| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
BRIEF REPORT |
Institute of Human Genetics (A.S., J.D., C.J.O., H.J.C., S.H.S.P.) and School of Clinical Medical Sciences (C.J.O., C.W., T.D.C., R.A.J., P.P., P.T.D., R.Q., S.H.S.P.), Newcastle University; and Endocrine Unit, Royal Victoria Infirmary (S.V., T.D.C., R.A.J., R.Q., S.H.S.P.), and Freeman Hospital (P.P.), Newcastle upon Tyne NE1 3BZ, United Kingdom
Address all correspondence and requests for reprints to: Dr. Simon Pearce, Institute of Human Genetics, Newcastle University, International Centre for Life, Central Parkway, Newcastle upon Tyne NE1 3BZ, United Kingdom E-mail: s.h.s.pearce{at}ncl.ac.uk.
| Abstract |
|---|
|
|
|---|
Objective: We sought to replicate these genetic associations in Graves disease and autoimmune Addisons disease patient cohorts.
Patients and Methods: A total of 602 Graves disease subjects, 214 Addisons disease subjects, and 446 healthy controls were genotyped for the IFIH1 and PDCD1 single-nucleotide polymorphisms using mass spectrometer analysis of primer extension products (Sequenom).
Results: The alanine-carrying allele at the IFIH1 codon 946 polymorphism was present in 796 of 1204 (66%) Graves disease patient alleles compared with 508 of 892 (57%) control subject alleles [odds ratio 1.47 (5–95% confidence interval, 1.23–1.76); P = 1.9 x 10–5]. In contrast, there was no association of alleles at this marker in autoimmune Addisons disease. Neither was there evidence for association in either patient cohort at the PD1.3 polymorphism.
Conclusions: We confirm a significant contribution of the Ala946Thr IFIH1 polymorphism to organ-specific autoimmune diseases, extending the range of conditions associated with this variant to include Graves disease. This polymorphism may also contribute to several other autoimmune disorders.
| Introduction |
|---|
|
|
|---|
Recently, using preliminary results from large-scale association analysis of nonsynonymous single-nucleotide polymorphisms (SNPs), a novel locus for T1D was identified, the interferon-induced helicase (IFIH1), also known as the melanoma differentiation-associated 5 (MDA-5), or Helicard, gene (9). The IFIH1 gene encodes a viral RNA-activated apoptosis protein, with a putative role in sensing and triggering clearance responses in virally infected cells (10, 11). Using a logistic regression analysis, the most associated marker in IFIH1 was defined as the SNP rs1990760, which encodes an alanine to threonine amino acid change at codon 946, with an odds ratio for association with T1D of 1.16 (5–95% confidence interval, 1.11–1.22) for the major allele (9). Another molecule with a role in cellular apoptosis pathways that has been demonstrated to have a role in autoimmunity is the cell-surface programmed cell death 1 receptor, encoded by the PDCD1 gene. Several large studies have shown association of polymorphisms in PDCD1 with systemic lupus erythematosus and rheumatoid arthritis (12, 13, 14). The most associated variant (designated PD1.3 or rs11568821) lies within intron 4 of the gene and has been demonstrated to alter a RUNX1 transcription factor binding site rendering RUNX1 unable to bind to the PDCD1 sequences (12). Both the IFIH1 and PDCD1 genes encode transcripts that have widespread expression in lymphoid and other tissues, suggesting that they could have a role in many autoimmune conditions. In this study, we have examined the IFIH1 Ala946Thr, and the PD1.3 SNPs in cohorts of Caucasians with GD and AAD to determine whether genomic polymorphism at these apoptosis-related loci may have a wider role in autoimmune endocrinopathy.
| Subjects and Methods |
|---|
|
|
|---|
The GD (n = 602) probands were recruited through endocrine- and thyroid-associated ophthalmopathy clinics in Newcastle and the surrounding district hospitals. Of the AAD probands, 105 were recruited from endocrine clinics in the northeast of England, with an additional 109 recruited via meetings of the United Kingdom Addisons disease self-help group (ADSHG). The diagnostic criteria for GD were biochemical hyperthyroidism with confirmation by serum autoantibodies, radionuclide scan, or presence of ophthalmopathy (15). Of the GD probands, 78% were female, 40% had significant thyroid-associated ophthalmopathy (defined as NOSPECS class 3 or worse), and 55% were cigarette smokers. The northeast AAD patients had a serum cortisol of less than 550nmol/liter after ACTH stimulation, with a raised basal plasma ACTH level or pigmentation. Patients with tuberculosis, those with another known non-autoimmune cause, and those with autoimmune hypoparathyroidism or candidiasis (subjects with type 1 polyendocrinopathy) were excluded from the cohort (16). AAD subjects recruited from ADSHG were all interviewed by C.W. or S.H.S.P. A self-reported diagnosis of AAD in subjects with an appropriate medical history who were currently taking hydrocortisone and fludrocortisone was taken as evidence of AAD. The median age of onset, male to female ratio, and prevalence of other autoimmune conditions was not different between AAD subjects recruited from our hospital services and from ADSHG. The AAD cohort included 161 females (75.2%) and 53 males (24.8%). Isolated AAD accounted for 36% of the AAD cohort, the other 64% had at least one other associated autoimmune disease (80 hypothyroidism, 25 GD, 24 primary gonadal failure, 12 T1D, 14 pernicious anemia, six vitiligo, six celiac disease, four rheumatoid arthritis, three alopecia, two hemolytic anemia, and one autoimmune hepatitis). United Kingdom controls (n = 446; 66.3% females, 33.7% males) also recruited from the local population had no clinical features or family history of autoimmune disease.
SNP genotyping
Both the rs1990760 SNP in IFIH1 and the rs11568821 (PD1.3) SNP were genotyped using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of primer extension products (Sequenom iPlex System, Hamburg, Germany). Amplification primers, including tag sequences were as follows: rs1990760, ACGTTGGATGCTCCATGATGATTCTTTCCC and ACGTTGGATGTTTGATAGTCGGCACACTTC; rs11568821, ACGTTGGATGA GGCAGGCACACACATGGG and ACGTTGGATGCAACCTCAATCCCTAAAGCC. Extension primers were as follows: rs1990760, TTTACATTGTAAGAGAAAACAAA, and rs11568821, CATTGGCCGGGCACCCCCGGAGAC. All reactions were carried out in a final volume of 5 µl according to manufacturers conditions. Typing of 10% of the samples was repeated blind to confirm assay fidelity.
Statistical analysis
The case-control association studies were analyzed using
2 tests on 2 x 2 and 2 x 3 contingency tables for allele and genotype frequencies, respectively. Odds ratios and confidence intervals were calculated using Woolfs method. Heterogeneity between the odds ratios in our study and those from the published analysis of T1D (9) was examined using an interaction term in a logistic regression analysis. No significant deviation from Hardy Weinberg equilibrium was observed for either of the SNPs in this study (all P > 0.05). We estimated that the power of our GD study was more than 90%, assuming an allelic odds ratio of 1.3 and an allele frequency of 0.40, as previously determined in United Kingdom controls at rs1990760 (
= 0.05) (9). Assuming an OR of 1.16 (as previously found in T1D), we estimate that more than 900 probands and matched controls would be needed to give 80% power (
= 0.05).
| Results |
|---|
|
|
|---|
|
|
| Discussion |
|---|
|
|
|---|
Second, IFIH1 is thought to have a role in protecting the host from viral infection by sensing viral nucleic acid in the cytoplasm and triggering a cellular antiviral and apoptotic response (10, 11). Because Coxsackie and other enteroviral infections are epidemiologically linked to T1D incidence (17), it was suggested that IFIH1 polymorphism could form a molecular link between the specific viral trigger and the autoimmune response in T1D (9). The finding of strong association of IFIH1 alleles with GD, a condition with no established link to viral infection, suggests that IFIH1 might have an endogenous immunoregulatory effect, unrelated to any specific role as a viral receptor.
Last, the association of IFIH1 alleles with GD in our population appears to be stronger than that with T1D, with an odds ratio for association of 1.47, in contrast to 1.16 found with T1D. Although some of the variation in odds ratios may be stochastic, in particular relating to the slightly lower prevalence of the disease-associated alanine-carrying IFIH1 allele in our local healthy control population compared with the United Kingdom-wide controls used in the diabetes study (57.0 vs. 59.6%), there may be a genuinely stronger effect of IFIH1 in autoimmune thyroid diseases than in T1D, as has already been observed for alleles at the CTLA4 locus (18, 19). Our analysis suggests that there is genuine heterogeneity in the strength of association at IFIH1 found in our GD cohort and in the T1D cohorts (an interaction term in a logistic regression was highly significant, P = 10–16). Conversely, our study does not have the power to exclude a small effect of IFIH1 in AAD pathogenesis. If the strength of effect in AAD is of the same order as that found in T1D (odds ratio, 1.16), more than 900 AAD probands and matched controls would be needed to show association. AAD is a relatively rare autoimmune endocrinopathy, with a prevalence about one in 9000 in the United Kingdom (20), and sample cohorts of such a size currently do not exist. Collection and testing of such a larger Addisons patient cohort would be a valuable future goal.
In summary, this study confirms IFIH1 as a novel autoimmunity locus, extending its known role in T1D to include a substantial role in Graves disease susceptibility. We can find no evidence to support an effect at the PDCD1 locus on susceptibility to either GD or AAD, underlining the differences in pathogenesis between these organ-specific autoimmune disorders and the non-organ-specific disorders, where PDCD1 polymorphism has been shown to have a role.
| Acknowledgments |
|---|
| Footnotes |
|---|
Authors Disclosure: None of the authors have any conflict of interest to declare.
First Published Online May 29, 2007
Abbreviations: AAD, Autoimmune Addisons disease; ADSHG, Addisons disease self-help group; GD, Graves disease; SNP, single-nucleotide polymorphism; T1D, type 1 diabetes.
Received January 24, 2007.
Accepted May 22, 2007.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Liu, H. Wang, Y. Jin, R. Podolsky, M. P. L. Reddy, J. Pedersen, B. Bode, J. Reed, D. Steed, S. Anderson, et al. IFIH1 polymorphisms are significantly associated with type 1 diabetes and IFIH1 gene expression in peripheral blood mononuclear cells Hum. Mol. Genet., January 15, 2009; 18(2): 358 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Huber, F. Menconi, S. Corathers, E. M. Jacobson, and Y. Tomer Joint Genetic Susceptibility to Type 1 Diabetes and Autoimmune Thyroiditis: from Epidemiology to Mechanisms Endocr. Rev., October 1, 2008; 29(6): 697 - 725. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |