site (12, 13), giving rise to at least 40 different haplotypic combinations (14).

Functional studies suggest that the GH1 promoter polymorphisms might influence the circulating GH level through their effect on transcription regulation. It has been shown that the different promoter haplotypes induce a 12-fold range of expression level in a reporter gene assay (14). We recently demonstrated that the GH1 promoter variation –75A->G, within the proximal Pit-1 binding site, influences the transcription in vitro, although it is not associated with a pathologically decreased GH secretion in vivo (15).

The involvement of GH1 polymorphisms has been investigated and found in several pathological conditions, including breast and colorectal cancer (16, 17, 18, 19, 20), accelerated bone loss (21), hypertension and stroke (22). Conversely, the only reported association study between GH1 polymorphisms and IGHD was performed in a small cohort of Japanese patients with mild GH deficiency in which the A allele of the intronic SNP IVS4+90A->T was significantly increased with respect to individuals with normal GH secretion (23).

Here we report the first systematic association study with GH1 SNPs in a Caucasoid population of idiopathic sporadic IGHD patients and matched controls. The selected cases presented with a nonsevere form of IGHD. A significant association with IGHD of a polymorphism within the vitamin D receptor (VDR)-binding element (VDRE) was detected. Functional analysis demonstrated that this variation has a significant influence on the transcriptional activity of the GH1 promoter.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

A total of 118 sporadic patients with IGHD, 113 short-stature individuals with normal GH secretion (normal short), and 200 normal-stature individuals, all belonging to the Italian population, were included in the genetic association analysis. The IGHD patients and normal-stature controls in part overlap with those included in a previous work (15).

The short-stature subjects were referred to the clinical centers because they had a height less than or equal to –2 SD score (SDS) (24) and/or a height velocity over 1 yr of less than –1.5 SDS. Patients with a known postnatal cause of acquired hypopituitarism were excluded. Skeletal maturation was estimated as bone age (radius, ulna, and short bone) (25) by an auxologist. The clinical, auxological, and radiological characteristics of the included subjects are shown in Table 1Go. They were all evaluated for GH serum level either after two consecutive classical provocative tests (with arginine or clonidine or insulin) or after one double stimulus with GHRH plus arginine (26). Traditionally, a diagnosis of GHD is supported by GH peaks less than 10 ng/ml after both consecutive stimuli (27) or less than 20 ng/ml after the double provocative test (26). On this basis, 118 subjects were diagnosed as GHD and 113 as short-stature individuals with normal GH secretion (normal short). The short stature in the latter was classified as familial short stature (n = 31), idiopathic short stature (n = 73), and constitutional delay of growth (n = 9). The GHD patients had a mean secretion peak of 4.2 ± 2.2 ng/ml after the single stimuli (n = 103) or 9.2 ± 5.7 ng/ml after the double provocative test (n = 15). Normal short individuals displayed a GH peak of more than 10 ng/ml after stimulus with either arginine or clonidine or insulin or more than 20 ng/ml after the GHRH+arginine test. A possible miscategorization of patients with a borderline phenotype cannot be excluded.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Clinical characteristics of the patients at the time of diagnosis

 
None of the GHD patients was deficient for other pituitary hormones, had a documented family history of the disease or consanguineous parents, or carried deleterious mutations in the GH1 and GHRHR genes.

Fifty-six IGHD patients underwent pituitary magnetic resonance imaging, and 33 of them had an abnormal finding (most of the images revealed pituitary hypoplasia and some ectopic posterior pituitary). None of the normal short underwent MRI, because of lack of any clinical indication.

The normal-stature control individuals included university and hospital staff and medical students and were not tested for GH secretion levels.

A written informed consent was obtained from the patients’ parents and from the normal-stature controls.

PCR amplification and sequencing

A 2.7-kb specific GH1 fragment was amplified from genomic DNA with primers 5'-CCAGCAATGCTCAGGGAAAG-3' (forward) and 5'-TGTCCCACCGGTTGGGCATGGCCAGGTAGCC-3' (reverse) and used as template for a nested PCR with primers 5'-TTAAACATGCGGGGAGGAA-3' (forward) and 5'-GCCCCCGTCCCATCTACAGGT-3' (reverse) that amplify the GH1 gene from –397 to +148 (considering +1 the transcription initiation; sequence M13438, http://www.ncbi.nlm.nih.gov/).

The LCR was amplified with primers 5'-TCAATATTTTCTGGGGTACAGG-3' (forward) and 5'-CTAGGCCTCGGACCTGATA-3' (reverse) from nucleotides 913-1593 of the sequence AF010280 (28).

The promoter and LCR fragments were directly sequenced using an automated ABI PRISM 3100 sequencer (Applied Biosystems, Foster City, CA).

The IVS4 fragment was amplified with primers 5'-CCCACTGACTTTGAGAGCTG-3' and 5'-CATGTCCTTCCTGAAGCAGT-3' from the 2.7-kb amplicon and the IVS4+90A->T polymorphism was genotyped by denaturing HPLC heteroduplex analysis on a Transgenomic HPLC Instrument (29) at a column temperature of 59.9 C with a 58–68% gradient of buffer B (25% acetonitrile, 01 M triethylamine acetate supplied by Transgenomic, Omaha, NE).

SNPs 990G->A and 1144A->C in the LCR were genotyped by the SNaPshot method (Applied Biosystems) following the manufacturers’ instructions using the internal primer 5'-ATTTCTGAGATTTTAGC-3' and 5'GCACACGTGTTTGTGGGGGG3', respectively. The reactions were visualized on the automated ABI PRISM 3100 sequencer (Applied Biosystems).

Plasmid construction and transfection

GH1 promoter haplotypes #1 and #2 (hp#1 and #2) were cloned into the luciferase reporter vector pGL3 basic (Promega, Madison, WI) as previously described (15). The construct bearing hp#1 was used as the template into which the T at –57 was substituted with a G (hp#1-MUT1) and the G at –278 was substituted with a T (hp#1-MUT2) using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

The haplotype activity was evaluated by transfection in the MCF-7 human breast adenocarcinoma cell line (American Type Culture Collection, Rockville, MD). A total of 1.5 x 105 cells grown in DMEM (Life Technologies, Inc., Rockville, MD) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin were seeded into six-well tissue culture plates in 2.0 ml medium and allowed to attach overnight. Transient transfections were carried out using 1 µg of each construct with Fugene 6 (Roche Diagnostics, Indianapolis, IN). Twenty-four hours after transfection, the cells were washed with PBS and cultured in serum-free medium supplemented with 500 nM 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] (Sigma-Aldrich, St. Louis, MO) or an equal volume of vehicle (ethanol). After 48 h, the cells were lysed with the buffer of the Luciferase Assay System (Promega). The luciferase activities were measured using a luminometer (Anthos Lucy1; BioTek, Winooski, VT) and normalized with respect to protein concentration (Bradford assay; Bio-Rad, Hercules, CA).

EMSA

Nuclear extracts were prepared from MCF7 cells grown for 48 h in serum-free medium containing 500 nM 1,25(OH)2D3 using the Nuclear Extract Kit (Active Motif, Rixensart, Belgium).

Double-stranded oligonucleotides were labeled with {gamma}-[32P]ATP using a T4 polynucleotide kinase (Promega) and purified on a Microspin G-25 column. Five micrograms of nuclear extract were incubated 30 min in binding buffer [20 mM HEPES (pH 7.9), 0.2 mM EDTA, 1 mM dithiothreitol, 50 mM KCl, 2 µg poly(dIdC), 10% glycerol, 0.5 mM phenylmethylsulfonyl fluoride] with 15 fmol of the 32P-labeled probes. The reaction mixtures were run on a 5% nondenaturing polyacrylamide gel (19:1 acrylamide to bisacrylamide) in a 0.25x Tris-boric acid running buffer at 100 V for 2.5 h.

Statistical analysis

The association analysis was performed by binary logistic regression adjusted for sex. The strength of the association was evaluated by the odds ratio (OR) with 95% confidence intervals (CI). Statistical significance was assessed by the likelihood ratio test. When not specified, the reported P values were not corrected for the number of comparisons. Analyses were carried out using SAS version 8.01 and STATA version 8.

Pairwise linkage disequilibria (LD) between SNPs were calculated by D' and r2 using the Haploview program version 3.2. The same software was used to estimate the haplotype structures and their frequencies from unphased genotype data.

The t test was used to compare the distribution of age, height SDS, bone age SDS, target corrected height SDS, and mean growth velocity SDS between IGHD and normal short.

The transfection experiment data are represented as the mean ± SD. All values are expressed as a percentage of the hp#1 mean value. The Mann-Whitney U test was used to compare the relative luciferase activity between two groups.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Association between GH1 SNPs and IGHD

The GH1 region including the proximal promoter, the 5'-untranslated region, and exon 1 were sequenced in 118 unrelated short-stature individuals with IGHD, 200 normal-stature individuals, and 113 short-stature individuals with normal GH secretion (normal short). Fourteen SNPs were detected, namely –308G->T (rs1811081), –301G->T (rs2011732), –278T->G (rs2005171), –168G->T (rs2727338), –75A->G (rs11568828), –57G->T (rs2005172), –31delG (rs41299067), –6A->G (rs6171), –1A->T->C (rs695), +3C->G (rs6175), +16A->G (rs282699), +25A->C (rs6172), +59A->C (rs6173), and Thr3Ala (rs2001345), corresponding to those already described in this region (12, 13, 14, 16, 30). All the individuals were also genotyped for the IVS4 polymorphism IVS4+90A->T (rs2665802).

Only SNPs with minor allele frequency higher than 2% were considered (Fig. 1Go). Their pairwise LD values are shown in Fig. 1Go. Because an almost perfect LD was observed between polymorphisms at –308 and –301, (D' = 0.98; r2 = 0.9), only one of them, namely –308G->T, was tested for association.

Allele frequencies of the eight selected SNPs were compared between IGHD, normal-stature, and normal short individuals. Four alleles (–278G, –57T, –1A, IVS4+90T) showed a nominally significant positive association with IGHD when comparing patients with normal-stature individuals. Of these, only the association with the –57T allele remained significant when P values were corrected for the number of analyzed SNPs (n = 8; corrected P = 0.048). The association with –57T was confirmed (corrected P = 0.008) when the patients were compared with normal short individuals, which represent an independent pediatric control group matched for stature (Table 1Go).

Genotype frequencies were consistent with those expected from Hardy-Weinberg equilibrium for all the tested SNPs in the three panels. The overall genotype distribution was significantly different between IGHD and normal-stature controls for –278T->G, –57G->T, and IVS4+90A->T (Table 2Go). An OR value higher than 1 was observed only for the homozygous genotypes –278GG (OR = 2.15), –57TT (OR = 2.93), and IVS4+90TT (OR = 1.99), suggesting a recessive effect of the associated variations. Only the association with –57 was confirmed when comparing the IGHD genotype distribution with that of normal short controls (Table 2Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Comparison of genotype frequencies of associated GH1 SNPs in IGHD patients and normal-stature and normal short controls

 
When considering the haplotypic combinations of the –278T->G, –57G->T and IVS4+90A->T SNPs, the GTT combination (hp#1; Table 3Go) was the commonest in the patients (42.9%) and the second most common in both control groups (29.4 and 26.5%). Notably, this haplotype was more significantly associated with IGHD than the allele –57T when comparing the patients both with normal-stature (P = 6.5 x 10–4) and with normal short (P = 3.6 x 10–4) controls. The homozygous diplotype #1/1 was present in 22.0% IGHD vs. 6.5% normal stature (P = 9.0 x 10–5; OR = 4.07; 95% CI = 1.90–8.80) and 8.8% normal short individuals (P = 9.8 x 10–5; OR = 2.91; 95% CI = 1.26–6.86).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Comparison of haplotype frequencies in IGHD patients and normal-stature and normal short controls

 
Association between LCR SNPs and IGHD

Previous reports show that LD in the GH1 gene extends to the LCR located 14.5 kb upstream to GH1 (Fig. 1Go) (14, 20). To test whether the association with the –57G->T SNP was secondary to an association with a causal variation in the LCR, we screened 50 IGHD patients, including 15 hp#1/1 homozygotes, and 20 normal-stature controls for sequence variations in the LCR between nucleotides 911 and 1593 including the three Pit-1 binding sites. We detected three common SNPs already described in this region, namely 990G->A, 1144A->C, and 1194C->T (14), and two rare variations (1497C->T in one patient and 1498G->C in one control), none of which fall within Pit-1 sites. The polymorphisms at positions 1144 and 1194 were in perfect LD, as described (14, 20). All the IGHD patients and the two control panels were thus genotyped for 990G->A and 1144A->C. No association with IGHD was detected, either considering allele or genotype frequencies or their haplotypic combinations. LD values of the two LCR with the GH1 SNPs are shown in Fig. 1Go. A strong LD was detected between the GH1 hp#1 and the LCR haplotype 990G, 1144A (D' = 0.95; r2 = 0.56). The inclusion of the LCR SNPs did not increase the strength of the association with hp#1 or the #1/1 diplotype.

Functional analysis of the GH1 promoter haplotypes

The functional relevance of the associated haplotype was tested through its capacity of modulating the expression of a reporter gene (luciferase) after transfection in the mammary adenocarcinoma MCF7 cell line. This is a human lineage expressing both GH and VDR and largely used as a model to study GH1 gene expression (8, 31). Two pGL3-based plasmids were constructed harboring either the IGHD-associated hp#1 or the hp#2 haplotypes. These haplotypes differ at positions –278, –57, and –6 (Fig. 2Go). The polymorphism at –278 lies in a NF-1 target element needed for transactivation (5), whereas the –57 polymorphism lies in a sequence bound by the VDR and involved in the vitamin D-dependent repression of GH expression (8). The VDR binds to its DNA cognate site after activation by its ligand, the metabolite of vitamin D, 1,25(OH)2D3. Thus, we analyzed the transcription activity of the two constructs both in the presence and absence of 1,25(OH)2D3. Vitamin D treatment repressed the activity of both GH1 promoters (Fig. 2Go), confirming the direct involvement of activated VDR in the control of GH1 gene expression. However, the promoter carrying the IGHD-associated hp#1 was significantly (P = 0.012) and consistently more repressed than hp#2. Because the difference was observed only in the presence of 1,25(OH)2D3, we hypothesized that this was due to the SNP –57 within the VDRE. To validate this hypothesis, hp#1 was mutagenized by replacing the –57T with a G (hp#1-MUT1), and the activity of this in vitro created haplotype, which differed from hp#1 only at position –57, was compared with that of hp#1 (Fig. 2Go). As a control, the same comparison was done with hp#1 mutagenized only at position –278 by replacing the G with a T (hp#1-MUT2). In the absence of 1,25(OH)2D3, both mutagenized promoters showed an activity comparable to that of hp#1. Conversely, in the presence of 1,25(OH)2D3, hp#1-MUT1 was no longer inhibited, whereas hp#1-MUT2 did not differ from hp#1.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 2. Reporter gene assay of pGL3-hp#1 and pGL3hp#2 constructs and of pGL3-hp#1 mutagenized at position –57 (hp#1-MUT1) or –278 (hp#1-MUT2) transfected into MCF7 cells, performed in the presence of 1,25(OH)2D3 (black histograms) or ethanol (gray histograms). On the left are reported the positions at which the promoter haplotypes differ. The mutagenized nucleotide on hp#1-MUT1 and hp#1-MUT2 is indicated as a filled rectangle. The transcriptional activity of the reporter constructs is normalized to that of hp#1 in the absence of 1,25(OH)2D3. Figures are the mean ± SD of the normalized activity from four experiments done in triplicate.

 
These results clearly demonstrate that the T at position –57 is necessary for the vitamin D-induced reduction of the transcriptional activity in the hp#1 context and consequently is responsible for the greater, vitamin D-induced inhibitory effect of this haplotype.

EMSA

To determine whether the SNP at –57 affects the binding of VDR to the GH1 VDRE site, we performed EMSA using vitamin D-treated MCF7 nuclear extracts and probes corresponding to the GH1 VDRE sequence containing either the T or the G at position –57 (–57T and –57G oligos, respectively; Fig. 3Go). As controls, we used a high-affinity VDRE consensus sequence (VDRE cons) and a related sequence modified at conserved positions [VDRE mutant sequence (VDRE mut)].


Figure 3
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 3. EMSA performed with nuclear extract from MCF7 cells grown in the presence of vitamin D. Labeled probes used for the EMSA are indicated in the lower part of the figure. They include the two allelic sequences spanning position –57 (–57T, 5'-AGGTGGGGTCAACAGTGGGA-3', and –57G, 5'-AGGTGGGGGCAACAGTGGGA-3') and two control sequences, namely a consensus VDR binding sequence (VDRE cons oligo: 5'-AGCTTCAGGTCAAGGAGGTCAGAGAGC-3') and a VDRE mutant oligonucleotide (VDRE mut oligo: 5'-AGCTTCAGAACAAGGAGAACAGAGAGC-3'). For competition experiments, the radiolabeled probes were incubated with increasing amounts of the unlabeled probes. The cold oligos used as competitors and their molar excess with respect to the labeled probes are indicated in the upper part of the figure. The complexes formed by the labeled probes are indicated as C1, C2, and C3. Results suggest that VDR is likely contained in the more slowly migrating C3 complex. In fact, the C3 complex was formed in the presence of the VDRE cons probe (lane 2) but not of VDRE mut (lane 1) and binding to the VDRE cons probe was efficiently competed by VDRE cons (lanes 3–6) but not by VDRE mut (lanes 7–10). When the nuclear extract was incubated with the two allelic sequences at position –57, the C3 complex was formed in the presence of –57T (lane 12) but not of –57G (lane 19). When binding to the –57T probe was challenged with competitor DNAs, the C3 complex was efficiently competed by the –57T (lanes 13–15) and the VDRE cons (lanes 20–22) oligos but not by –57G (lanes 16–18) and VDRE mut (lanes 23–25).

 
Three complexes (C1–3) were observed with the VDRE cons probe (Fig. 3Go, lane 2). C1 and C2 are likely nonspecific complexes. In fact, C2 bound both the VDRE cons and the VDRE mut probes (Fig. 3Go, lanes 1 and 2), and both complexes were similarly titrated by the VDRE cons and VDRE mut competitors only at a high molar excess (Fig. 3Go, lanes 3–6 and 7–10). In contrast, complex C3 was specifically competed by VDRE cons but not by VDRE mut cold oligos (Fig. 3Go, lanes 3–6 and 7–10), indicating that this shifted band results from specific binding of the VDR present in the MCF7 cell extract. Three complexes with the same electrophoretic mobility as C1–C3 were observed with the –57T probe (Fig. 3Go, lane 12). Notably, the slower migrating C3-like complex was not detectable with the –57G probe (Fig. 3Go, lane 19). The binding properties of these complexes were characterized by competition. Binding of the C3 complex to the –57T probe was efficiently competed by the –57T (lanes 13–15) but not by the –57G cold oligo (lanes 16–18), even in the presence of a 200-fold excess of –57G competitor (data not shown). In contrast, C1 and C2 complexes were not titrated by either competitor DNA, suggesting that they are either nonspecific binding complexes or complexes with a low affinity for the GH1 VDRE sequence (see below). To confirm that the C3 complex contains VDR activity, we challenged its binding to the –57T probe by VDRE cons or VDRE mut competitor DNAs (Fig. 3Go, lanes 20–25). The C3 complex was efficiently and specifically competed by the VDRE cons DNA, demonstrating that the VDRE cons and the –57T oligos bind the same proteins in this complex. However, the VDRE cons binding affinity was higher than that of the –57T sequence as indicated by the different molar excess of the VDRE cons competitor needed to abolish the C3 complex formed by the VDRE cons and –57T probes (Fig 3Go, lanes 4 and 22, respectively). In addition, it must be noted that the binding of complex C2 to the –57T probe was competed by a relatively low amount of the high-affinity VDRE cons oligo (lane 22), indicating that this complex might also contain VDR, but in a form binding the GH1 VDRE element with a lower affinity (e.g. as a heterodimer complexed with other factors).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Causal mutations have been detected in a minority of IGHD patients (32). We tested the hypothesis that low-penetrance genetic variations with a quantitative effect on GH1 transcription might contribute to IGHD. We thus performed an association study between GH1 polymorphisms and IGHD in the Italian population. The included IGHD patients were all sporadic, and most of them presented with a partial GHD.

We detected a positive association with IGHD of the –57T allele and of two alleles, namely –278G and IVS4+90T, in strong LD with it. Contrary to our results, a significant association was detected in the Japanese population with the IVS4+90 allele A, that the authors described to be in complete LD with the alleles –278T and –57G (23). Thus, in the Italian and Japanese population, the association with IGHD concerned different haplotypes, corresponding to our hp#1 and -#2, respectively (Table 3Go). The discrepant results obtained in the Japanese population could be driven by another causal variation, in LD with the IVS4+90 allele A, which arose independently in the Japanese population. However, it must also be considered that the Japanese patient cohort was small (43 patients) and was recruited with less stringent inclusion criteria than ours.

Our results, both from the association analysis and from functional experiments, point to a primary involvement of the –57T sequence in the VDRE for the low GH production of the IGHD patients.

The VDRE in the human GH1 promoter acts as a negative regulator of GH1 transcription (8). It is an imperfect direct repeat [GGG(T/G)CAACAGTGGGA] separated by three bases that binds to a homodimeric VDR complex (8). The –57 SNP corresponds to position 4 of the 5' half-site, which is occupied by a T in the majority of the VDREs in different human gene promoters (33). This highly conserved base forms a hydrogen bond with Glu42 in the activated VDR, as indicated by crystallographic studies of the VDR complexed to the VDRE in the mouse osteopontin promoter (that has a 5' half-site very similar to that of the human GH1) (34). The determining role of position –57 in the GH1 promoter VDRE function is demonstrated by our data showing the higher vitamin D-induced inhibition of the transcriptional activity in the presence of the T vs. the G sequence in this site (Fig. 2Go). Actually, the substitution by site-specific mutagenesis of the T with a G at position –57 on the hp#1 context completely abolished the vitamin D-induced inhibitory response of this haplotype (Fig. 2Go). The functional relevance of the –57 sequence was also indicated by EMSA (Fig. 3Go) showing that the T and the G alleles had a different protein-binding affinity.

According to functional data, the –57T allele was significantly associated with IGHD when compared both with normal-stature and with normal short controls. Individuals homozygous for the –57T allele had an almost 3-fold increased risk of IGHD (Table 2Go). The risk was somewhat increased when we further considered homozygosity for all the alleles that are in LD with –57T (diplotype #1/1). The apparently stronger effect of the haplotypic combination has two possible explanations.1) The hp#1 is in LD with another causal variation. However, this putative variant must lie outside the GH1 region because no further associated variation was detected when sequencing the promoter and the entire gene (introns and exons) in all the patients (data not shown). Moreover, a possible causal variation was not found within the Pit-1 binding sites in the LCR when sequencing patients carrying diplotype #1/1. Although no new variation was detected in this region, the presence of other functional polymorphisms between the LCR and the GH1 gene cannot be excluded. 2) The associated variations interactively contribute to IGHD susceptibility. A hint that this might be the case comes from the experiments of luciferase induction showing that the presence of –57T seems to be crucial for the vitamin D-induced inhibition only in the context of hp#1 (Fig. 2Go). In fact, hp#2, naturally carrying –57G, is anyway able to induce inhibition, although at a significantly lower level than hp#1 (Fig. 3Go), indicating that the flanking sequences contribute to increase the per se low binding affinity of –57G.

In conclusion, we have identified a common polymorphism in the GH1 promoter contributing to the IGHD phenotype, thus supporting the hypothesis that in most sporadic patients, GHD has a multifactorial etiology. Because the associated allele has a high binding affinity for the VDR and VDR is expressed in GH-producing pituitary cells (35), the gene encoding the VDR is an obvious additional candidate.


    Footnotes
 
This work was supported by grants from Pfizer, from Eastern Piedmont University, from the Italian Ministry for University and Research (Cofin 2004, to G.B.), from Regione Piemonte (Ricerca Scientifica Applicata, bando 2004), from "Compagnia S. Paolo" foundation, and from Centro di Genomica in Endocrinologia Pediatrica. M.Go. is a Ph.D. fellow of Dottorato di Ricerca in Medicina Molecolare.

Disclosure Statement: The authors have nothing to disclose.

First Published Online December 26, 2007

Abbreviations: CI, Confidence interval; GHD, GH deficiency; hp#1, haplotype #1; IGHD, isolated GHD; LCR, locus control region; LD, linkage disequilibrium; 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; NF-1, nuclear factor-1; OR, odds ratio; SDS, SD score; SNP, single-nucleotide polymorphism; VDR, vitamin D receptor; VDRE, VDR-binding element; VDRE cons, VDRE consensus sequence; VDRE mut, VDRE mutant sequence.

Received August 27, 2007.

Accepted December 19, 2007.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Bona G, Paracchini R, Giordano M, Momigliano-Richiardi P 2004 Genetic defects in GH synthesis and secretion. Eur J Endocrinol 151:1–8[Abstract]
  2. Mullis PE 2005 Genetic control of growth. Eur J Endocrinol 152:11–31[Abstract/Free Full Text]
  3. Hanew K, Tachibana K, Yokoya S, Fujieda K, Tanaka T, Igarashi Y, Shimatsu A, Tanaka H, Tanizawa T, Teramoto A, Nishi Y, Hasegawa Y, Hizuka N, Hirano T, Fujita K, GH; Treatment Study Committee, The Foundation for Growth Science, Japan 2005 Studies of very severe short stature with severe GH deficiency: from the data registered with the foundation for growth science. Endocr J 52:37–43[CrossRef][Medline]
  4. Alba M, Salvatori R 2004 Familial growth hormone deficiency and mutations in the GHRH receptor gene. Vitam Horm 69:209–220[Medline]
  5. Courtois SJ, Lafontaine DA, Lemaigre FP, Durviaux SM, Rousseau GG 1990 Nuclear factor-I and activator protein-2 bind in a mutually exclusive way to overlapping promoter sequences and trans-activate the human growth hormone gene. Nucleic Acids Res 18:57–64[Abstract/Free Full Text]
  6. Lemaigre FP, Courtois SJ, Lafontaine DA, Rousseau GG 1989 Evidence that the upstream stimulatory factor and the Sp1 transcription factor bind in vitro to the promoter of the human-growth-hormone gene. Eur J Biochem 181:555–561[Medline]
  7. Lipkin SM, Naar AM, Kalla KA, Sack RA, Rosenfeld MG 1993 Identification of a novel zinc finger protein binding a conserved element critical for Pit-1-dependent growth hormone gene expression. Genes Dev 7:1674–1687[Abstract/Free Full Text]
  8. Seoane S, Alonso M, Segura C, Perez-Fernandez R 2002 Localization of a negative vitamin D response sequence in the human growth hormone gene. Biochem Biophys Res Commun 292:250–255[CrossRef][Medline]
  9. Shepard AR, Zhang W, Eberhardt NL 1994 Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells. J Biol Chem 269:1804–1814[Abstract/Free Full Text]
  10. Ingraham HA, Chen RP, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson L, Rosenfeld MG 1988 A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55:519–529[CrossRef][Medline]
  11. Shewchuk BM, Liebhaber SA, Cooke NE 2002 Specification of unique Pit-1 activity in the hGH locus control region. Proc Natl Acad Sci USA 99:11784–11789[Abstract/Free Full Text]
  12. Giordano M, Marchetti C, Chiorboli E, Bona G, Momigliano-Richiardi P 1997 Evidence for gene conversion in the generation of extensive polymorphism in the promoter of the growth hormone gene. Hum Genet 100:249–255[CrossRef][Medline]
  13. Wagner JK, Ebl A, Cogan JD, Prince MA, Phillips III JA, Mullis PE 1997 Allelic variations in the human growth hormone-1 gene promoter of growth hormone-deficient patients and normal controls. Eur J Endocrinol 137:474–478[Abstract]
  14. Horan M, Millar DS, Hedderich J, Lewis G, Newsway V, Mo N, Fryklund L, Procter AM, Krawczak M, Cooper DN 2003 Human growth hormone 1 (GH1) gene expression: complex haplotype-dependent influence of polymorphic variation in the proximal promoter and locus control region. Hum Mutat 21:408–423[CrossRef][Medline]
  15. Giordano M, Godi M, Giacopelli F, Lessi M, Mellone S, Paracchini R, Petri A, Bellone J, Ravazzolo R, Bona G, Momigliano-Richiardi P 2006 A variation in a Pit-1 site in the growth hormone gene (GH1) promoter induces a differential transcriptional activity. Mol Cell Endocrinol 249:51–57[Medline]
  16. Le Marchand L, Donlon T, Seifried A, Kaaks R, Rinaldi S, Wilkens LR 2002 Association of a common polymorphism in the human GH1 gene with colorectal neoplasia. J Natl Cancer Inst 94:454–460[Abstract/Free Full Text]
  17. Ren Z, Cai Q, Shu XO, Cai H, Cheng JR, Wen WQ, Gao YT, Zheng W 2004 Genetic polymorphisms in the human growth hormone-1 gene (GH1) and the risk of breast carcinoma. Cancer 101:251–257[CrossRef][Medline]
  18. Canzian F, McKay JD, Cleveland RJ, Dossus L, Biessy C, Boillot C, Rinaldi S, Llewellyn M, Chajes V, Clavel-Chapelon F, Tehard B, Chang-Claude J, Linseisen J, Lahmann PH, Pischon T, Trichopoulos D, Trichopoulou A, Zilis D, Palli D, Tumino R, Vineis P, Berrino F, Bueno-de-Mesquita HB, van Gils CH, Peeters PH, Pera G, Barricarte A, Chirlaque MD, Quiros JR, Larranaga N, Martinez-Garcia C, Allen NE, Key TJ, Bingham SA, Khaw KT, Slimani N, Norat T, Riboli E, Kaaks R 2005 Genetic variation in the growth hormone synthesis pathway in relation to circulating insulin-like growth factor-I, insulin-like growth factor binding protein-3, and breast cancer risk: results from the European prospective investigation into cancer and nutrition study. Cancer Epidemiol Biomarkers Prev 14:2316–2325[Abstract/Free Full Text]
  19. Mulhall C, Hegele RA, Cao H, Tritchler D, Yaffe M, Boyd NF 2005 Pituitary growth hormone and growth hormone-releasing hormone receptor genes and associations with mammographic measures and serum growth hormone. Cancer Epidemiol Biomarkers Prev 14:2648–2654[Abstract/Free Full Text]
  20. Wagner K, Hemminki K, Israelsson E, Grzybowska E, Klaes R, Chen B, Butkiewicz D, Pamula J, Pekala W, Forsti A 2005 Association of polymorphisms and haplotypes in the human growth hormone 1 (GH1) gene with breast cancer. Endocr Relat Cancer 12:917–928[Abstract/Free Full Text]
  21. Dennison EM, Syddall HE, Rodriguez S, Voropanov A, Day IN, Cooper C, Southampton Genetic Epidemiology Group 2004 Polymorphism in the growth hormone gene, weight in infancy, and adult bone mass. J Clin Endocrinol Metab 89:4898–4903[Abstract/Free Full Text]
  22. Horan M, Newsway V, Yasmin, Lewis MD, Easter TE, Rees DA, Mahto A, Millar DS, Procter AM, Scanlon MF, Wilkinson IB, Hall IP, Wheatley A, Blakey J, Bath PM, Cockcroft JR, Krawczak M, Cooper DN 2006 Genetic variation at the growth hormone (GH1) and growth hormone receptor (GHR) loci as a risk factor for hypertension and stroke. Hum Genet 119: 527–540
  23. Hasegawa Y, Fujii K, Yamada M, Igarashi Y, Tachibana K, Tanaka T, Onigata K, Nishi Y, Kato S, Hasegawa T 2000 Identification of novel human GH-1 gene polymorphisms that are associated with growth hormone secretion and height. J Clin Endocrinol Metab 85:1290–1295[Abstract/Free Full Text]
  24. Tanner JM, Whitehouse RH 1976 Clinical longitudinal standards for height, weight, height velocity, weight velocity, and stages of puberty. Arch Dis Child 51:170–179[Abstract/Free Full Text]
  25. Tanner JM, Whitehouse RH, Cameron N, Marshall WA, Healy WA, Goldstein H 1988 Assessment of skeletal maturity and prediction of adult height (TW2 method). San Diego, CA: Academic Press
  26. Ghigo E, Bellone J, Aimaretti G, Bellone S, Loche S, Cappa M, Bartolotta E, Dammacco F, Camanni F 1996 Reliability of provocative tests to assess growth hormone secretory status: study in 472 normally growing children. J Clin Endocrinol Metab 81:3323–3332[Abstract]
  27. Growth Hormone Research Society 2000 Consensus guidelines for the diagnosis and treatment of growth hormone (GH) deficiency in childhood and adolescence: summary statement of the GH Research Society. GH Research Society. J Clin Endocrinol Metab 85:3990–3993[Free Full Text]
  28. Jin Y, Surabhi RM, Fresnoza A, Lytras A, Cattini PA 1999 A role for A/T-rich sequences and Pit-1/GHF-1 in a distal enhancer located in the human growth hormone locus control region with preferential pituitary activity in culture and transgenic mice. Mol Endocrinol 13:1249–1266[Abstract/Free Full Text]
  29. D’Alfonso S, Mellai M, Giordano M, Pastore A, Malferrari G, Naldi P, Repice A, Liguori M, Cannoni S, Milanese C, Caputo D, Savettieri G, Momigliano-Richiardi P; Italian Group for the Study of Multiple Sclerosis Genetics 2002 Identification of single nucleotide variations in the coding and regulatory regions of the myelin-associated glycoprotein gene and study of their association with multiple sclerosis. J Neuroimmunol 126:196–204[CrossRef][Medline]
  30. Esteban C, Audi L, Carrascosa A, Fernandez-Cancio M, Perez-Arroyo A, Ulied A, Andaluz P, Arjona R, Albisu M, Clemente M, Gussinye M, Yeste D 2007 Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population. Clin Endocrinol (Oxf) 66:258–268[CrossRef][Medline]
  31. Gil-Puig C, Blanco M, Garcia-Caballero T, Segura C, Perez-Fernandez R 2002 Pit-1/GHF-1 and GH expression in the MCF-7 human breast adenocarcinoma cell line. J Endocrinol 173:161–167[Abstract]
  32. Dattani MT 2005 Growth hormone deficiency and combined pituitary hormone deficiency: does the genotype matter? Clin Endocrinol (Oxf) 63:121–130[CrossRef][Medline]
  33. Colnot S, Lambert M, Blin C, Thomasset M, Perret C 1995 Identification of DNA sequences that bind retinoid X receptor-1,25(OH)2D3-receptor heterodimers with high affinity. Mol Cell Endocrinol 113:85–98
  34. Shaffer PL, Gewirth DT 2002 Structural basis of VDR-DNA interactions on direct repeat response elements. EMBO J 21:2242–2252[CrossRef][Medline]
  35. Perez-Fernandez R, Alonso M, Segura C, Munoz I, Garcia-Caballero T, Diguez C 1997 Vitamin D receptor gene expression in human pituitary gland. Life Sci 60:35–42[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giordano, M.
Right arrow Articles by Momigliano-Richiardi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giordano, M.
Right arrow Articles by Momigliano-Richiardi, P.
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals