| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Laboratory of Pediatric Endocrinology (I.Z., S.M.), Department of Pediatrics (F.C., M.C.V., G.C., S.M., G.W.), San Raffaele Scientific Institute, Vita-Salute San Raffaele University, and Department of Medical Sciences (L.F., L.P.), University of Milan, Istituto Auxologico Italiano (L.P.) and Fondazione Ospedale Maggiore Policlinico (L.F.), 20100 Milan, Italy; and Departments of Medicine (H.G., K.O., S.R.) and Pediatrics (S.R.) and Committee on Genetics (S.R.), University of Chicago, Chicago, Illinois 60637
Address all correspondence and requests for reprints to: Luca Persani, M.D., Ph.D., Department of Medical Sciences, University of Milan, Lab of Experimental Endocrinology, Istituto di Ricovero e Cura a Carattere Scientifico, Istituto Auxologico Italiano, Via Zucchi 18, 20095 Cusano (Milan), Italy. E-mail: luca.persani{at}unimi.it.
| Abstract |
|---|
|
|
|---|
Objective: Our objective was to identify DUOXA2 mutations as a novel cause of CH due to dyshormonogenesis.
Patients: Subjects included 11 CH patients with partial iodine organification defect but negative for other known genetic causes of partial iodine organification defect.
Results: One Chinese patient born to nonconsanguineous parents was homozygous for a nonsense mutation (p.Y246X), producing a truncated DUOXA2 protein lacking transmembrane helix 5 and the C-terminal cytoplasmic domain. The mutant protein was inactive in reconstituting DUOX2 in vitro. Pedigree analysis demonstrated recessive inheritance, because heterozygous carriers had normal thyroid function including negative results in neonatal TSH screening. One heterozygous carrier of Y246X was identified in unrelated Chinese controls (n = 92) but not in Caucasian or Japanese controls, indicating that homozygosity for Y246X could be a frequent cause of CH in Chinese. Functional studies suggest that the DUOXA2 paralog (DUOXA1) can partially compensate DUOXA2 deficiency, consistent with the proband having a milder CH phenotype than patients with biallelic DUOX2 nonsense mutations.
Conclusions: We report the first mutation in DUOXA2, identified in a patient with CH and dyshormonogenic goiter. Results of our studies provide evidence for the critical role of DUOXA2 in thyroid hormonogenesis. Biallelic DUOXA2 mutations are a novel genetic event in permanent CH.
| Introduction |
|---|
|
|
|---|
The generation of hydrogen peroxide (H2O2) is a critical step in the synthesis of thyroid hormones. H2O2 is used as a substrate by TPO in the oxidation of iodide and incorporation of iodine into thyroglobulin (TG) (4). Based on their high expression in thyroid gland and their homology to other reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidases, the dual oxidases (DUOX1 and DUOX2) appeared to constitute the catalytic core of the thyroidal H2O2 generator (5, 6). However, no reconstitution of H2O2 production was obtained in nonthyroidal cell lines expressing these proteins (7). Evidence for the involvement of DUOX2 in thyroid hormonogenesis came from the identification of naturally occurring mutations; biallelic homozygous or compound heterozygous DUOX2 mutations lead to goitrous CH (8, 9, 10), whereas monoallelic nonsense defects cause transient CH (8, 11).
Recently, two novel genes, called DUOX maturation factors (DUOXA1 and DUOXA2) were cloned in the Chicago laboratory (12). These genes are oriented head-to-head to the DUOX genes in the DUOX1/DUOX2 intergenic region (12). The DUOXA2 gene encodes an endoplasmic reticulum (ER) resident protein comprising five membrane-integral regions. DUOXA2 mRNA is predominantly expressed in thyroid gland with lower levels in gastrointestinal epithelia, reminiscent of the expression profile of DUOX2. Whereas DUOX2 expressed in nonthyroidal cells is completely retained in the ER (7), coexpression of DUOXA2 rescues ER-to-Golgi transition, maturation, and translocation to the plasma membrane of functional DUOX2 (12). Being crucial for DUOX2 maturation, DUOXA2 is an attractive candidate gene for CH.
Here, we report the first mutation in DUOXA2 identified in a patient with permanent CH and PIOD. Our results provide in vivo evidence for the important role of DUOXA2 in thyroid hormonogenesis and establish biallelic inactivation of DUOXA2 as a novel genetic event in CH.
| Patients and Methods |
|---|
|
|
|---|
Patients
Eleven patients (10 Caucasians and one Chinese) with CH and PIOD (percent discharge on perchlorate test, 13–77%; normal, <10%) were included in the study. Possible involvement of SLC26A4 defects had been excluded on the basis of normal hearing function. Mutation screening of TPO and DUOX2, as previously described (9, 13), was negative in all subjects.
Case reports
The girl (proband in Fig. 1A
) with homozygous DUOXA2 mutation described in this report was born at term by vaginal delivery to nonconsanguineous parents of Chinese origin. Clinical data are summarized in Table 1
. The patient had a positive newborn screen for CH (TSH of 48 mU/liter on dry blood spot). Subsequent measurements of serum TSH level confirmed progressive hyperthyrotropinemia at 22 and 43 d of life. T4 was low. TG concentration before treatment with L-T4 is not known, but it was not reduced. Thyroid autoantibodies were negative. Ultrasonographic examination revealed an enlarged thyroid gland (14). Thyroidal 99mTc uptake was normal. L-T4 replacement therapy was started at 43 d of age, when the patient was referred to our center. At 2 months of age, the patient moved back to China where she continued the endocrine follow-up and therapy.
|
|
Mutation screening and genotyping
Genomic DNA was isolated from peripheral blood cells using a commercial kit (QIAamp DNA Mini Kit; QIAGEN, Milan, Italy). The complete coding region of DUOXA2 (reference sequence NM_207581) and DUOXA1 (DQ489735), including intron-exon boundaries, was amplified by PCR using appropriate primer pairs (DUOXA2, 1F: CAGCCTTGTACGCAAAGAGA; 1R: CC CCCACTCTACCTGCACTA; 2F: GTCTTGGG GACTCTGGTTTG; 2R: ACCCCAGTTCCCTA TTGTCC; 3F: CAGTGTCCCACCTCCCATA C; 3R: ACTCACCTAACCGGGGATCT; 4F: T TTCCGTCTGAATCCGCTTA; 4R: CATCCTC CCGCTCATACG; 5F: GGGGTAGGGATAAA GAAGAGC; 5R: AATCCTGTCTCCACCCTT AGC; 6F: GTTTGAGGCCAGAGTTCGAG; 6R: GGGGAAGGAGTCCAGATTG; DUOXA1 1F: CCAGGG TGGTGGTAGCACTGA; 1R: GGCTGAGGTCTCTCTGGGCT; 2F: CCTCCAGCCTGGGCAAGAGA; 2R: GGGTG ACACCTCTCCAGGCA; 3F: CCATGAGC CAGACCCTGGCT; 3R: GGACTCACCC ACACTGGGCA; 4F: GGAGGTCAGAGG CATGGTAGGA; 4R: GGACTTCCCAAG CCAGCACCA; 5F: GGAGGCCCTGGTA GCCTAGA; 5R: GGCCTCCAGGAACAG ACCCT; 6F: GCACTGGGCTTGGAGTC TGGA; 6R: GCAAGGCAGCACGGAAAG GCT). PCRs were performed using hot-start polymerase (AmpliTaq Gold; Applied Biosystems, Foster City, CA) and included 1x LCGreen (Idaho Technology, Salt Lake City, UT) for fluorescent labeling. All amplicons were run on a High-Resolution Melter instrument (Idaho Technology) together with a normal control sample. Products with abnormal melting temperature were directly used for cycle sequencing (DYEnamic ET Dye Terminator Kit; Amersham Biosciences, Buckinghamshire, UK) with the original PCR primers and reactions resolved by capillary electrophoresis on MegaBACE 1000 DNA Analysis System (Amersham). To genotype the triallelic nucleotide c.738 of DUOXA2 in random control populations, amplicons of exon 5 were sequenced bidirectionally.
Expression vectors, cell culture, and transient transfection
The c.C738G (p.Y246X) mutation was introduced into expression vectors encoding wild-type (WT) DUOXA2 or N-terminal myc-epitope tagged DUOXA2 (12) by site-directed mutagenesis. The DUOXA1 open reading frame was cloned from human thyroid cDNA using native Pfu polymerase and primers 5'-ATAGGTACCAAGATGGCTACTTTGGGACA-3' and 5'-ATACTCGAGCCAGACTGGAAGTCCA-3' (restriction endonuclease sites for cloning into pcDNA3.1 underlined). The expression vectors for DUOX2 and hemagglutinin-tagged DUOX2 were prepared as described (12). All constructs were verified by sequencing. HeLa cells were cultured and transfected as previously described (17).
Generation of affinity-purified polyclonal antibodies against human DUOXA2
Anti-DUOXA2 antiserum was generated in rabbits immunized with keyhole limpet hemocyanin-conjugated peptide RLKENYAAEYANALEKGLPDPVLY (residues 133–156 of human DUOXA2). The antibodies were affinity purified against the unconjugated peptide immobilized on an AminoLink Plus column (Pierce, Rockford, IL).
Immunoblot analysis and immunofluorescence studies
The protocols for cell lysate preparation, enzymatic deglycosylation, and immunoblot and surface immunofluorescence analysis have been described previously in detail for functional studies of DUOX2 mutations (18). Affinity-purified anti-DUOXA2 was used at 1:4000 in Western blot and 1:1000 in immunofluorescence procedures.
Determination of NADPH oxidase activity
DUOX2-generated H2O2 was determined by endpoint fluorescence assay using cell-impermeable 10-acetyl-3,7-dihydroxyphenoxa-zine (Amplex Red reagent; Invitrogen Life Technologies, Carlsbad, CA) and superoxide release assessed by continuously monitoring the chemiluminescence reaction of Diogenes reagent (National Diagnostics, Atlanta, GA), as previously described (18).
| Results |
|---|
|
|
|---|
G) resulting in a nonsense mutation (Y246X) was identified. The cytosine at position 738 is part of a CpG dinucleotide and also site of a C
T synonymous polymorphism (rs4774518) (Fig. 1B
The mutant allele encodes a truncated protein lacking the transmembrane helix 5 and the cytoplasmic C-terminal domain (Fig. 2A
). Given the location of the mutation 32 bp upstream (i.e. less than 50–55 nucleotides) of the exon 5-exon 6 junction, expression of the mutant mRNA should not be affected by nonsense-mediated mRNA decay (19). Transient transfection experiments in a heterologous cell system were thus performed to assess the functional properties of the truncated DUOXA2 protein. On immunoblot analysis with an antiserum raised against part of the ER-luminal domain of DUOXA2 (Fig. 2A
), we found reduced expression of 246X protein compared with WT (246Y) DUOXA2 (Fig. 2B
). Equivalent results were obtained when WT and 246X DUOXA2 were expressed as fusion with an N-terminal myc-epitope and detected with monoclonal anti-myc antibody (not shown). The difference in steady-state protein expression of WT and mutant DUOXA2 was not altered by DUOX2 coexpression. The 246X mutant protein is N-glycosylated to same degree as WT DUOXA2 (Fig. 2C
), indicating correct membrane insertion of at least the N-terminal transmembrane helices. In contrast to the reticular intracellular distribution pattern of WT DUOXA2, 246X DUOXA2 was concentrated in larger foci in the immediate vicinity of the nuclear envelope (Fig. 2D
). Taken together, these data suggest that the mutant protein is subject to rapid turnover at the site of synthesis resulting in lower steady-state expression compared with WT protein.
|
|
|
| Discussion |
|---|
|
|
|---|
Upon the present findings, DUOXA2 defects may not be prevalent among Caucasian patients with CH and PIOD. However, the Y246X DUOXA2 mutation appears to be frequent in the Chinese population surveyed; not only were the heterozygous parents nonconsanguineous, but we also identified one additional heterozygous carrier of the Y246X mutation of 92 unrelated controls from the Shanghai area. Assuming Hardy-Weinberg equilibrium, the frequency of affected homozygous for Y246X is estimated at one of 34,000 newborns in this population.
The four heterozygous relatives of the proband were all euthyroid with normal perchlorate discharge test indicating a recessive mode of inheritance of DUOXA2 defects. It should be stressed that the two heterozygous siblings of the patient also tested negative at neonatal TSH screening. Thus, in contrast to monoallelic DUOX2 mutations that cause transient CH (8), monoallelic DUOXA2 defects appear not to manifest haploinsufficiency. Because no dominant negative effects were found for those DUOX2 mutations already studied in vitro (18), it seems that DUOX2 is more sensitive than DUOXA2 to gene dosage effects. Such a conclusion is supported by the dose-response characteristics of the reconstituted DUOX2/DUOXA2 system, in which DUOXA2 is not limiting for H2O2 generation even at high DUOX2-to-DUOXA2 expression ratios (18).
As judged by the degree of hyperthyrotropinemia and perchlorate discharge at 7 yr of age, our patient displays a rather mild CH compared with patients with biallelic DUOX2 nonsense mutations. A potential compensatory mechanism in DUOXA2 deficiency is the activation of DUOX2 by DUOXA1, which is expressed at about a 5-fold lower level than DUOXA2 in the thyroid gland (12). The functional studies presented here (Fig. 4
) would indeed lend support to the concept that DUOX2 can be partially rescued by WT DUOXA1, mitigating the manifestation of DUOXA2 deficiency.
In conclusion, we report the first mutation in DUOXA2 gene, identified in a patient with mild permanent CH and dyshormonogenic goiter. Loss of functional DUOXA2 in the homozygous patient provides in vivo evidence for the essential role of DUOXA2 in thyroid hormone synthesis. The prevalence of DUOXA2 mutations in patients with CH and their phenotypic spectrum remain to be determined.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online November 27, 2007
1 I.Z. and H.G. contributed equally to this study. ![]()
Abbreviations: CH, Congenital hypothyroidism; DUOX2, dual oxidase 2; ER, endoplasmic reticulum; NADPH, reduced nicotinamide adenine dinucleotide phosphate; PIOD, partial iodide organification defects; TG, thyroglobulin; TIOD, total iodide organification defects; TPO, thyroid peroxidase.
Received September 7, 2007.
Accepted November 19, 2007.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Tonacchera, G. De Marco, P. Agretti, L. Montanelli, C. Di Cosmo, A. C. Freitas Ferreira, A. Dimida, E. Ferrarini, H. E. Ramos, C. Ceccarelli, et al. Identification and Functional Studies of Two New Dual-Oxidase 2 (DUOX2) Mutations in a Child with Congenital Hypothyroidism and a Eutopic Normal-Size Thyroid Gland J. Clin. Endocrinol. Metab., November 1, 2009; 94(11): 4309 - 4314. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pardo, J. Vono-Toniolo, I. G. S. Rubio, M. Knobel, R. F. Possato, H. M. Targovnik, P. Kopp, and G. Medeiros-Neto The p.A2215D Thyroglobulin Gene Mutation Leads to Deficient Synthesis and Secretion of the Mutated Protein and Congenital Hypothyroidism with Wide Phenotype Variation J. Clin. Endocrinol. Metab., August 1, 2009; 94(8): 2938 - 2944. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Luxen, D. Noack, M. Frausto, S. Davanture, B. E. Torbett, and U. G. Knaus Heterodimerization controls localization of Duox-DuoxA NADPH oxidases in airway cells J. Cell Sci., April 15, 2009; 122(8): 1238 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morand, T. Ueyama, S. Tsujibe, N. Saito, A. Korzeniowska, and T. L. Leto Duox maturation factors form cell surface complexes with Duox affecting the specificity of reactive oxygen species generation FASEB J, April 1, 2009; 23(4): 1205 - 1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rigutto, C. Hoste, H. Grasberger, M. Milenkovic, D. Communi, J. E. Dumont, B. Corvilain, F. Miot, and X. De Deken Activation of Dual Oxidases Duox1 and Duox2: DIFFERENTIAL REGULATION MEDIATED BY cAMP-DEPENDENT PROTEIN KINASE AND PROTEIN KINASE C-DEPENDENT PHOSPHORYLATION J. Biol. Chem., March 13, 2009; 284(11): 6725 - 6734. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Afink, W. Kulik, H. Overmars, J. de Randamie, T. Veenboer, A. van Cruchten, M. Craen, and C. Ris-Stalpers Molecular Characterization of Iodotyrosine Dehalogenase Deficiency in Patients with Hypothyroidism J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4894 - 4901. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Maruo, H. Takahashi, I. Soeda, N. Nishikura, K. Matsui, Y. Ota, Y. Mimura, A. Mori, H. Sato, and Y. Takeuchi Transient Congenital Hypothyroidism Caused by Biallelic Mutations of the Dual Oxidase 2 Gene in Japanese Patients Detected by a Neonatal Screening Program J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4261 - 4267. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |