help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2008-0366
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garcia, E. A.
Right arrow Articles by Korbonits, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garcia, E. A.
Right arrow Articles by Korbonits, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*SNP
*UniGene
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 93, No. 10 4158-4161
Copyright © 2008 by The Endocrine Society


BRIEF REPORT

Ghrelin Receptor Gene Polymorphisms and Body Size in Children and Adults

Edwin A. Garcia1, Barbara Heude1, Clive J. Petry, Maria Gueorguiev, Zaki K. Hassan-Smith, Antigoni Spanou, Susan M. Ring, David B. Dunger, Nicholas Wareham, Manjinder S. Sandhu, Ken K. Ong and Márta Korbonits

Department of Endocrinology (E.A.G., M.G., Z.K.H.-S., A.S., M.K.), John Vane Science Centre, Barts and the London Medical School, London EC1M 6BQ, United Kingdom; Medical Research Council Epidemiology Unit (B.H., N.W., M.S.S., K.K.O.), Institute of Metabolic Science, and Department of Paediatrics (C.J.P., D.B.D., K.K.O.), University of Cambridge, Addenbrooke’s Hospital, Cambridge CB0 0QQ, United Kingdom; Institut National de la Santé et de la Recherche Médicale Unit 780 (B.H.), Institut Fédératif de Recherche 69, Villejuif F-94807, France; Faculty of Medicine (B.H.), Université Paris-Sud, Orsay F-91405, France; and Department of Social Medicine (S.M.R.), University of Bristol, Bristol BS8 1TQ, United Kingdom

Address all correspondence and requests for reprints to: Dr. Ken Ong, Medical Research Council Epidemiology Unit, Institute of Metabolic Science, Addenbrooke’s Hospital Box 285, Cambridge CB2 0QQ, United Kingdom. E-mail: ken.ong{at}mrc-epid.cam.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Background: The GH secretagogue receptor type 1a gene (GHSR) encodes the cognate receptor of ghrelin, a gut hormone that regulates food intake and pituitary GH secretion. Previous studies in U.S. families and a German population suggested GHSR to be a candidate quantitative locus for association with human obesity and growth.

Aim: The aim of the study was to test common genetic variation in GHSR for association with body size in children and adults.

Methods: Sequencing was performed to systematically identify novel single nucleotide polymorphisms (SNPs) in GHSR. A set of three haplotype-tagging SNPs that captured all the genetic variation in GHSR was identified. These three haplotype-tagging SNPs were then genotyped in three large population-based U.K. cohort studies (two adult and one childhood cohort) comprising 5807 adults and 843 children.

Results: No significant genotype or haplotype associations were found with adult or childhood height, weight, or body mass index.

Conclusion: Common variation in GHSR is not associated with body size in U.K. adults or children.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The GH secretagogue receptor type 1a gene (GHSR) encodes the cognate receptor of ghrelin, a gut hormone that regulates energy homeostasis, food intake, and the release of GH by the anterior pituitary (1). The full-length receptor (type 1a) contains 366 amino acids encoded by two exons on chromosome 3q25. A splice variant (type 1b) comprises only exon 1 and a short region of the intron. It is not clear whether this variant is transcribed to protein in vivo, but theoretically it would code for a 289-amino acid protein, representing five transmembrane domains. The type 1b receptor is widely distributed (as opposed to the type 1a receptor) but has no biological activity in GH-releasing or calcium-related functional assays (2). In animal mode1s genomic regions syntenic with the human GHSR gene are candidate quantitative trait loci for energy expenditure and body temperature regulation (3). In addition, Ghsr-null mice have a lean phenotype (4), and improvement of glycemic profiles in leptin-deficient mice with concomitant suppression of Ghsr suggest a possible role of this gene in obesity and related comorbidities (5). In humans the GHSR locus is in physical proximity to genomic linkage peaks for obesity (6, 7).

Rare deleterious mutations in GHSR have been associated with short stature in humans (8, 9). Carriers of an alanine 204 to glutamate amino acid change were 3 SD smaller than average for height and weight (8). The 204 glutamate variant lowers cell membrane receptor density but does not alter receptor affinity for the agonist, and increased signal transduction was recorded (8). Another nonsynonymous GHSR variation at amino acid 279 was detected in one heterozygous obese child with short normal stature, but its function is yet unknown (9).

Common polymorphisms in GHSR have been associated with obesity in both a cross-sectional and a family-based association study (10). Five single nucleotide polymorphisms (SNPs)s in a single strong linkage disequilibrium (LD) block covering GHSR exon 1 and its 5' adjacent region were all associated with body mass index (BMI) and obesity in the German population-based Monitoring Trends and Determinants in Cardiovascular Disease cohort (10). In a large U.S. family study, the same susceptibility haplotype was more commonly transmitted to obese offspring (10).

The SNPs genotyped in the above study (10) were selected from a public database SNP. To confirm those observations and systemically test for association with common genetic variations, we resequenced GHSR to identify the common haplotype-tagging (ht)SNPs and then examined these SNPs for association with BMI in three population-based U.K. cohort studies comprising 5807 adults and 843 children.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Populations and measurements

The adult populations came from two distinct cohort studies: the Medical Research Council Ely Study (11) and European Prospective Investigation of Cancer (EPIC)-Norfolk (6, 12). The children were derived from one population, the Avon Longitudinal Study of Parents and Children (ALSPAC) (13, 14).

The Ely Study is a population-based study of the etiology and pathogenesis of type 2 diabetes and related metabolic disorders (11). The study consists of an ethnically homogeneous Caucasian population, aged between 40 and 65 yr at baseline. Body weight and height were measured at clinic visits using standard methods. This cohort was recruited from a population-sampling frame with a high response rate (74%), and is therefore representative of the eastern U.K. population. Body weight was known for 811 Ely Study participants.

The EPIC-Norfolk cohort (6, 12) is a prospective, population-based study of 25,639 men and women aged between 40 and 79 yr, resident in Norfolk, UK. Participants were recruited from age-sex registers of general practices in Norfolk as part of the 10-country collaborative EPIC study designed to investigate dietary and other determinants of cancer. The subcohort used for this study is a random sample of 5000 participants (EPIC5000) who were free of disease (cancer, coronary heart disease, and diabetes) at baseline, who had arrayed DNA samples available and had height and weight measured at clinic visits using standard methods (15). Body weight was known for 4996 EPIC5000 participants.

ALSPAC is a geographically based birth cohort (14). The initial ALSPAC sample consists of 14,541 pregnancies. Children in the present study derived from a 10% subcohort (Children in Focus) who were chosen at random from the last 6 months of ALSPAC births and attended research clinics at various time intervals between 4 and 61 months of age (1432 families attended at least one clinic) (13). At age 7 yr, body weight was measured using electronic scales and standing height by stadiometer (Leicester height measure; Child Growth Foundation, London, UK). Using a topical anesthetic, a nonfasting venous blood sample was collected. Samples were centrifuged and stored at –70 C. IGF-I levels were measured by direct ELISA (Diagnostic Systems Laboratories, Sinsheim, Germany) (16). Body weight at age 7 yr was known for 843 of these children. Lymphocyte DNA was prepared as described previously (17).

All the studies were approved by the local research ethics committees, and informed consent was obtained from each participant or their parent.

SNP selection

The selection of SNPs to cover the genetic variation of the GHSR gene in the European population was based on DNA resequencing performed in 70 obese French children (BMI > 97th percentile for age) with a strong component of early-onset obesity in their family background (18). The SNPs rs495225 (T171C), rs2232169 (C447G), and rs572169 (G477A) were selected following haplotype-tagging identification methods suggested by Johnson et al. (19).

Genotyping

Genotyping was performed sequentially; initially in the Ely Study and ALSPAC populations using the MassEXTEND (hME) assay on the SEQUENOM platform (Sequenom, San Diego, CA). Genotyping calling rate was 96% (95% confidence interval 0.95–0.99).

Subsequently EPIC5000 samples were genotyped using custom TaqMan assays (Applied Biosystems, Warrington, UK) on an ABI PRISM 7900HT sequence detection system (Applied Biosystems). Genotyping call rate was 98% and repeated assays in 75 DNA samples showed 100% concordance. Details for all genotyping primers, probes, and PCR conditions are available on request from the corresponding author.

Statistical analysis

Each SNP was tested for Hardy-Weinberg equilibrium using the {chi}2 test. We used linear regression to test the association between each SNP (unilocus tests) and the continuous anthropometric outcomes (dependent variables) adjusting for age and sex. All SNPs were considered as linear factors (i.e. additive or codominant models). Results are displayed as P value for the Wald test of the coefficients in the linear model, separately in each study and then jointly for adult populations. These analyses were performed with SAS version 8.2 (SAS Institute Inc., Cary, NC) and SPSS version 11 (SPSS, Chicago, IL).

Common haplotypes were inferred from the three htSNPs. Because phase was unknown, assignment of haplotype probabilities was performed using the SNPHAP program (19). Tests for main haplotype effects were performed using a linear model weighted by haplotype probability and clustered by the individual identification to obtain robust SEs (STATA regression command xi:regres) (20). Results are displayed as P value for main haplotype effects. Significance was taken at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Details of the GHSR SNPs identified are shown in Fig. 1Go. Genotype frequencies of the three GHSR htSNPs genotyped were in Hardy-Weinberg equilibrium (P > 0.2) in each study population (see supplementary data Table 1, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://jcem.endojournals.org). Genotype frequencies of T171C differed slightly between the EPIC5000 and Ely study populations (P = 0.044).


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 1. Schematic diagram of the GHSR gene demonstrating the common SNPs identified by sequencing of 70 French obese children. The three htSNPs genotyped in the U.K. population studies are indicated by solid triangles and bold type. Only SNP C231G (ttccgcgagctgcgcaccacc/gaccaacctctacctgtccag) is not annotated in HAPMAP Build 35.

 
The phenotypic characteristics of the study populations are summarized in supplementary data Table 2. In ALSPAC children none of the three htSNPs were associated with height, weight, BMI, or IGF-I levels (Table 1Go; all P > 0.16). In adults from the Ely Study, borderline associations were seen between T171C and BMI (P = 0.041, positive association with minor allele), and between G477A and IGF-I levels (P = 0.015, positive association with minor allele). In contrast, in EPIC5000 adults, there was only a weak inverse association between the G477A minor allele and height (P = 0.035). None of the associations were concordant between the Ely and EPIC5000 studies, and in a combined analysis of these two adult populations, no htSNP showed an association with height, weight, or BMI (all P > 0.11; Table 1Go).


View this table:
[in this window]
[in a new window]

 
TABLE 1. P values for the associations between each GHSRhtSNP and body size in children (ALSPAC) and adults (Ely and EPIC5000 studies)

 
Three major haplotypes (frequency > 0.1) could be inferred from the three GHSR htSNPs in the adult populations (supplementary data Table 3). Similar to the individual SNP analyses, there was no association between common GHSR haplotypes and body size in adults from Ely and EPIC5000 combined (supplementary data Table 3; all P > 0.20).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In three large U.K. cohort studies we failed to identify any consistent association between common haplotypic variation in GHSR and body weight, height, or BMI in adults or children.

Baessler et al. (10) previously studied two SNPs within GHSR and a further eight SNPs within the 40- to 50-kb up- and downstream adjacent regions and found that an LD block of five SNPs was associated with BMI in 1095 individuals from 178 pedigrees with multiple obese members. That LD block included the synonymous SNP G477A (rs572169); the minor allele (A) was transmitted more frequently than expected to obese cases, was more prevalent in obese cases than controls, and an additive genetic association with higher BMI was confirmed in a further 1418 Caucasians (10). Of the five SNPs in that study, we included only G477A (rs572169); however, this SNP would be expected to closely represent the other four obesity risk-associated SNPs due to high LD (r2 > 0.75). The relatively large size of our study provided greater than 98% power to replicate the association with obesity risk reported by Baessler et al. (10).

The reason for lack of consistency between the two reports is unknown. Baessler et al. (10) observed a consistent association in Caucasian populations from the United States and Germany, and our three U.K. populations were also largely Caucasian in origin, with a minor allele frequency of the G477A SNP in our populations (minor allele frequency = 0.31) being similar to the other study. It is possible that the genetic association might be dependent on, or modified by, some further environment, lifestyle, or other genetic factor. However, the lack of further confirmatory studies published since that original report might suggest that the original association was a false-positive finding. It is possible that genetic variations in the ghrelin gene, the ligand for the GHSR, may contribute to obesity risk directly or by interaction with GHSR variants.

In addition to G477A (rs572169), we genotyped two other SNPs to further cover the common variation in GHSR exons as indicated by our resequencing of 70 obese children. Inspection of the HapMap Build 35 CEU population data (http://www.hapmap.org/), which were released after the genotyping of this study, showed that in addition to the three SNPs that we genotyped, only one further intronic SNP (A216G, rs2948694) would be needed to fully cover the GHSR gene including the introns and 1 kb up- and downstream; however, that additional SNP is relatively rare (minor allele frequency = 0.07).

A limitation of our study is the slight discrepancies we obtained between the different study populations. Slight differences in genotype frequencies between the Ely Study and EPIC5000 populations could reflect differences in selection of these cohorts. Furthermore, borderline associations in the Ely Study with adult body weight and BMI were not confirmed in larger EPIC5000 study. We checked that the first results were not driven by a few individuals (data not shown) and conclude that they might have arisen by chance. Associations with circulating IGF-I levels in the Ely Study could not be tested in EPIC5000 due to lack of data but were not supported by associations with body size.

In conclusion, in a systematic study of common GHSR variation in three large population-based U.K. cohort studies comprising 5807 adults and 843 children, we found no association with body weight, height, or BMI.


    Acknowledgments
 
We are extremely grateful to the families and volunteers in the ALSPAC, EPIC-Norfolk, and Ely studies who gave their time to take part in these studies.


    Footnotes
 
The U.K. Medical Research Council, the Wellcome Trust, and the University of Bristol provide core support for ALSPAC. The Ely Study was funded by the Medical Research Council and Diabetes UK. EPIC-Norfolk is supported by program grants from the U.K. Medical Research Council UK and Cancer Research UK. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Disclosure Statement: The authors have nothing to declare.

First Published Online July 22, 2008

1 E.A.G. and B.H. should be considered as joint first authors. Back

Abbreviations: ALSPAC, Avon Longitudinal Study of Parents and Children; BMI, body mass index; EPIC, European Prospective Investigation of Cancer; EPIC5000, EPIC subcohort of a random sample of 5000 participants; GHSR, GH secretagogue receptor type 1a gene; ht, haplotype-tagging; LD, linkage disequilibrium; SNP, single nucleotide polymorphism.

Received February 14, 2008.

Accepted July 11, 2008.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656–660[CrossRef][Medline]
  2. Gnanapavan S, Kola B, Bustin SA, Morris DG, McGee P, Fairclough P, Bhattacharya S, Carpenter R, Grossman AB, Korbonits M 2002 The tissue distribution of the mRNA of ghrelin and subtypes of its receptor, GHS-R, in humans. J Clin Endocrinol Metab 87:2988
  3. Ueda H, Ikegami H, Kawaguchi Y, Fujisawa T, Yamato E, Shibata M, Ogihara T 1999 Genetic analysis of late-onset type 2 diabetes in a mouse model of human complex trait. Diabetes 48:1168–1174[Abstract]
  4. Zigman JM, Nakano Y, Coppari R, Balthasar N, Marcus JN, Lee CE, Jones JE, Deysher AE, Waxman AR, White RD, Williams TD, Lachey JL, Seeley RJ, Lowell BB, Elmquist JK 2005 Mice lacking ghrelin receptors resist the development of diet-induced obesity. J Clin Invest 115:3564–3572[CrossRef][Medline]
  5. Sun Y, Asnicar M, Saha PK, Chan L, Smith RG 2006 Ablation of ghrelin improves the diabetic but not obese phenotype of ob/ob mice. Cell Metab 3:379–386[CrossRef][Medline]
  6. Rice T, Chagnon YC, Perusse L, Borecki IB, Ukkola O, Rankinen T, Gagnon J, Leon AS, Skinner JS, Wilmore JH, Bouchard C, Rao DC 2002 A genomewide linkage scan for abdominal subcutaneous and visceral fat in black and white families: the HERITAGE Family Study. Diabetes 51:848–855[Abstract/Free Full Text]
  7. Vionnet N, Hani EH, Dupont S, Gallina S, Francke S, Dotte S, De Matos F, Durand E, Lepretre F, Lecoeur C, Gallina P, Zekiri L, Dina C, Froguel P 2000 Genomewide search for type 2 diabetes-susceptibility genes in French whites: evidence for a novel susceptibility locus for early-onset diabetes on chromosome 3q27-qter and independent replication of a type 2-diabetes locus on chromosome 1q21–q24. Am J Hum Genet 67:1470–1480[CrossRef][Medline]
  8. Pantel J, Legendre M, Cabrol S, Hilal L, Hajaji Y, Morisset S, Nivot S, Vie-Luton MP, Grouselle D, de Kerdanet M, Kadiri A, Epelbaum J, Le Bouc Y, Amselem S 2006 Loss of constitutive activity of the growth hormone secretagogue receptor in familial short stature. J Clin Invest 116:760–768[CrossRef][Medline]
  9. Wang HJ, Geller F, Dempfle A, Schauble N, Friedel S, Lichtner P, Fontenla-Horro F, Wudy S, Hagemann S, Gortner L, Huse K, Remschmidt H, Bettecken T, Meitinger T, Schafer H, Hebebrand J, Hinney A 2004 Ghrelin receptor gene: identification of several sequence variants in extremely obese children and adolescents, healthy normal-weight and underweight students, and children with short normal stature. J Clin Endocrinol Metab 89:157–162[Abstract/Free Full Text]
  10. Baessler A, Hasinoff MJ, Fischer M, Reinhard W, Sonnenberg GE, Olivier M, Erdmann J, Schunkert H, Doering A, Jacob HJ, Comuzzie AG, Kissebah AH, Kwitek AE 2005 Genetic linkage and association of the growth hormone secretagogue receptor (ghrelin receptor) gene in human obesity. Diabetes 54:259–267[Abstract/Free Full Text]
  11. Wareham NJ, Hennings SJ, Byrne CD, Hales CN, Prentice AM, Day NE 1998 A quantitative analysis of the relationship between habitual energy expenditure, fitness and the metabolic cardiovascular syndrome. Br J Nutr 80:235–241[Medline]
  12. Day N, Oakes S, Luben R, Khaw KT, Bingham S, Welch A, Wareham N 1999 EPIC-Norfolk: study design and characteristics of the cohort. European Prospective Investigation of Cancer. Br J Cancer 80(Suppl 1):95–103
  13. Ong KK, Ahmed ML, Emmett PM, Preece MA, Dunger DB 2000 Association between postnatal catch-up growth and obesity in childhood: prospective cohort study. BMJ 320:967–971[Abstract/Free Full Text]
  14. Golding J, Pembrey M, Jones R 2001 ALSPAC—the Avon Longitudinal Study of Parents and Children. I. Study methodology. Paediatr Perinat Epidemiol 15:74–87[CrossRef][Medline]
  15. Sandhu MS, Heude B, Young EH, Luben R, Luan J, Khaw KT, Todd J, Wareham NJ 2005 INS VNTR class genotype and indexes of body size and obesity: population-based studies of 7,999 middle-aged men and women. Diabetes 54:2812–2815[Abstract/Free Full Text]
  16. Ong K, Kratzsch J, Kiess W, Dunger D 2002 Circulating IGF-I levels in childhood are related to both current body composition and early postnatal growth rate. J Clin Endocrinol Metab 87:1041–1044[Abstract/Free Full Text]
  17. Jones RW, Ring S, Tyfield L, Hamvas R, Simmons H, Pembrey M, Golding J 2000 A new human genetic resource: a DNA bank established as part of the Avon Longitudinal Study of Pregnancy and Childhood (ALSPAC). Eur J Hum Genet 8:653–660[CrossRef][Medline]
  18. Gueorguiev MLC, Mein CA, Meyre D, Benzinou M, Weill J, Grossman AB, Froguel P, Korbonits M 2004 Ghrelin receptor gene: involvement in eating behaviour. 11th Congress of the European Association O3.4 (Abstract)
  19. Johnson GC, Esposito L, Barratt BJ, Smith AN, Heward J, Di Genova G, Ueda H, Cordell HJ, Eaves IA, Dudbridge F, Twells RC, Payne F, Hughes W, Nutland S, Stevens H, Carr P, Tuomilehto-Wolf E, Tuomilehto J, Gough SC, Clayton DG, Todd JA 2001 Haplotype tagging for the identification of common disease genes. Nat Genet 29:233–237[CrossRef][Medline]
  20. Mander A 2003 QHAPIPF: Stata module to perform analysis of quantitative traits using refression and log-linear modelling when PHASE is unknown. Boston College Department of Economics, Boston, MA. http.//ideas.repec.org/c/boc/bocode/s425502.html



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
E. A Garcia, P. King, K. Sidhu, H. Ohgusu, A. Walley, C. Lecoeur, M. Gueorguiev, S. Khalaf, D. Davies, A. B Grossman, et al.
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes
Eur. J. Endocrinol., August 1, 2009; 161(2): 307 - 315.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garcia, E. A.
Right arrow Articles by Korbonits, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garcia, E. A.
Right arrow Articles by Korbonits, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*SNP
*UniGene
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals