help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2007-2836
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheung, C.-L.
Right arrow Articles by Kung, A. W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheung, C.-L.
Right arrow Articles by Kung, A. W. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Medline Plus Health Information
*Fractures
Related Collections
Right arrow Calcium and Bone Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 93, No. 11 4448-4455
Copyright © 2008 by The Endocrine Society

Identification of LTBP2 on Chromosome 14q as a Novel Candidate Gene for Bone Mineral Density Variation and Fracture Risk Association

Ching-Lung Cheung, Pak C. Sham, Vivian Chan, Andrew D. Paterson, Keith D. K. Luk and Annie W. C. Kung

Department of Medicine (C.-L.C., V.C., A.W.C.K.), Genome Research Centre (P.C.S.), Orthopaedics and Traumatology (K.D.K.L.), The University of Hong Kong, Pokfulam, Hong Kong, China; and Program in Genetics and Genomic Biology (A.D.P.), The Hospital for Sick Children Research Institute, University of Toronto, Toronto, Ontario M5G 1L7, Canada

Address all correspondence and requests for reprints to: Annie W. C. Kung, M.D., Department of Medicine, The University of Hong Kong, Pokfulam, Hong Kong, China. E-mail: awckung@hkucc.hku.hk; or Pak C. Sham, Ph.D., Genome Research Centre, The University of Hong Kong, Pokfulam, Hong Kong, China. E-mail: pcsham{at}hkucc.hku.hk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Low bone mineral density (BMD) is a major risk factor for osteoporotic fracture. Chromosome 14q has previously been linked to BMD variation in several genome-wide linkage scans in Caucasian populations.

Objective: Our objective was to replicate and identify the novel candidate genes in the quantitative trait loci (QTL) at chromosome 14q QTL.

Subjects and Methods: Eighteen microsatellite markers were genotyped for a 117-cM interval in 306 Southern Chinese pedigrees with 1459 subjects. Successful replication of the QTL was confirmed within this region for trochanter and total hip BMD. Using a gene prioritization approach as implemented in the Endeavour program, we genotyped 65 single-nucleotide polymorphisms in the top five ranking candidate genes within the linkage peak in 706 and 760 case-control subject pairs with extremely high and low trochanter and total hip BMD, respectively.

Results: Single-marker and haplotype analyses revealed that ESR2 and latent TGF-β binding protein 2 (LTBP2) had significant associations with trochanter and total hip BMD. Multiple logistic regression revealed a strong genetic association between LTBP2 gene locus and total hip BMD variation (P = 0.0004) and prevalent fracture (P = 0.01). Preliminary in vitro study showed differential expression of LTBP2 gene in MC3T3-E1 mouse preosteoblastic cells in culture.

Conclusions: Apart from ESR2, LTBP2 is a novel positional candidate gene in chromosome 14q QTL for BMD variation and fracture.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Osteoporosis is an important health problem worldwide as the prevalence of associated bone fractures is increasing due to prolonged life expectancy and aging of the population. Osteoporosis is a disorder in which there is a reduction in bone strength that results in enhanced bone fragility and a consequent increased fracture risk. Low bone mineral density (BMD) is one of the major determinants of bone strength and an important risk factor for osteoporotic fractures. BMD is under strong genetic inference with a heritability estimate of 0.63–0.71 in women and 0.74–0.79 in men (1). Early identification of at-risk subjects allows preventive measures to be implemented before any significant bone loss. In addition, localization of candidate genes for BMD variation aids understanding of the pathogenesis of the disease and development of new therapies.

More than 20 genome-wide linkage scans (GWLS) have been published on BMD and osteoporotic fractures. Nonetheless, inconsistent results remain the major challenge in the quest for identification of genes that affect BMD. Suggestive or significant linkages for BMD variation at several skeletal sites have been detected on chromosome 14q (2, 3, 4). In our recent meta-analysis study of nine GWLS with 11,842 subjects, several significant quantitative trait loci (QTL) were identified, and two neighboring bins on chromosome 14, 14q13.1-q24.1 (P = 0.003) and 14q23.3-q32.12 (P = 0.022), were shown to be significantly linked to hip BMD variation (5). These combined findings suggest that chromosome 14 may harbor multiple candidate genes that contribute to BMD variation at different skeletal sites. Estrogen receptor β (ESR2) is one of the positional candidate genes in this region that has been shown to contribute to BMD variation (6). Given the QTL size and overall strength of linkage signals observed on chromosome 14q, it is likely that more than one susceptibility locus may reside within the QTL. Nonetheless, it remains largely unknown which genes in the region also play a role in BMD regulation.

In this study, we carried out a linkage analysis of the chromosome 14 region in an independent set of southern Chinese families in attempt to replicate the previously reported linkage findings. Using a newly developed bioinformatics tool for gene prioritization, the five top-ranked genes under the QTL were selected for association analysis using the tagging approach. Our results revealed a novel candidate gene LTBP2 on chromosome 14q that is associated with hip BMD variation and fracture prevalence.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Study population

The study subjects were extracted from an expanding database being compiled at the Osteoporosis Centre at Queen Mary Hospital, the University of Hong Kong, to determine the genetic and environmental risk factors for osteoporosis. All study subjects were individuals of southern Chinese descent resident in the local community. They were recruited at road shows and health talks on osteoporosis held between 1998 and 2003 and were invited to the Osteoporosis Centre for BMD measurement. All participants gave informed consent, and the study was approved by the Ethics Committee of the University of Hong Kong and conducted according to the Declaration of Helsinki.

For the family study, probands were identified from subjects with BMD Z score of less than or equal to –1.28 (the lowest 10th percentile of the population) at either the lumbar spine (L1–4) or hip; extended family members were also invited to participate. We estimated family informativeness for 1021 pedigrees. Based on previous heritability estimates of BMD of 70% from a similar population, the expected LOD score for each pedigree was estimated, via regression, on the basis of phenotypic values, by using the option rankFamilies in Merlin-regress. Families with the highest informativeness were selected for evaluation (1). Three hundred six families with 1459 subjects (293 males and 1166 females) spanning two to four generations were analyzed. These pedigrees contained 1260 sib pairs, 143 cousin pairs, 2356 parent-child pairs, 522 grandparent-grandchild pairs, and 512 avuncular pairs. Detailed descriptions of these families have been reported previously (7, 8).

To increase the power of the association study, a threshold-defined case-control design was adopted, and unrelated subjects from the opposite extreme of the distribution of BMD were studied for the association analysis. Low BMD subjects were arbitrarily defined as those with a BMD Z score of less than or equal to –1.28 (equivalent to the lowest 10th percentile of the population) at either the spine or hip. High BMD subjects were sex-matched controls with a BMD Z score higher than +1 (approximately equivalent to the 85th percentile of the population) at the corresponding bone site. We identified 833 unrelated case-control pairs of subjects, with 706 trochanter case-control pairs and 760 total hip case-control pairs. A total of 633 pairs constituted both trochanter and total hip cohorts. The case-control cohorts were sex and age matched. Detailed inclusion and exclusion criteria have been described previously (8, 9).

BMD measurements and prevalent fracture assessment

BMD (grams per square centimeter) at the spine L1–L4, femoral neck (FN), trochanter, and total hip was measured by dual-energy x-ray absorptiometry (Hologic QDR 4500 plus; Hologic Waltham, MA). The in vivo precision of the machine for spine, FN, and total hip region was 1.2, 1.5, and 1.5%, respectively (10). Weight and height were measured at the same visit. Thoracolumbar spine x-rays were assessed for radiographic evidence of spine fracture at baseline using the semiquantitative method (11). All low-trauma fractures at the spine, hip, and distal radius and morphometric fracture at the spine were included in the final analysis.

Microsatellite marker genotyping

Genomic DNA was extracted from peripheral blood leukocytes using a phenol/chloroform extraction method. A total of 18 high-density microsatellite markers were genotyped in the chromosome 14 region delineated by D14S972 (located at 14q12) and D14S1007 (located at 14q32.2) encompassing a 117-cM interval. This region showed significant linkage to hip BMD variation in a recent meta-analysis. All markers were commercially available through PE Applied Biosystems (ABI PRISM Linkage Mapping Sets, version 2; Norwalk, CT). Marker order and map positions were obtained from the Marshfield map (Fig. 1Go). The average intermarker distance was 6.5 cM, and average population heterozygosity was 70%. Genotyping was performed on an ABI PRISM 3700 genetic analyzer using the GENESCAN and GENOTYPER software for allele identification and sizing.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 1. Multipoint LOD scores for linkage of spine, FN, trochanter, and total hip BMD to chromosome 14q.

 
Statistical analysis for the linkage study

Multipoint regression-based linkage analysis was performed for BMD at the spine, FN, trochanter, and total hip in the whole study population using Merlin-regress (12, 13). Merlin-regress can handle nonrandomly ascertained samples and deviations from multivariate normality of the observed data but no loss in power when compared with the variance component method (13). Based on our previous heritability study, heritability of 0.7 was used for hip BMD in the Merlin-regress. On the basis of the criteria, LOD of at least 1.3 would be considered as significant replication of a previous reported QTL (14). To obtain the empirical P value corresponding to the linkage result, we empirically derived the P values from 1000 simulated data sets using the gene-dropping method in Merlin-regress. The P values were calculated for the full sample. If a LOD score of 1.3 is reached in 10 of the 1000 simulated data sets, this would indicate an empirical P value of 0.01.

Candidate gene selection, single-nucleotide polymorphism (SNP) selection, and genotyping

An arbitrarily defined region of a 1-LOD interval from the linkage peak was selected for fine mapping. We applied a recently developed gene prioritization approach, implemented in software Endeavor (15), to identify the positional candidate genes. Endeavor prioritizes the candidate genes in a three-step analysis. In the first step, the biological information about the disease is gathered from a set of training genes, which are known to affect the disease. The biological information is based on the literature, gene ontology, gene expression data, expressed sequence tag expression data, protein domain, protein-protein interaction, pathway, cis-regulatory modules, transcriptional motifs, and sequence similarity. The training genes were selected based on our recent review of the genetics of osteoporosis (16): VDR, ESR1, BMP2, IL-6, IGF-I, CYP19, LRP5, CLCN7, TGF-β, COL1A1, and SOST. In the second step, a set of testing genes is loaded to the software. In our study, the chromosomal region 14q22.1-24.3 was loaded for testing and prioritizing the genes. In the last step, the testing genes are ranked based on the similarity with the training properties (i.e. the biological information gathered in the first step). In our study, the top five candidate genes were selected for association analysis.

To improve the efficiency of association studies, an aggressive tagging approach (17) was adopted to select a subset of informative SNPs in each gene from the HAPMAP Chinese population data Rel 21/Phase II (18), with force-tagging of the SNPs located in 5'-untranslated region and coding region. SNPs were genotyped using the high-throughput Sequenom MassARRAY system (Sequenom, San Diego, CA). Genotyping was repeated in 5% of the samples for verification and quality control; genotype data were confirmed to have an error rate of less than 0.1%.

Association analyses

The genotyping quality of each SNP was first checked for the call rate, minor allele frequency (MAF), and Hardy-Weinberg equilibrium using the HAPLOVIEW (19). SNPs with MAF less than 0.01, call rate less than 90%, and Hardy-Weinberg equilibrium less than 0.01 were excluded from further analysis. Genotype and allele frequencies for each SNP were determined by gene counting. Pairwise linkage disequilibrium (LD) was calculated as r2 for all SNP-pair combinations using HAPLOVIEW.

Odds ratio and 95% confidence interval (CI) were determined using binary logistic regression to determine the association of the SNPs and SNP haplotype and the BMD status (high vs. low); BMD was adjusted for age, sex, height, and weight in the logistic model. The global association per candidate gene was assessed by multiple logistic regression with adjustment for confounding factors (age, height, weight, and sex) while controlling for other loci located at the same gene. This omnibus test [likelihood ratio test (LRT)] provided a single test for a collection of SNPs per candidate gene locus and an overall evidence of association. It also ameliorated the multiple comparisons that are usually encountered in a single-marker test, because the LRT has already accounted for all markers in the same gene locus and provided a single P value for overall association. In practice, this genotypic multiple regression is comparable to haplotype analysis. Although it does not include phase information, the power of the two tests is similar (20). In the second stage, backward logistic regression was applied to identify the most predictive SNPs in each gene locus.

Haplotype association was performed in two ways. In the first, we applied the default block definition in HAPLOVIEW using the method of Gabriel et al. (21). Haplotype tests of association were run using logistic regression on blocks of SNP markers identified in HAPLOVIEW with or without adjustment of confounding factors. In the second approach, a three-marker sliding window approach was adopted using WHAP (22). For H haplotypes, the omnibus (global) test (H–1 degree of freedom test) assessed the overall association of haplotypes in the haplotype window with the trait. The haplotype-specific test was performed only if a significant association was observed in the global test.

Associations between SNPs and prevalent fractures at the hip, spine, and distal forearm were assessed using a single-marker test and multiple logistic regression as described above. Symptomatic as well as morphometric spine fractures were included for analysis.

Power estimation of threshold-defined case-control subjects

Power calculations were performed with the quantitative trait case-control calculator in the Genetic power calculator (23). We presumed that the tested marker was the QTL itself or was in complete LD with the causal allele and that the QTL follows additive inheritance.

The power estimation based on the above method revealed that our study had over 80% power to detect a marker responsible for at least 1% of BMD variance at the {alpha}-level of 1–5%.

LTBP2 gene expression in MC3T3-E1 mouse preosteoblast cells

MC3T3-E1 mouse preosteoblast cells were plated at 1.5 x 105 cells/ml in a 24-well plate. Each well contained {alpha}-MEM supplemented with 10% fetal calf serum, and growth medium was replaced every 2–3 d. Total RNA was isolated using TRI Reagent (Molecular Research Center Inc., Cincinnati, OH) at d 0, 1, 3, 5, 7, 10, 15, and 20 after incubation. The amount of LTBP2 and 18S mRNA expression was quantitated by semiquantitative PCR with LTBP2 primers forward GAGCTCATGATGGCAGTGTG and reverse GCTCCTTCCACTGGGATGTA and 18S primers forward TTTCGAGGCCCTGTAATTGGAATGA and reverse TTCAAAGTAAACGCTTCGGGCCC, respectively.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Multipoint linkage analysis

The results of the multipoint linkage analysis in 306 families are summarized in Fig. 1Go. Demographic data have been previously described (7). One marker (D14S63) achieved a LOD score higher 1.3 with trochanter BMD, with the maximum LOD score of 1.55 (nominal P value = 0.004; empirical P value = 0.006) at 69.5 cM near the marker D14S63. For total hip BMD, three markers (D14S63, D14S258, and D14S1036) achieved a LOD score higher than 1.3, with the maximum LOD score of 1.78 (nominal P = 0.002; empirical P value = 0.009) at 69.5 cM near the marker D14S63. A LOD score lower than 1.3 was detected for spine and FN BMD.

Candidate gene selection and association analyses

In the region of the 1-LOD interval, i.e. 14q22.1-24.3, 344 genes were identified (NCBI build 36). We applied the gene-prioritization approach implemented in the Endeavor program to prioritize these genes within the QTL of 14q. The five top-ranked genes were estrogen receptor β (ESR2), transforming growth factor β 3 (TGFB3), bone morphogenetic protein 4 (BMP4), estrogen receptor related β (ESRRB), and LTBP2. Linkage disequilibrium (LD) pattern investigation of our data revealed no evidence of LD between these five genes on chromosome 14q (data not shown).

To assess the association of these five genes with trochanter and total hip BMD variation, a tagging approach with average r2 of 0.8 was used to select a set of informative SNPs for each gene based on the HapMap Chinese population data Rel 21/Phase II (2005). Three, six, 16, seven, and 26 SNPs were tagged for BMP4, ESR2, LTBP2, TGFB3, and ESRRB, respectively, with an intermarker distance of 4.5 kb. We excluded three SNPs in ESRRB in the analysis because they did not pass the genotyping quality control.

Table 1Go shows the significant results of the single-marker test and BMD variation at either trochanter or total hip. Clinical characteristics of subjects have been previously described (6). Using an empirical P value of 0.05 through 10,000 permutations, the following SNPs were significantly associated with BMD at the trochanter in either the additive, dominant, or recessive model: rs1256064, rs944052, and T-1213C in ESR2; rs2359141 and rs7569 SNPs in LTBP2; and rs12436385 and rs4903413 in ESRRB. There was no significant association between SNPs in TGFB3 and BMP4 with trochanter BMD variation. Similar results were obtained for total hip BMD: rs1256064, rs944052, and T-1213C in ESR2; rs2286411, rs3825709, and rs2043948 in LTBP2; and rs4414418 and rs12436385 in ESRRB (Table 1Go).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Results of single-marker test for trochanter and total hip BMD

 
The overall gene locus effect of each candidate gene was assessed using gene-based multiple logistic regression (Table 2Go) that included all the SNPs in a gene as predictor variables. The strongest association was observed for LTBP2 (P = 0.011 for trochanter BMD and 0.0004 for total hip BMD). The omnibus P value for total hip BMD remained significant after conservative Bonferroni correction of multiple testing with 55 SNPs and two skeletal sites.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Results of multiple locus analysis of candidate genes using multiple logistic regression and subsequently with backward logistic regression to identify the most predictive SNPs for trochanter BMD and total hip BMD

 
In the second stage, backward logistic regression was used to identify the most predictive SNPs in each gene locus while controlling for other SNPs located at the same gene. The results are shown in Table 2Go. Multiple SNPs in LTBP2 remained in the final logistic model, suggesting they each had a significant main effect on trochanter and total hip BMD variation.

In the haplotype analysis, we investigated the regional association by performing the three-marker sliding window test. The analysis revealed significant associations between LTBP2 and trochanter and total hip BMD variation (Table 3Go). Haplotype analysis using block haplotypes revealed similar results (Table 4Go), with the block haplotypes in LTBP2 demonstrating a significant association with BMD variation at both trochanter and total hip. The block haplotype in ESR2 showed a significant association with trochanter BMD variation.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Results of haplotype analysis of candidate genes using a three-marker sliding window approach

 

View this table:
[in this window]
[in a new window]

 
TABLE 4. Results of haplotype analysis of candidate genes using a block haplotype approach

 
Association of LTBP2 with prevalent fractures

The association between 16 SNPs in LTBP2 gene locus and prevalent fracture at the spine, hip, and distal radius was examined. These were the most common osteoporotic fracture sites. The omnibus test revealed an overall association of LTBP2 gene locus with fractures, even after adjustment of BMD at all sites (P < 0.05) (Table 5Go). Six SNPs remained in the final logistic model with or without adjustment of BMD. The single-marker test revealed similar findings; rs862046 and rs2302114 showed significant associations (P < 0.05) with prevalent fractures without adjustment of BMD. After adjustment of BMD, only rs862046 remained significant.


View this table:
[in this window]
[in a new window]

 
TABLE 5. Results of multiple locus analysis of LTBP2 using multiple logistic regression and subsequently with backward logistic regression to identify most predictive SNPs for fracture at any site with and without adjustment of BMD

 
LTBP2 gene expression in MC3T3-E1 cells

In vitro study using the MC3T3-E1 mouse preosteoblast cells demonstrated constitutive expression of LTBP2 gene, with differential expression during osteoblastic proliferation (first 4 d of culture) and subsequent differentiation into mature osteoblasts (Fig. 2Go).


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 2. LTBP2 gene expression in MC3T3–E1 mouse preosteoblast cells at d 0, 1, 3, 5, 7, 10, 15, and 20 of culture; the lower panel shows the semiquantitation of LTBP2 mRNA expression (mean ± SD) with RT-PCR.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Previous GWLS provided evidence of linkage to BMD variation at the spine (3), FN (5), trochanter (2), and total hip (4) and BMD at all sites (24). In the present study, successful replication of linkage was detected at the trochanter and total hip but not spine or FN BMD. According to our linkage findings, the effect size of QTL peak observed on chromosome 14q as estimated using Merlin-regress contributed 15.2 ± 5.4% to the final variance in BMD. In our previous study, ESR2 accounted for only 1% of the final variance in women and 4–7% in men (6). Therefore, we hypothesized that there may be other candidate genes located in the same QTL to explain the strength of signal, although it is well recognized that QTL effect-size estimates from linkage studies are imprecise and often overestimated (25).

Over 300 known genes are present under the QTL on chromosome 14q. Prioritization of the candidate gene while focusing on just a few genes was possible by integrating the information available from multiple publicly available databases (15). Using this approach to select the top five genes from genotyping, we were able to reconfirm our previous findings of the association of ESR2 with trochanter and hip BMD. Besides, LTBP2 showed consistent and multiple significant associations at the single-SNP, multiple-SNP, and haplotype levels, suggesting LTBP2 is another positional QTL gene on chromosome 14q. Using fracture per se as the phenotype, LTBP2 also showed a significant association with prevalent fractures, even after adjustment of BMD, suggesting LTBP2 may exert its independent effect on BMD and fracture.

LTBP2 is located at 84 cM, in close proximity to the second peak near the marker D14S1036 (Fig. 1Go). The LTBP2 protein is known to play a structural role within elastic fiber and affects extracellular matrix homeostasis (26). It belongs to the family of fibrillin/LTBP glycoproteins and contains two domains, epidermal growth-factor like domains and eight-cysteine repeats, that are important in gene-gene interaction (27). In a recent in vitro study of LTBP2 expression during chondrogenic differentiation of mesenchymal stem cell and chondrocytes, LTBP2 was up-regulated during dedifferentiation and down-regulated during chondrocyte differentiation (28). In addition, the level of expression of LTBP2 in the joint differed between patients and controls with osteoarthritis (29) and in the synovium of patients with systemic lupus erythematosus (26). Although this study did not evaluate the role of LTBP2 in bone metabolism, preliminary in vitro study using the MC3T3-E1 mouse preosteoblast cells demonstrated differential expression of LTBP2 during different stages of osteoblast differentiation (Fig. 2Go). Based on the common pathway of chondrocyte and osteoblast differentiation from mesenchymal stem cells, and together with our association and preliminary expression data, it is likely that LTBP2 may be involved in osteoblast differentiation, BMD determination, matrix homeostasis, and fracture etiology.

The present study, with over 80% power, identified a number of significant markers with the gene-based omnibus approach even after correction for multiple testing for 55 markers and two traits (P < 0.00045) that warrant further evaluation in other populations (30). Although it could be argued that none of the SNPs were significant in the single-marker test (Table 1Go) if corrected for multiple testing, it should be noted that allelic heterogeneity (i.e. presence of more than one susceptibility allele in a locus or gene) greatly reduced the power for testing of an individual SNP (31). Therefore, a single gene-based omnibus test (LRT) was used to ameliorate the situation by simply testing the global null hypothesis about the SNPs located per gene. The gene-based omnibus test is a direct and powerful means of protecting the overall false-positive rate when a collection of loci are tested, because the P value from the omnibus test has already reflected the number of SNPs included in the number of degrees of freedom (32). In this regression framework, the association was examined with controlling for other SNPs at the same gene without stratifying by effects at other loci, hence having more advantage over the simple single-marker test (33). Using this omnibus test approach, a significant enrichment in P value was observed in the LTBP2 gene when compared with the single-marker test, suggesting the presence of untagged susceptibility variants. Conversely, the P value in the omnibus test of ESR2 was not enriched when compared with the single-marker test. This suggested that either an absence of an additional susceptibility variant or the causal variant may already be included or tagged (with very high LD) in the study.

In the haplotype analyses, a number of rare haplotypes were associated with BMD variation. These observations may be explained by the existence of an additional rare variant in LD with the rare haplotypes. Although rare haplotypes may not be robust to genotyping error and type I error, the significant result generated from the haplotype omnibus test in a relatively large case-control cohort suggested the overall effect of the test loci should be valid (34). Of course, future replication study in our population will help to validate our findings. Apart from the gene prioritization method, there are other approaches for selection of candidate genes, and we cannot preclude the possibility of the presence of other candidate genes in this QTL.

In conclusion, QTL in chromosome 14 for hip BMD variation was replicated in the Southern Chinese population. In addition to ESR2, significant associations between LTBP2 and BMD and osteoporotic fractures were observed. The association with fracture was through mechanisms both dependent and independent of BMD. These results suggest that the LTBP2 gene might be clinically important in fracture management.


    Acknowledgments
 
We thank the staff of the Osteoporosis Centre, The University of Hong Kong, Queen Mary Hospital and K. S. Lau and Benjamin Chan for their assistance in this project.


    Footnotes
 
This project is supported by Hong Kong Research Grant Council; The Bone Health Fund, HKU Foundation and Matching Grant, The University of Hong Kong.

Current address for C.-L.C.: Institute for Aging Research, Hebrew SeniorLife and Harvard Medical School, Boston, Massachusetts 02131.

Disclosure Statement: The authors have nothing to disclose.

First Published Online August 12, 2008

Abbreviations: BMD, Bone mineral density; CI, confidence interval; FN, femoral neck; GWLS, genome-wide linkage scans; LD, linkage disequilibrium; LRT, likelihood ratio test; MAF, minor allele frequency; QTL, quantitative trait loci; SNP, single-nucleotide polymorphism.

Received December 26, 2007.

Accepted August 5, 2008.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Ng MY, Sham PC, Paterson AD, Chan V, Kung AWC 2006 Effect of environmental factors and gender on the heritability of bone mineral density and bone size. Ann Hum Genet 70:428–438[CrossRef][Medline]
  2. Koller DL, Econs MJ, Morin PA, Christian JC, Hui SL, Parry P, Curran ME, Rodriguez LA, Conneally PM, Joslyn G, Peacock M, Johnston CC, Foroud T 2000 Genome screen for QTLs contributing to normal variation in bone mineral density and osteoporosis. J Clin Endocrinol Metab 85:3116–3120[Abstract/Free Full Text]
  3. Peacock M, Koller DL, Fishburn T, Krishnan S, Lai D, Hui S, Johnston CC, Foroud T, Econs MJ 2005 Sex-specific and non-sex-specific quantitative trait loci contribute to normal variation in bone mineral density in men. J Clin Endocrinol Metab 90:3060–3066[Abstract/Free Full Text]
  4. Streeten EA, McBride DJ, Pollin TI, Ryan K, Shapiro J, Ott S, Mitchell BD, Shuldiner AR, O'Connell JR 2006 Quantitative trait loci for BMD identified by autosome-wide linkage scan to chromosomes 7q and 21q in men from the Amish Family Osteoporosis Study. J Bone Miner Res 21:1433–1442[CrossRef][Medline]
  5. Ioannidis JP, Ng MY, Sham PC, Zintzaras E, Lewis CM, Deng HW, Econs MJ, Karasik D, Devoto M, Kammerer CM, Spector T, Andrew T, Cupples LA, Duncan EL, Foroud T, Kiel DP, Koller D, Langdahl B, Mitchell BD, Peacock M, Recker R, Shen H, Sol-Church K, Spotila LD, Uitterlinden AG, Wilson SG, Kung AW, Ralston SH 2007 Meta-analysis of genome-wide scans provides evidence for sex- and site-specific regulation of bone mass. J Bone Miner Res 22:173–183[CrossRef][Medline]
  6. Kung AW, Lai BM, Ng MY, Chan V, Sham PC 2006 T-1213C polymorphism of estrogen receptor β is associated with low bone mineral density and osteoporotic fractures. Bone 39:1097–1106[CrossRef][Medline]
  7. Cheung CL, Huang QY, Ng MY, Chan V, Sham PC, Kung AW 2006 Confirmation of linkage to chromosome 1q for spine bone mineral density in southern Chinese. Hum Genet 120:354–359[CrossRef][Medline]
  8. Huang QY, Ng MY, Cheung CL, Chan V, Sham PC, Kung AW 2006 Identification of two sex-specific quantitative trait loci in chromosome 11q for hip bone mineral density in Chinese. Hum Hered 61:237–243[CrossRef][Medline]
  9. Cheung CL, Chan V, Kung AW 2008 A differential association of ALOX15 polymorphisms with bone mineral density in pre- and post-menopausal women. Hum Hered 65:1–8[Medline]
  10. Kung AW, Yeung SS, Lau KS 1998 Vitamin D receptor gene polymorphisms and peak bone mass in southern Chinese women. Bone 22:389–393[CrossRef][Medline]
  11. Genant HK, Wu CY, van Kuijk C, Nevitt MC 1993 Vertebral fracture assessment using a semiquantitative technique. J Bone Miner Res 8:1137–1148[Medline]
  12. Abecasis GR, Cherny SS, Cookson WO, Cardon LR 2002 Merlin: rapid analysis of dense genetic maps using sparse gene flow trees. Nat Genet 30:97–101[CrossRef][Medline]
  13. Sham PC, Purcell S, Cherny SS, Abecasis GR 2002 Powerful regression-based quantitative-trait linkage analysis of general pedigrees. Am J Hum Genet 71:238–253[CrossRef][Medline]
  14. Lander E, Kruglyak L 1995 Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11:241–247[CrossRef][Medline]
  15. Aerts S, Lambrechts D, Maity S, Van Loo P, Coessens B, De Smet F, Tranchevent LC, De Moor B, Marynen P, Hassan B, Carmeliet P, Moreau Y 2006 Gene prioritization through genomic data fusion. Nat Biotechnol 24:537–544[CrossRef][Medline]
  16. Huang QY, Kung AW 2006 Genetics of osteoporosis. Mol Genet Metab 88:295–306[CrossRef][Medline]
  17. de Bakker PI, Yelensky R, Pe'er I, Gabriel SB, Daly MJ, Altshuler D 2005 Efficiency and power in genetic association studies. Nat Genet 37:1217–1223[CrossRef][Medline]
  18. International HapMap Consortium 2005 A haplotype map of the human genome. Nature 437:1299–1320[CrossRef][Medline]
  19. Barrett JC, Fry B, Maller J, Daly MJ 2005 Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21:263–265[Abstract/Free Full Text]
  20. Cordell HJ 2006 Estimation and testing of genotype and haplotype effects in case-control studies: comparison of weighted regression and multiple imputation procedures. Genet Epidemiol 30:259–275[CrossRef][Medline]
  21. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DeFelice M, Lochner A, Faggart M, Liu-Cordero SN, Rotimi C, Adeyemo A, Cooper R, Ward R, Lander ES, Daly MJ, Altshuler D 2002 The structure of haplotype blocks in the human genome. Science 296:2225–2229[Abstract/Free Full Text]
  22. Purcell S, Daly MJ, Sham PC 2007 WHAP: haplotype-based association analysis. Bioinformatics 23:255–256[Abstract/Free Full Text]
  23. Purcell S, Cherny SS, Sham PC 2003 Genetic Power Calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics 19:149–150[Abstract/Free Full Text]
  24. Lee YH, Rho YH, Choi SJ, Ji JD, Song GG 2006 Meta-analysis of genome-wide linkage studies for bone mineral density. J Hum Genet 51:480–486[CrossRef][Medline]
  25. Goring HH, Terwilliger JD, Blangero J 2001 Large upward bias in estimation of locus-specific effects from genomewide scans. Am J Hum Genet 69:1357–1369[CrossRef][Medline]
  26. Nzeusseu Toukap A, Galant C, Theate I, Maudoux AL, Lories RJ, Houssiau FA, Lauwerys BR 2007 Identification of distinct gene expression profiles in the synovium of patients with systemic lupus erythematosus. Arthritis Rheum 56:1579–1588[CrossRef][Medline]
  27. Shipley JM, Mecham RP, Maus E, Bonadio J, Rosenbloom J, McCarthy RT, Baumann ML, Frankfater C, Segade F, Shapiro SD 2000 Developmental expression of latent transforming growth factor β binding protein 2 and its requirement early in mouse development. Mol Cell Biol 20:4879–4887[Abstract/Free Full Text]
  28. Goessler UR, Bugert P, Bieback K, Deml M, Sadick H, Hormann K, Riedel F 2005 In-vitro analysis of the expression of TGFβ-superfamily-members during chondrogenic differentiation of mesenchymal stem cells and chondrocytes during dedifferentiation in cell culture. Cell Mol Biol Lett 10:345–362[Medline]
  29. Appleton CT, Pitelka V, Henry J, Beier F 2007 Global analyses of gene expression in early experimental osteoarthritis. Arthritis Rheum 56:1854–1868[CrossRef][Medline]
  30. Lohmueller KE, Pearce CL, Pike M, Lander ES, Hirschhorn JN 2003 Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. Nat Genet 33:177–182[CrossRef][Medline]
  31. Slager SL, Huang J, Vieland VJ 2000 Effect of allelic heterogeneity on the power of the transmission disequilibrium test. Genet Epidemiol 18:143–156[CrossRef][Medline]
  32. Longmate JA 2001 Complexity and power in case-control association studies. Am J Hum Genet 68:1229–1237[CrossRef][Medline]
  33. Cordell HJ, Clayton DG 2002 A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes. Am J Hum Genet 70:124–141[CrossRef][Medline]
  34. Moskvina V, Craddock N, Holmans P, Owen MJ, O'Donovan MC 2006 Effects of differential genotyping error rate on the type I error probability of case-control studies. Hum Hered 61:55–64[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheung, C.-L.
Right arrow Articles by Kung, A. W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheung, C.-L.
Right arrow Articles by Kung, A. W. C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Medline Plus Health Information
*Fractures
Related Collections
Right arrow Calcium and Bone Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals