Increased Interleukin (IL)-1β Messenger Ribonucleic Acid Expression in β-Cells of Individuals with Type 2 Diabetes and Regulation of IL-1β in Human Islets by Glucose and Autostimulation
Marianne Böni-Schnetzler,
Jeffrey Thorne,
Géraldine Parnaud,
Lorella Marselli,
Jan A. Ehses,
Julie Kerr-Conte,
Francois Pattou,
Philippe A. Halban,
Gordon C. Weir and
Marc Y. Donath
Clinic of Endocrinology and Diabetes (M.B.-S., J.A.E., M.Y.D.), University Hospital of Zurich, 8091 Zurich, Switzerland; Section of Islet Transplantation and Cell Biology (J.T., L.M., G.C.W.), Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts 02215; Department of Genetic Medicine and Development (G.P., P.A.H.), University of Geneva, 1211 Geneva 4, Switzerland; and Thérapie Cellulaire du Diabète (J.K.-C., F.P.), Institut National de la Santé et de la Recherche Médicale Unit M 859, Faculté de Médecine, 59045 Lille Cedex, France
Address all correspondence and requests for reprints to: Marianne Böni-Schnetzler, Ph.D., Clinic of Endocrinology and Diabetes, Department of Medicine, University Hospital, CH-8091 Zurich, Switzerland. E-mail: marianne.boeni{at}usz.ch.
Context: Elevated glucose levels impair islet function and survival,and it has been proposed that intraislet expression of IL-1βcontributes to glucotoxicity.
Objective: The objective was to investigate IL-1β mRNAexpression in near-pure β-cells of patients with type 2diabetes (T2DM) and study the regulation of IL-1β by glucosein isolated human islets.
Methods: Laser capture microdissection was performed to isolateβ-cells from pancreas sections of 10 type 2 diabetic donorsand nine controls, and IL-1β mRNA expression was analyzedusing gene arrays and PCR. Cultured human islets and fluorescence-activatedcell sorter-purified human β-cells were used to study theregulation of IL-1β expression by glucose and IL-1β.
Results: Gene array analysis of RNA from β-cells of individualswith T2DM revealed increased expression of IL-1β mRNA.Real-time PCR confirmed increased IL-1β expression in sixof 10 T2DM samples, with minimal or no expression in nine controlsamples. In cultured human islets, IL-1β mRNA and proteinexpression was induced by high glucose and IL-1β autostimulationand decreased by the IL-1 receptor antagonist IL-1Ra. The glucoseresponse was negatively correlated with basal IL-1β expressionlevels. Autostimulation was transient and nuclear factor-B dependent.Glucose-induced IL-1β was biologically active and stimulatedIL-8 release. Low picogram per milliliter concentrations ofIL-1β up-regulated inflammatory factors IL-8 and IL-6.
Conclusion: Evidence that IL-1β mRNA expression is up-regulatedin β-cells of patients with T2DM is presented, and glucose-promotedIL-1β autostimulation may be a possible contributor.
Chronically elevated glucose levels impair islet function andproliferation and induce apoptosis, leading to the concept ofislet glucotoxicity (1, 2). Whereas it has been well documentedover the last 20 yr that cytokines are crucial in the etiopathologyof type 1 diabetes (3, 4), only recently was it postulated thatcytokines also play a role in islet dysfunction and death intype 2 diabetes (T2DM) (5, 6, 7). It has been proposed thatintraislet expression of inflammatory cytokines, in particularof IL-1β, contributes to the pathogenesis of type 2 diabetes(6, 8). This hypothesis was based on observations of increasedIL-1β expression in pancreas sections of patients withT2DM by immunofluorescence and by in situ hybridization as wellas in hyperglycemic Psammomys obesus (8). Furthermore, in vitro,high-glucose concentrations induced IL-1β release fromsome but not all human islet cell preparations (8). Nevertheless,the role of IL-1β in the deleterious effects of high glucoseor the type 2 diabetes milieu on human pancreatic islets hasbeen challenged based on ex vivo studies (9, 10). However, arecent clinical study demonstrated that the blockade of IL-1in type 2 diabetic patients with the IL-1 receptor antagonist(IL1-Ra) results in improved blood glucose levels and insulinsecretion in the absence of changes in peripheral insulin resistanceand body mass index (BMI) (11).
IL-1β has some unique features not shared by other chemokinesand cytokines. Most notably, the signal transduction pathwayvia the IL-1 receptor (type I) is unusually effective and lessthan 10 molecules of IL-1β bound per cell can induce biologicalresponses (12, 13, 14). Because of its effective signaling andcytotoxic effects on cells, processing, release, and receptorbinding of IL-1β to target cells is tightly controlled.Unlike other secreted cytokines, IL-1β does not have aleader sequence and has to be processed from pro-IL-1βto IL-1β by inflammasomes before secretion (15). SecretedIL-1β associates with binding proteins such as the solubleform of the nonsignaling type II IL-1 receptor, thereby inhibitingits signaling to target cells (12, 16). These IL-1β bindingproteins are also the reason that conventional ELISA detectionof IL-1β is problematic (16). Furthermore, IL-1β-producingcells also synthesize their own antagonist IL-1Ra, which bindsto the IL-1 receptor without having agonistic properties andthereby modulates inflammatory responses (17, 18). The low levelof expression and the above described control mechanisms renderIL-1β protein difficult to detect.
IL-1β is typically produced by activated immune cells,but it is also expressed at lower levels by many different celltypes (19). In islets, IL-1β expression has been demonstratedin resident lymphoid cells (20, 21), ductal cells, and vascularendothelial cells (22) as well as insulin producing β-cells(8, 21, 23).
To demonstrate increased IL-1β mRNA expression in pancreaticsections of type 2 diabetic patients, we used laser capturemicrodissection to obtain near pure samples of β-cellsfrom 10 patients with T2DM and nine controls. To elucidate theregulation of IL-1β expression and to understand the observedvariable effects of glucose on IL-1β induction, we examinedIL-1β expression in vitro using 12 different human isletpreparations. Furthermore, we studied the effects of IL-1βand glucose on islet derived inflammatory factors IL-8 and IL-6.
Nearly pure β-cells were obtained from human pancreaticfrozen sections of 10 T2DM donors and nine controls by LCM.The technical details and β-cell purity were describedpreviously (24). Briefly, LCM was performed under direct microscopicvisualization of the autofluorescent signal positive areas.We performed 150–250 pulses per section on 20–30sections per donor corresponding to a total of 5,000–15,000cells. RNA was extracted (25), amplified, biotinylated, andhybridized to GeneChip human X3P array (Affymetrix, Santa Clara,CA) and analyzed as described (24).
RT-PCR of LCM-derived RNA was done using TaqMan reverse transcriptionreagents and universal PCR master mix (Applied Biosystems, FosterCity, CA). Ribosomal L32 transcripts served as a reference andprimers were designed using Primer Express software (AppliedBiosystems). For triplicate PCR determinations, SYBR green (IL-1β,IL-8) or TaqMan technology (RPL32) was used. The relative amountof mRNA was calculated by the cycle threshold method. Forwardand reverse primers were, respectively, for IL-1β (CCACGGCCACATTTGGTTand AGGGAAGCGGTTGCTCATC), IL-8, (GATCCACAAGTCCTTGTTCCA and GCTTCCACATGTCCTCACAA),and RPL32, (TCCTGGTCCACAACGTCAAG and AGCGATCTCGGCACAGTAAGA)with the internal detection primer, AGCTGGAAGTGCTGCTGATGTGCAAC.
Human islet cultures and treatment with glucose, IL-1β, and IL-1Ra
Islets were isolated from pancreata of organ donors aged between35 and 70 yr with a BMI between 20.7 and 40.6 kg/m2. Islet purityranged between 75 and 90% as judged by dithizone staining andglucose-stimulated insulin secretion was 3.3 ± 0.96-fold(mean ± SD, n = 8). Islets were plated on extracellularmatrix-coated dishes (Novamed Ltd., Jerusalem, Israel) at adensity of 150–200 islets per 35 mm Ø dish in CMRL1066 medium containing 5.5 mM glucose and 10% fetal calf serum(8). After 3 d of preculture, experiments were started by addingmedium with 5.5 or 33.3 mM glucose for a further 4 d withoutmedium change. IL-1Ra (Amgen, Seattle, WA) was added at 1 µg/mland rhIL-1β (R&D Systems Inc., Minneapolis, MN) at0.2 ng/ml at the start of the experiments.
Human β-cell purification
The detailed protocol for purification of human β-cellsis described elsewhere (26) and depends on the preferentiallabeling of β-cells with the fluorescent Zn2+-chelatorNewport Green (27, 28) and subsequent fluorescence-activatedcell sorter (FACS) sorting. The resulting cell population wascomprised of greater than 90% β-cells based on immunostainingwith either antiinsulin or antipancreatic duodenal homeobox-1.Then 105 β-cells/dish were cultured and treated as describedfor the whole islets.
Quantitative PCR of cDNA from islet and β-cell cultures
RNA extraction and cDNA synthesis was done as described (29).For quantitative PCR, the real-time PCR system 7500 (AppliedBiosystems) and the following commercial TaqMan assays wereused: IL-1β, Hs00174097_m1; IL-1Ra, Hs00277299_m1; hypoxanthine-guaninephosphoribosyl transferase HPRT-1, Hs99999909_m1; IL-6, Hs00174131_m1;IL-8, Hs00174103_m1; CD31, Hs00169777_m1; insulin, Hs00154355_m1;CD68, Hs02741908_m1; caspase-1, Hs00236158_m1; prohormone convertase(PC)-1, Hs01026108_m1; PC2, Hs00159922_m1; and eukaryotic 18srRNA, Hs99999901_s1 (Applied Biosystems, Rotkreuz, Switzerland).Triplicate cycle threshold values were normalized to 18s andvalues above cycle 36 were not used.
Detection of IL-8 and IL-6 with Luminex technology
Culture media were collected and stored at –20 C. IL-6and IL-8 concentrations were assayed using a 2-Plex LINCO kitcontaining beads coupled with antibodies specific for IL-6 andIL-8 (Millipore, Billerica, MA). Recording was done with a Bioplexanalyzer from Bio-Rad (Hercules, CA).
Nuclear factor-B (NF-B) inhibition
Islets were precultured for 3 d, media were removed, and cellswere treated for 2 h with 5 µM BAY 11–7083 (ANAWA,Wangen, Switzerland) or solvent control [0.01% dimethylsulfoxide(DMSO)]. Cells were washed with media and stimulated for 24h with or without 0.2 ng/ml IL-1β before RNA extraction.
Western blotting
Western blotting of protein extracts from islets was done asdescribed (29). Anti-IL-1β antibody was from Xoma (Berkeley,CA), horseradish peroxidase-labeled goat antihuman IgG (PierceBiotechnology, Rockford, IL), antiactin (C-2), and a horseradishperoxidase-labeled goat antimouse IgG (Santa Cruz Biotechnology,Santa Cruz, CA). Signal detection was assessed with a chemoluminescenceimager (LAS-3000; Bucher Biotech, Basel, Switzerland).
Statistics
Data were analyzed with the GraphPad Prism program (GraphPad,San Diego, CA). Statistical significance was determined usingthe t test for normally distributed samples, the Mann Whitneyfor nonnormal distribution, and ANOVA with Bonferronispost hoc test for multiple comparisons. Significance was setat P < 0.05.
IL-1β mRNA expression is increased in β-cells from patients with T2DM
IL-1β and IL-8 mRNA expression was analyzed from gene profilesof near-pure samples of β-cells obtained by LCM from frozenpancreatic tissue sections of 10 T2DM and nine nondiabetic cadaverdonors. The control and diabetic groups had a matched BMI of30.8 ± 6.0 kg/m2 in the diabetic and 30.9 ± 5.4kg/m2 in the control group. The average duration for known diabeteswas 5.3 ± 2.3 yr (n = 7), and the cause of death wasin most cases a cardiovascular accident (supplemental Table1, published as supplemental data on The Endocrine SocietysJournals Online Web site at http://jcem.endojournals.org).
Gene array analysis (Table 1) showed that IL-1β and IL-8mRNA expression was higher in β-cell samples from patientswith T2DM when compared with controls. Regression analysis ofthe gene array data revealed a significant correlation (r2 =0.48, P = 0.0267) between the expression of IL-1β and IL-8and no correlation between IL-1β and insulin expression(P = 0.155). Furthermore, there was no differential gene expressionin samples from the control and T2DM groups for IL-1Ra, insulin,zinc transporter ZnT8 (SLC30A8), inflammatory/immune cell markers(CD68, CD163, CD3d, and tryptase-1), and endothelial cell markers(VE-cadherin, CD31, CD54, von Willebrand factor, CD34, CD51).
TABLE 1. IL-1β mRNA expression in nearly pure β-cells obtained from patients with and without T2DM
Increased expression of IL-1β and IL-8 in samples fromT2DM was confirmed by real-time quantitative PCR. We found stronglyincreased IL-1β mRNA levels (77.52 ± 36.84 fold)in six of 10 patients with T2DM, whereas minimal expressionof IL-1β (1.39 ± 0.26 fold) was observed in threeof nine controls (P = 0.021). IL-8 expression was also observedby real-time PCR in six of 10 T2DM samples and four of ninecontrol samples (Table 1). The mean IL-8 mRNA levels of thediabetics of 15.12 ± 5.23-fold vs. 3.19 ± 1.9-foldin controls also showed a trend to increased expression (P =0.086) in the diabetic group. The gene array data correlatedwith the PCR data for both IL-1β (r2 = 0.67, P = 0.007)and IL-8 (r2 = 0.73, P = 0.0016). There were no correlationsfor the IL-1β PCR data with the BMI or cold ischemia time.A weak correlation was found for blood glucose and the IL-8gene array data (r2 = 0.358, P = 0.018) but no correlation withthe IL-8 PCR results. However, the blood glucose levels weresignificantly correlated with both the IL-1β-positive PCRresults (r2 = 0.784, P = 0.003) and the IL-1β gene arraydata (r2 = 0.565, P = 0.001).
IL-1β mRNA levels are induced by glucose and the responsiveness to glucose correlates with basal IL-1β levels
IL-1β mRNA expression and the effect of high glucose concentrationswere evaluated in vitro using cultured human islets from 12different donors. Untreated islets from different donors expressedIL-1β mRNA at unusually variable levels when compared withother basal transcript levels such as PC1/3 and PC2, insulin,macrophage marker CD68, and endothelial cell marker CD31 (Fig.1, A and D). There was no correlation of basal IL-1β expressionwith basal insulin (P = 0.649), CD31 (P = 0.65), or CD68 (P= 0.179) expression. This excludes that a different cell compositionin different islet isolations or a technical problem relatedto the RNA preparation is the cause for the variable basal IL-1βlevels. Upon treatment of different islet preparations withhigh glucose concentrations, we observed that six of 12 isletpreparations displayed a glucose-induced increase of IL-1βmRNA levels relative to the basal state (Fig. 1B). The meanincrease in all 12 preparations was 2.0 ± 0.4-fold (Fig.2A) and 3.02 ± 0.49-fold in those six preparations thatdid respond. Most islet preparations with low basal IL-1βlevels displayed a glucose-induced increase in IL-1β expression.Conversely, in preparations with elevated basal IL-1β mRNAlevels, glucose failed to further enhance IL-1β expression(Fig. 1, A and B, i.e. H1, H7, H9). There was a significantnegative correlation between basal and glucose-stimulated IL-1βmRNA expression (Fig. 1E), suggesting that high basal IL-1βlevels blunted the effects of glucose.
FIG. 1. Responsiveness of human islets to glucose-induced IL-1β expression and IL-1Ra inhibition depends on baseline IL-1β expression levels. Human islets were cultured for 4 d at 5.5 (basal) or 33.3 mM glucose. IL-1β and IL-1Ra mRNA levels were quantified using 18s RNA as an internal standard. The mean of triplicate determinations for each preparation is shown. A, Basal IL-1β mRNA levels expressed relative to a human islet preparation arbitrarily designated as H0 and defined as 1. B Effect of 33.3 vs. 5.5 mM glucose on IL-1β mRNA in different human islet preparations expressed as fold of basal levels (5.5 mM glucose). C, Effect of 33.3 mM glucose on IL-1Ra mRNA expressed as fold of basal levels, D, Variation of basal expression of different gene products in 11–12 human islet preparations. For each separate gene transcript, we defined the sample with the lowest expression as 1. E, Linear regression analysis of basal IL-1β mRNA vs. fold stimulation of IL-1β mRNA by glucose. F, Fold glucose-stimulated IL1β mRNA vs. fold glucose-inhibited IL-1Ra mRNA.
FIG. 2. IL-1β mRNA is induced by IL-1β autostimulation and glucose. A, Effect of 33.3 mM glucose (n = 12 separate donors), 0.2 ng/ml IL-1β (n = 11 separate donors), and a combination of 33.3 mM glucose and 0.2 ng/ml IL-1β (n = 8 separate donors) on IL-1β mRNA levels in whole-islet cultures relative to basal levels (5.5 mM glucose). Means ± SE, significance vs. 5.5 mM glucose was determined with the Wilcoxon rank test. *, P < 0.05; **, P < 0.01. B, Effect of 0.2 ng/ml IL-1β or 33.3 mM glucose on IL-1β mRNA levels in purified β-cells (mean ± SE, n = 3) relative to 5.5 mM glucose (Mann Whitney test). C, Effect of 33.3 mM glucose (n = 12), 0.2 ng/ml IL-1β (n = 10), or 1 µg/ml IL-1Ra (n = 6) on IL-1Ra mRNA levels relative to untreated islet control cultures. Means ± SE, significance vs. untreated controls was determined with the Wilcoxon rank test, **, P < 0.01.
Glucose reduces IL-1Ra mRNA levels
We next analyzed the effects of glucose on IL-1Ra mRNA levelsin the 12 human islet cultures (Fig. 1C). The mean IL-1Ra mRNAlevel of all human preparations was decreased by 33.3 mM glucoseto 72.2 ± 9.57% of the control levels (Fig. 2C). Mostislet preparations with glucose-induced IL-1β mRNA haddiminished IL-1Ra mRNA levels, whereas nonresponding preparationshad unchanged IL-1Ra levels, and there were significant correlationsbetween glucose-stimulated IL-1β and glucose inhibitedIL-1Ra mRNA levels (Fig. 1F) and between basal IL-1β andglucose-inhibited IL-1Ra (supplemental Fig. 1, published assupplemental data on The Endocrine Societys JournalsOnline Web site at http://jcem.endojournals.org).
IL-1β expression is increased by IL-1β autostimulation
Induction of IL-1β expression by IL-1β itself (autostimulation)was reported for different cell types (30, 31, 32, 33) but notyet for islets. Treatment of human islets with 0.2 ng/ml exogenousIL-1β [a concentration in the range released by islets(8, 9)] significantly stimulated IL-1β mRNA expressionby 4.6 ± 1.3-fold (Fig. 2A). By contrast, nonspecificcell death induced by staurosporine resulted in a dose-dependentinhibition of IL-1β mRNA expression (not shown). Autostimulationwas positively correlated with glucose stimulated IL-1βexpression in human islet preparations (supplemental Fig. 2).High glucose together with 0.2 ng/ml IL-1β did not furtherincrease IL-1β mRNA (Fig. 2A ), and there was no effectof 0.2 ng/ml IL-1β on IL-1Ra expression (Fig. 2C).
Because primary islet cell cultures contain different cell types,we examined whether IL-1β autostimulation can be observedin FACS-purified human β-cells. IL-1β strongly inducedautostimulation in purified β-cells (15.3 ± 4.11;Fig. 2B), whereas glucose stimulated IL-1β mRNA expressionby 1.62 ± 0.27-fold (Fig. 2B).
Glucose induces biologically active IL-1β
To test whether glucose treatment results in release of biologicallyactive IL-1β, we used the antagonist IL-1Ra, which blocksligand-induced IL-1 receptor activation without having agonisticproperties (17, 34). We incubated control and glucose- and IL-1β-treatedhuman islet cultures with IL-1Ra and measured IL-1β andIL-8 mRNA and protein expression. Figure 3, A and B, shows thatIL-1Ra blocked IL-1β-induced IL-1β and IL-8 mRNA,demonstrating complete antagonism of IL-1β action. Importantly,IL-1Ra also inhibited glucose-stimulated IL-1β and IL-8mRNA expression (Fig. 3 , A and B).
FIG. 3. Glucose-induced IL-1β and IL-8 expression is antagonized with IL-1Ra. A, IL-1β mRNA expression in human islet cell cultures maintained at 5.5 mM glucose (control) or 33.3 mM glucose or treated with 0.2 ng/ml IL-1β in the presence (black bars) or absence (open bars) of 1 µg/ml IL-1Ra. Data are expressed relative to the untreated controls (means ± SE, n = 7). Significance of the effect of IL-1Ra and glucose was determined with ANOVA and Bonferronis post hoc test. *, Control vs. IL-1Ra, P < 0.05 ; **, 33.3 mM glucose vs. IL-1Ra, P < 0.01 ; , control vs. 33.3 mM glucose or IL-1β P < 0.05. B, IL-8 mRNA and statistics determined as described for A (means ± SE, n = 6). *, 33.3 mM glucose vs. IL-1Ra, P < 0.05; **, IL-1β vs. IL-1Ra, P < 0.01; , control vs. 33.3 mM glucose, P < 0.05; , control vs. IL-1β, P < 0.01. C. Human islet cell cultures were treated as described under A, and islet cell extracts were subjected to Western blotting with an anti-IL-1β and an antiactin antibody. D, Secreted IL-8 in culture supernatants of cultures treated for 4 d with 33.3 mM glucose or 5.5 mM glucose in the presence (black bars) or absence (open bars) of 1 µg/ml IL-1Ra. Results from each islet preparation were expressed as percent of the untreated control (mean IL-8 concentration ± SD: 12.5 ± 4.4 ng/ml, n = 5). *, 33.3 mM glucose vs. IL-1Ra, P < 0.05 ; , control vs. 33.3 mM glucose, P < 0.05.
Autostimulation and glucose-induced IL-1β and IL-8 productionwas also demonstrated at the protein level by measuring releasedIL-8 and performing Western blot analysis of pro-IL-1β(32 kDa). The latter enabled us to distinguish islet cell-producedIL-1β from exogenously added IL-1β. A representativeblot with islet extracts from six different donors is shownin Fig. 3C. In all islet preparations, IL-1β strongly inducedand IL-1Ra inhibited pro-IL-1β expression. Glucose increasedpro-IL-1β expression in three of six islet donors, a frequencyexpected based on the results of Fig. 1 . Furthermore, glucoseincreased the level of IL-8 in culture supernatants (Fig. 3D).IL-1Ra antagonized glucose-induced pro-IL-1β and IL-8 (Fig.3, C and D).
Dose response, kinetics, and NF-B dependence of IL-1β expression
Next, we determined the IL-1β and glucose dose dependenceof IL-1β mRNA induction (Fig. 4, A and B) and observedsignificantly increased IL-1β expression with 11.1 mM glucose(Fig. 4A) and 0.2 and 1 ng/ml IL-1β (Fig. 4B). The kineticsof IL-1β-induced IL-1β mRNA expression showed it tobe transient (Fig. 4C). Basal IL-1β mRNA levels increasedonly minimally during the 4-d culture period, whereas 0.2 ng/mlexogenous IL-1β induced a peak of IL-1β mRNA expressionat d 1, followed by a decline and another increase at d 4. Bycontrast, glucose-induced IL-1β mRNA stimulation was slower,and a significant increase was evident only at d 4 (not shown).To test whether NF-B is involved in IL-1β autostimulation,we pretreated islets with the irreversible inhibitor of inhibitory-Bphosphorylation BAY 11–7082 (35). Figure 4D shows thatinhibition of NF-B activation reduced IL-1β autostimulationby 41.2 ± 6.2%.
FIG. 4. Glucose and IL-1β dose dependence of IL-1β expression and kinetics and NF-B dependence of IL-1β autostimulation. A, IL-1β mRNA levels of human islet cultures treated for 4 d in the presence of increasing concentrations of glucose. Each data point shows the mean (± SE) of quadruplicate cultures from two donors analyzed in triplicate. Significance relative to the lowest glucose value was determined with Mann Whitney. *, P < 0.05; **, P < 0.01. B, Human islet cell cultures were treated for 4 d without (0) or with increasing concentrations of recombinant human IL-1β. Results were expressed as fold of the untreated control and represent the mean of three islet preparations ± SE. Significance relative to the value without IL-1β treatment was determined with Mann Whitney. *, P < 0.05. C, Kinetics of IL-1β mRNA stimulation. Islet cultures were treated with (dashed lines) or without (solid lines) 0.2 ng/ml IL-1β; results were expressed as fold of the 0 time point, and the mean ± SE of three different islet preparations is shown. Significance was determined for control vs. IL-1β-treated cultures for each individual time point with Mann Whitney. *, P < 0.05. D, Cultured human islets were treated for 2 h with 5 µM BAY 11–7082 or 0.01% DMSO (solvent) alone. After washing, the islet cultures were incubated for 24 h with or without 0.2 ng/ml IL-1β. Data were expressed as percent of the cultures stimulated with 0.2 ng/ml IL-1β together with 0.01% DMSO and are means ± SE of four different islet preparations. Statistical significance was determined using the Mann Whitney test. **, P < 0.01 for BAY 11–7082/ IL-1β vs. IL-1β alone.
Low picogram per milliliter concentrations of IL-1β regulate IL-6 and IL-8 expression in human islets
IL-1β is a master regulator of various inflammatory factorsincluding IL-8 and IL-6 (19). To test that this holds true inislets, we antagonized IL-1β-induced IL-6 and IL-8 proteinrelease with IL-1Ra (Fig. 5, A and B). Time-course experimentsshowed that IL-1β-induced IL-6 and IL-8 mRNA with kineticssimilar to those of IL-1β autoinduction (Fig. 5, C andD, compared with Fig. 4C). IL-1β also increased IL-8 mRNAexpression in FACS-purified β-cells by 4.95 ± 0.95-fold(Fig. 5E).
FIG. 5. IL-1β induces IL-8 and IL-6 expression and release from human islets. A and B, Human islet cell cultures were treated for 4 d without (control) or with 0.2 ng/ml IL-β, or IL-1β and 33.3 mM glucose in the presence (black bars) or absence (open bars) of 1 µg/ml IL-1Ra. IL-8 (A) and IL-6 (B) concentrations in culture supernatants (200 islets per 2 ml media) were determined and expressed as percent of the untreated controls (100%). Mean ± SE for four different islet preparations are shown in A and for six islet preparations in B. Significance was determined with Mann Whitney. *, P < 0.05; **, P < 0.01 of cultures with vs. without IL-1Ra. C and D, Kinetics of IL-8 (C) and IL-6 (D) mRNA induction by 0.2 ng/ml IL-1β. Results were expressed as fold of the 0 time point, the mean ± SE of three different islet preparations is shown, and significance was determined with Mann Whitney. *, P < 0.05; **, P < 0.01 of control vs. IL-1β-treated cultures for each time point. E, IL-8 mRNA levels of FACS-purified β-cells treated with or without 0.2 ng/ml IL-1β (n = 3 separate β-cell purifications; *, P < 0.05, Mann Whitney). F and G, Dose responses of IL-1β-induced IL-8 and IL-6 released into culture media from human islets treated for 4 d with various concentrations of IL-1β. For IL-8 (F), the mean ± SE of three islet preparations is shown. Significance vs. the data point without IL-1β was determined by ANOVA with the Dunnetts posttest. *, P < 0.05; **, P < 0.01. The dose response of IL-1β-induced IL-6 release (G) is expressed as fold of untreated control (0.7–5.4 ng/ml) and the mean ± SD of two islet preparations is shown.
The concentrations of IL-1β released by islets were inthe low picogram per milliliter range (8, 9). A dose dependencewith picogram per milliliter concentrations of exogenous IL-1βdemonstrated that these low amounts stimulated the release ofIL-8 and IL-6 protein in human islet cultures (Fig. 5, F andG). Already 20 pg/ml of IL-1β significantly induced therelease of nanogram per milliliter concentrations of IL-8, andmaximal effects were observed at 200 pg/ml of IL-1β. Similarlylow doses of IL-1β also induced nanogram per milliliterconcentrations of rodent CXC-chemokine ligand 1 in INS-1E cells(data not shown).
In vivo expression of cytokines, in particular the tightly regulatedand transiently expressed IL-1β, is difficult to assess.In the present study, the gene expression profiles of β-cellscaptured by LCM of pancreas sections from patients with T2DMwere analyzed, and IL-1β expression was confirmed by real-timePCR. These samples contain β-cell selected tissue stronglydepleted of glucagon, somatostatin, acinar, and duct cells whencompared with isolated whole islets (24). We observed IL-1βmRNA expression in β-cells of six of 10 patients with T2DMand, at a much lower level, in three of nine controls. Becauseonly low amounts of material can be obtained by LCM, analysisof IL-1β protein was not possible.
In a recent study with whole islets isolated from patients withT2DM, no significant difference in IL-1β expression couldbe observed, compared with nondiabetic islets (9). These isletswere cultured at 5.5 mM glucose for 3–4 d before analysis,and IL-1β expression may have returned to lower levelsduring that time. Furthermore, the isolation stress and thehigh number of non-β-cells are additional confounding factors,particularly in T2DM islets displaying reduced numbers of β-cells,compared with controls.
The observed IL-1β expression pattern was very variablein individuals with T2DM. In the array screening, we observedno differences between control and T2DM samples for β-cellspecific genes as well as markers for macrophage and endothelialcells. It is thus unlikely that the variability of IL-1βexpression is due to a technical problem related to RNA isolationor variable contamination by non-β-cells. Furthermore,we found no correlation between IL-1β expression and age,BMI, cause of death, or cold ischemia time. We did, however,find significant correlation of IL-1β expression with glycemia,suggesting that variable blood glucose levels could contributeto the variable IL-1β expression levels. A further possiblecause for the variable IL-1β levels could be its mode ofexpression. In other cell types, IL-1β expression oscillatedand was amplified by autostimulation (30, 31, 32, 33). In keepingwith this, we indeed observed transient IL-1β expressionand autostimulation in islets in vitro. With such changing expressionlevels, constant measurements can hardly be expected when samplingis done at just one time point. Highly variable circulatingIL-1β concentrations were recently also reported in patientswith type 1 diabetes, whereas other cytokines did not show suchfluctuations (36). Furthermore, it is possible that only someof the patients with T2DM presented with an inflammatory phenotype.
We also analyzed the effects of elevated glucose on IL-1βmRNA expression in vitro using 12 different islet preparations.In contrast to the ex vivo samples obtained by LCM, normal untreatedislets always expressed IL-1β. However, basal expressionlevels were unusually variable in the different islet preparations,compared with other genes that did not show such a high variability.The most constant expression was observed with the macrophagemarker CD68. The variability was also not due to IL-1βinduction during the 6- to 7-d culture period because IL-1βlevels changed only by a factor of 2 within subjects, and thiscannot account for the up to 20-fold between-subject differenceobserved among different preparations. Variable basal IL-1βexpression could be the result of the stress of islet isolation.In previous studies various inflammatory cyto- and chemokinesincluding IL-1β were induced upon islet isolation (24,37, 38) and persisted 2–11 d after isolation. Also, differencesin the attachment of the islets on the extracellular matrix,which has been shown to induce IL-1β (23), or differencesin the genetic background of the donors may contribute to thevariability. Independent of the underlying cause, variable basalIL-1β could be the reason that we did not observe glucosestimulated IL-1β in all islet preparations. This notionis supported by the finding of a negative correlation betweenbasal IL-1β and glucose-stimulated IL-1β. Furthermore,in the presence of exogenously added IL-1β, glucose didnot further stimulate IL-1β mRNA. Taken together, thissuggests that elevated basal IL-1β levels blunt the effectsof glucose on IL-1β expression in some but not all isletpreparations.
A glucose dose response revealed that a concentration as lowas 11 mM glucose already significantly increased IL-1βmRNA expression. Elevated glucose concentrations also increasedIL-1β at the protein level and up-regulated inflammatoryfactor IL-8 mRNA and protein expression. IL-1Ra blocked glucose-inducedIL-1β and IL-8, indicating that the effect of glucose requiresIL-1 receptor activation via increased secretion of biologicallyactive IL-1β.
Islet IL-1β expression was partly mediated by NF-B, whichis a known activator of the IL-1β promoter (33).
A variety of different cell types present within islets canproduce IL-1β (8, 20, 21, 22, 23). Here we demonstrateautostimulation in FACS-purified β-cells. This findingtogether with IL-1β expression in samples obtained by LCMsupports the idea that human β-cells themselves can produceIL-1β. IL-1β expression was recently also demonstratedin sorted rat β-cells (23). This does not rule out thatadditional islet cells (e.g. macrophages) also produce IL-1βin inflamed islets of patients with T2DM (39).
The LCM data also revealed that IL-1β and IL-8 expressionwas correlated, and in vitro, we found that glucose inducedIL-8 mRNA and protein release by an IL-1-dependent mechanism.IL-1β concentrations measured in islet culture supernatantsare in the low picogram per milliliter range (8, 9), and weshow that these low concentrations were sufficient to stimulateIL-8 and IL-6, which were released in nanogram per milliliterconcentrations. IL-8 produced by cultured human islets is functionaland mediates chemoattraction of macrophages (40). The inductionof proinflammatory mediators together with IL-1β autostimulation,which may act in an auto- and/or paracrine way, implicates IL-1βin the mediation and amplification of intraislet inflammatoryprocesses. We hypothesize that glucose-induced intraislet IL-1βmay contribute to an inflammatory state in at least some patientswith T2DM.
Acknowledgments
We thank G. Sigfried-Kellenberger for excellent technical assistance.Some batches of human islets of Langerhans were provided bythe Cell Isolation and Transplantation Center at the Universityof Geneva School of Medicine, thanks to the ECIT Islets forResearch distribution program sponsored by the Juvenile DiabetesResearch Foundation. We thank P. Marchetti for providing uspancreas sections from T2D donors (supported by a European Foundationfor the Study of Diabetes/Pfizer Resource Grant).
Footnotes
The work of M.B.-S., J.A.E., and M.Y.D. was supported by grantsfrom the Swiss National Science Foundation, the Juvenile DiabetesResearch Foundation, the University Research Priority ProgramIntegrative Human Physiology at the University of Zürich,and a European Foundation for the Study of Diabetes/Merck Sharp& Dohme basic research grant. The work of G.C.W., L.M.,and J.T. was supported by grants from the National Institutesof Health (NCRR ICR U4Z RR 16606 and U19DK6125), the AmericanDiabetes Association, and the Diabetes Research and WellnessFoundation. P.A.H. was supported by Grant 7-2005-1158 from theJuvenile Diabetes Research Foundation.
Disclosure Summary: M.B.-S., J.T., G.P., L.M., J.A.E., J.K.-C.,F.P., P.A.H., G.C.W., and M.Y.D. have nothing to declare.
First Published Online July 29, 2008
Abbreviations: BMI, Body mass index; DMSO, dimethylsulfoxide;FACS, fluorescence-activated cell sorter; IL1-Ra, IL-1 receptorantagonist; LCM, laser capture microdissection; NF-B, nuclearfactor-B; PC, prohormone convertase; T2DM, type 2 diabetes.
Leahy JL, Cooper HE, Deal DA, Weir GC 1986 Chronic hyperglycemia is associated with impaired glucose influence on insulin secretion. A study in normal rats using chronic in vivo glucose infusions. J Clin Invest 77:908–915[Medline]
Donath MY, Gross DJ, Cerasi E, Kaiser N 1999 Hyperglycemia-induced β-cell apoptosis in pancreatic islets of Psammomys obesus during development of diabetes. Diabetes 48:738–744[Abstract]
Mandrup-Poulsen T 1996 The role of interleukin-1 in the pathogenesis of IDDM. Diabetologia 39:1005–1029[Medline]
Eizirik DL, Mandrup-Poulsen T 2001 A choice of death—the signal-transduction of immune-mediated β-cell apoptosis. Diabetologia 44:2115–2133[CrossRef][Medline]
Donath MY, Storling J, Maedler K, Mandrup-Poulsen T 2003 Inflammatory mediators and islet β-cell failure: a link between type 1 and type 2 diabetes. J Mol Med 81:455–470[CrossRef][Medline]
Donath MY, Ehses JA, Maedler K, Schumann DM, Ellingsgaard H, Eppler E, Reinecke M 2005 Mechanisms of β-cell death in type 2 diabetes. Diabetes 54(Suppl 2):S108–S113
Kolb H, Mandrup-Poulsen T 2005 An immune origin of type 2 diabetes? Diabetologia 48:1038–1050[CrossRef][Medline]
Maedler K, Sergeev P, Ris F, Oberholzer J, Joller-Jemelka HI, Spinas GA, Kaiser N, Halban PA, Donath MY 2002 Glucose-induced β-cell production of interleukin-1β contributes to glucotoxicity in human pancreatic islets. J Clin Invest 110:851–860[CrossRef][Medline]
Welsh N, Cnop M, Kharroubi I, Bugliani M, Lupi R, Marchetti P, Eizirik DL 2005 Is there a role for locally produced interleukin-1 in the deleterious effects of high glucose or the type 2 diabetes milieu to human pancreatic islets? Diabetes 54:3238–3244[Abstract/Free Full Text]
Jorns A, Rath KJ, Bock O, Lenzen S 2006 β Cell death in hyperglycaemic Psammomys obesus is not cytokine-mediated. Diabetologia 49:2704–2712[CrossRef][Medline]
Larsen CM, Faulenbach M, Vaag A, Volund A, Ehses JA, Seifert B, Mandrup-Poulsen T, Donath MY 2007 Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N Engl J Med 356:1517–1526[Abstract/Free Full Text]
Slack J, McMahan CJ, Waugh S, Schooley K, Spriggs MK, Sims JE, Dower SK 1993 Independent binding of interleukin-1 and interleukin-1β to type I and type II interleukin-1 receptors. J Biol Chem 268:2513–2524[Abstract/Free Full Text]
Orencole SF, Dinarello CA 1989 Characterization of a subclone (D10S) of the D10.G4.1 helper T-cell line which proliferates to attomolar concentrations of interleukin-1 in the absence of mitogens. Cytokine 1:14–22[CrossRef][Medline]
Dinarello CA 1996 Biologic basis for interleukin-1 in disease. Blood 87:2095–2147[Abstract/Free Full Text]
Martinon F, Tschopp J 2007 Inflammatory caspases and inflammasomes: master switches of inflammation. Cell Death Differ 14:10–22[CrossRef][Medline]
Arend WP, Malyak M, Smith Jr MF, Whisenand TD, Slack JL, Sims JE, Giri JG, Dower SK 1994 Binding of IL-1, IL-1β, and IL-1 receptor antagonist by soluble IL-1 receptors and levels of soluble IL-1 receptors in synovial fluids. J Immunol 153:4766–4774[Abstract]
Arend WP, Guthridge CJ 2000 Biological role of interleukin 1 receptor antagonist isoforms. Ann Rheum Dis 59(Suppl 1):i60–i64
Dinarello CA 2000 The role of the interleukin-1-receptor antagonist in blocking inflammation mediated by interleukin-1. N Engl J Med 343:732–734[Free Full Text]
Dinarello CA 1994 The interleukin-1 family: 10 years of discovery. FASEB J 8:1314–1325[Abstract]
Arnush M, Scarim AL, Heitmeier MR, Kelly CB, Corbett JA 1998 Potential role of resident islet macrophage activation in the initiation of autoimmune diabetes. J Immunol 160:2684–2691[Abstract/Free Full Text]
Heitmeier MR, Arnush M, Scarim AL, Corbett JA 2001 Pancreatic β-cell damage mediated by β-cell production of IL-1: a novel mechanism for virus-induced diabetes. J Biol Chem 276:11151–11158[Abstract/Free Full Text]
Matsuda T, Omori K, Vuong T, Pascual M, Valiente L, Ferreri K, Todorov I, Kuroda Y, Smith CV, Kandeel F, Mullen Y 2005 Inhibition of p38 pathway suppresses human islet production of pro-inflammatory cytokines and improves islet graft function. Am J Transplant 5:484–493[CrossRef][Medline]
Ribaux P, Ehses JA, Lin-Marq N, Carrozzino F, Boni-Schnetzler M, Hammar E, Irminger JC, Donath MY, Halban PA 2007 Induction of CXCL1 by extracellular matrix and autocrine enhancement by interleukin-1 in rat pancreatic β-cells. Endocrinology 148:5582–5590[Abstract/Free Full Text]
Marselli L, Thorne J, Ahn YB, Omer A, Sgroi DC, Libermann T, Otu HH, Sharma A, Bonner-Weir S, Weir GC 2008 Gene expression of purified β-cell tissue obtained from human pancreas with laser capture microdissection. J Clin Endocrinol Metab 93:1046–1053[Abstract/Free Full Text]
Emmert-Buck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang Z, Goldstein SR, Weiss RA, Liotta LA 1996 Laser capture microdissection. Science 274:998–1001[Abstract/Free Full Text]
Parnaud G, Bosco D, Berney T, Pattou F, Kerr-Conte J, Donath MY, Bruun C, Mandrup-Poulsen T, Billestrup N, Halban PA 2008 Proliferation of sorted human and rat β cells. Diabetologia 51:91–100[CrossRef][Medline]
Gmyr V, Belaich S, Muharram G, Lukowiak B, Vandewalle B, Pattou F, Kerr-Conte J 2004 Rapid purification of human ductal cells from human pancreatic fractions with surface antibody CA19–9. Biochem Biophys Res Commun 320:27–33[CrossRef][Medline]
Lukowiak B, Vandewalle B, Riachy R, Kerr-Conte J, Gmyr V, Belaich S, Lefebvre J, Pattou F 2001 Identification and purification of functional human β-cells by a new specific zinc-fluorescent probe. J Histochem Cytochem 49:519–528[Abstract/Free Full Text]
Schumann DM, Maedler K, Franklin I, Konrad D, Storling J, Boni-Schnetzler M, Gjinovci A, Kurrer MO, Gauthier BR, Bosco D, Andres A, Berney T, Greter M, Becher B, Chervonsky AV, Halban PA, Mandrup-Poulsen T, Wollheim CB, Donath MY 2007 The Fas pathway is involved in pancreatic β cell secretory function. Proc Natl Acad Sci USA 104:2861–2866[Abstract/Free Full Text]
Dinarello CA, Ikejima T, Warner SJ, Orencole SF, Lonnemann G, Cannon JG, Libby P 1987 Interleukin 1 induces interleukin 1. I. Induction of circulating interleukin 1 in rabbits in vivo and in human mononuclear cells in vitro. J Immunol 139:1902–1910[Abstract]
Libby P, Ordovas JM, Birinyi LK, Auger KR, Dinarello CA 1986 Inducible interleukin-1 gene expression in human vascular smooth muscle cells. J Clin Invest 78:1432–1438[Medline]
Warner SJ, Auger KR, Libby P 1987 Human interleukin 1 induces interleukin 1 gene expression in human vascular smooth muscle cells. J Exp Med 165:1316–1331[Abstract/Free Full Text]
Toda Y, Tsukada J, Misago M, Kominato Y, Auron PE, Tanaka Y 2002 Autocrine induction of the human pro-IL-1β gene promoter by IL-1β in monocytes. J Immunol 168:1984–1991[Abstract/Free Full Text]
Arend WP, Malyak M, Guthridge CJ, Gabay C 1998 Interleukin-1 receptor antagonist: role in biology. Annu Rev Immunol 16:27–55[CrossRef][Medline]
Pfleger C, Mortensen HB, Hansen L, Herder C, Roep BO, Hoey H, Aanstoot HJ, Kocova M, Schloot NC 2008 Association of IL-1ra and adiponectin with C-peptide and remission in patients with type 1 diabetes. Diabetes 57:929–937[Abstract/Free Full Text]
Johansson U, Olsson A, Gabrielsson S, Nilsson B, Korsgren O 2003 Inflammatory mediators expressed in human islets of Langerhans: implications for islet transplantation. Biochem Biophys Res Commun 308:474–479[CrossRef][Medline]
Bottino R, Balamurugan AN, Tse H, Thirunavukkarasu C, Ge X, Profozich J, Milton M, Ziegenfuss A, Trucco M, Piganelli JD 2004 Response of human islets to isolation stress and the effect of antioxidant treatment. Diabetes 53:2559–2568[Abstract/Free Full Text]
Weksler-Zangen S, Raz I, Lenzen S, Jorns A, Ehrenfeld S, Amir G, Oprescu A, Yagil Y, Yagil C, Zangen DH, Kaiser N 2008 Impaired glucose-stimulated insulin secretion is coupled with exocrine pancreatic lesions in the Cohen diabetic rat. Diabetes 57:279–287[Abstract/Free Full Text]
Ehses JA, Perren A, Eppler E, Ribaux P, Pospisilik JA, Maor-Cahn R, Gueripel X, Ellingsgaard H, Schneider MK, Biollaz G, Fontana A, Reinecke M, Homo-Delarche F, Donath MY 2007 Increased number of islet-associated macrophages in type 2 diabetes. Diabetes 56:2356–2370[Abstract/Free Full Text]
This article has been cited by other articles:
A. M. Owyang, K. Maedler, L. Gross, J. Yin, L. Esposito, L. Shu, J. Jadhav, E. Domsgen, J. Bergemann, S. Lee, et al. XOMA 052, an Anti-IL-1{beta} Monoclonal Antibody, Improves Glucose Control and {beta}-Cell Function in the Diet-Induced Obesity Mouse Model
Endocrinology,
June 1, 2010;
151(6):
2515 - 2527.
[Abstract][Full Text][PDF]
M. Carstensen, C. Herder, M. Kivimaki, M. Jokela, M. Roden, M. J. Shipley, D. R. Witte, E. J. Brunner, and A. G. Tabak Accelerated Increase in Serum Interleukin-1 Receptor Antagonist Starts 6 Years Before Diagnosis of Type 2 Diabetes: Whitehall II Prospective Cohort Study
Diabetes,
May 1, 2010;
59(5):
1222 - 1227.
[Abstract][Full Text][PDF]
K. Schroder, R. Zhou, and J. Tschopp The NLRP3 Inflammasome: A Sensor for Metabolic Danger?
Science,
January 15, 2010;
327(5963):
296 - 300.
[Abstract][Full Text][PDF]
M. Y. Donath, M. Boni-Schnetzler, H. Ellingsgaard, and J. A. Ehses Islet Inflammation Impairs the Pancreatic {beta}-Cell in Type 2 Diabetes
Physiology,
December 1, 2009;
24(6):
325 - 331.
[Abstract][Full Text][PDF]
M. Boni-Schnetzler, S. Boller, S. Debray, K. Bouzakri, D. T. Meier, R. Prazak, J. Kerr-Conte, F. Pattou, J. A. Ehses, F. C. Schuit, et al. Free Fatty Acids Induce a Proinflammatory Response in Islets via the Abundantly Expressed Interleukin-1 Receptor I
Endocrinology,
December 1, 2009;
150(12):
5218 - 5229.
[Abstract][Full Text][PDF]
C. M. Larsen, M. Faulenbach, A. Vaag, J. A. Ehses, M. Y. Donath, and T. Mandrup-Poulsen Sustained Effects of Interleukin-1 Receptor Antagonist Treatment in Type 2 Diabetes
Diabetes Care,
September 1, 2009;
32(9):
1663 - 1668.
[Abstract][Full Text][PDF]
J. A. Ehses, G. Lacraz, M.-H. Giroix, F. Schmidlin, J. Coulaud, N. Kassis, J.-C. Irminger, M. Kergoat, B. Portha, F. Homo-Delarche, et al. IL-1 antagonism reduces hyperglycemia and tissue inflammation in the type 2 diabetic GK rat
PNAS,
August 18, 2009;
106(33):
13998 - 14003.
[Abstract][Full Text][PDF]
G. Parnaud, E. Hammar, P. Ribaux, M. Y. Donath, T. Berney, and P. A. Halban Signaling Pathways Implicated in the Stimulation of {beta}-Cell Proliferation by Extracellular Matrix
Mol. Endocrinol.,
August 1, 2009;
23(8):
1264 - 1271.
[Abstract][Full Text][PDF]