help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism, doi:10.1210/jc.2007-0173
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
92/8/3338    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sutherland, A.
Right arrow Articles by Pearce, S. H. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sutherland, A.
Right arrow Articles by Pearce, S. H. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*SNP*UniGene
Related Collections
Right arrow Autoimmunity
Right arrow Thyroid
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 8 3338-3341
Copyright © 2007 by The Endocrine Society


BRIEF REPORT

Genomic Polymorphism at the Interferon-Induced Helicase (IFIH1) Locus Contributes to Graves’ Disease Susceptibility

Alison Sutherland, Jocelyn Davies, Catherine J. Owen, Suresh Vaikkakara, Christine Walker, Timothy D. Cheetham, R. Andrew James, Petros Perros, Peter T. Donaldson, Heather J. Cordell, Richard Quinton and Simon H. S. Pearce

Institute of Human Genetics (A.S., J.D., C.J.O., H.J.C., S.H.S.P.) and School of Clinical Medical Sciences (C.J.O., C.W., T.D.C., R.A.J., P.P., P.T.D., R.Q., S.H.S.P.), Newcastle University; and Endocrine Unit, Royal Victoria Infirmary (S.V., T.D.C., R.A.J., R.Q., S.H.S.P.), and Freeman Hospital (P.P.), Newcastle upon Tyne NE1 3BZ, United Kingdom

Address all correspondence and requests for reprints to: Dr. Simon Pearce, Institute of Human Genetics, Newcastle University, International Centre for Life, Central Parkway, Newcastle upon Tyne NE1 3BZ, United Kingdom E-mail: s.h.s.pearce{at}ncl.ac.uk.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: A recent large-scale analysis of nonsynonymous coding polymorphisms showed strong evidence that an alanine to threonine amino acid change at codon 946 of the interferon-induced helicase (IFIH1) gene (SNP ID rs1990760) was associated with type 1 diabetes. Previous investigations have also demonstrated that an intronic polymorphism (termed PD1.3; SNP ID rs11568821) in the programmed cell death (PDCD1) gene was associated with systemic lupus erythematosus and rheumatoid arthritis.

Objective: We sought to replicate these genetic associations in Graves’ disease and autoimmune Addison’s disease patient cohorts.

Patients and Methods: A total of 602 Graves’ disease subjects, 214 Addison’s disease subjects, and 446 healthy controls were genotyped for the IFIH1 and PDCD1 single-nucleotide polymorphisms using mass spectrometer analysis of primer extension products (Sequenom).

Results: The alanine-carrying allele at the IFIH1 codon 946 polymorphism was present in 796 of 1204 (66%) Graves’ disease patient alleles compared with 508 of 892 (57%) control subject alleles [odds ratio 1.47 (5–95% confidence interval, 1.23–1.76); P = 1.9 x 10–5]. In contrast, there was no association of alleles at this marker in autoimmune Addison’s disease. Neither was there evidence for association in either patient cohort at the PD1.3 polymorphism.

Conclusions: We confirm a significant contribution of the Ala946Thr IFIH1 polymorphism to organ-specific autoimmune diseases, extending the range of conditions associated with this variant to include Graves’ disease. This polymorphism may also contribute to several other autoimmune disorders.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
THERE IS A SUBSTANTIAL contribution of genetic factors to the pathogenesis of autoimmune endocrine disorders (1, 2), with one twin study suggesting that more than three quarters of the predisposition to Graves’ disease (GD, autoimmune hyperthyroidism) is determined by heredity (3). Genomic loci that make a significant and consistent contribution to autoimmune thyroid disease susceptibility include the major histocompatibility complex, the cytotoxic T lymphocyte antigen-4 locus, and an allele at the protein tyrosine phosphatase nonreceptor 22 gene (encoding the lymphoid tyrosine phosphatase 620W variant) (1, 2, 4, 5). These alleles have also been shown, in varying degrees, to have a role in type 1 diabetes (T1D), autoimmune Addison’s disease (AAD), rheumatoid arthritis, and several other autoimmune conditions, demonstrating that several loci may be considered as common autoimmunity loci (1, 2, 5), presumably with a general predisposing effect to skew the immune response toward autoreactivity. These loci stand in contrast to disease-specific loci, which tend to have a tissue-specific expression pattern, such as the insulin gene variable number tandem repeat (VNTR) polymorphism in T1D and the TSH receptor in GD (6, 7, 8).

Recently, using preliminary results from large-scale association analysis of nonsynonymous single-nucleotide polymorphisms (SNPs), a novel locus for T1D was identified, the interferon-induced helicase (IFIH1), also known as the melanoma differentiation-associated 5 (MDA-5), or Helicard, gene (9). The IFIH1 gene encodes a viral RNA-activated apoptosis protein, with a putative role in sensing and triggering clearance responses in virally infected cells (10, 11). Using a logistic regression analysis, the most associated marker in IFIH1 was defined as the SNP rs1990760, which encodes an alanine to threonine amino acid change at codon 946, with an odds ratio for association with T1D of 1.16 (5–95% confidence interval, 1.11–1.22) for the major allele (9). Another molecule with a role in cellular apoptosis pathways that has been demonstrated to have a role in autoimmunity is the cell-surface programmed cell death 1 receptor, encoded by the PDCD1 gene. Several large studies have shown association of polymorphisms in PDCD1 with systemic lupus erythematosus and rheumatoid arthritis (12, 13, 14). The most associated variant (designated PD1.3 or rs11568821) lies within intron 4 of the gene and has been demonstrated to alter a RUNX1 transcription factor binding site rendering RUNX1 unable to bind to the PDCD1 sequences (12). Both the IFIH1 and PDCD1 genes encode transcripts that have widespread expression in lymphoid and other tissues, suggesting that they could have a role in many autoimmune conditions. In this study, we have examined the IFIH1 Ala946Thr, and the PD1.3 SNPs in cohorts of Caucasians with GD and AAD to determine whether genomic polymorphism at these apoptosis-related loci may have a wider role in autoimmune endocrinopathy.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

The GD (n = 602) probands were recruited through endocrine- and thyroid-associated ophthalmopathy clinics in Newcastle and the surrounding district hospitals. Of the AAD probands, 105 were recruited from endocrine clinics in the northeast of England, with an additional 109 recruited via meetings of the United Kingdom Addison’s disease self-help group (ADSHG). The diagnostic criteria for GD were biochemical hyperthyroidism with confirmation by serum autoantibodies, radionuclide scan, or presence of ophthalmopathy (15). Of the GD probands, 78% were female, 40% had significant thyroid-associated ophthalmopathy (defined as NOSPECS class 3 or worse), and 55% were cigarette smokers. The northeast AAD patients had a serum cortisol of less than 550nmol/liter after ACTH stimulation, with a raised basal plasma ACTH level or pigmentation. Patients with tuberculosis, those with another known non-autoimmune cause, and those with autoimmune hypoparathyroidism or candidiasis (subjects with type 1 polyendocrinopathy) were excluded from the cohort (16). AAD subjects recruited from ADSHG were all interviewed by C.W. or S.H.S.P. A self-reported diagnosis of AAD in subjects with an appropriate medical history who were currently taking hydrocortisone and fludrocortisone was taken as evidence of AAD. The median age of onset, male to female ratio, and prevalence of other autoimmune conditions was not different between AAD subjects recruited from our hospital services and from ADSHG. The AAD cohort included 161 females (75.2%) and 53 males (24.8%). Isolated AAD accounted for 36% of the AAD cohort, the other 64% had at least one other associated autoimmune disease (80 hypothyroidism, 25 GD, 24 primary gonadal failure, 12 T1D, 14 pernicious anemia, six vitiligo, six celiac disease, four rheumatoid arthritis, three alopecia, two hemolytic anemia, and one autoimmune hepatitis). United Kingdom controls (n = 446; 66.3% females, 33.7% males) also recruited from the local population had no clinical features or family history of autoimmune disease.

SNP genotyping

Both the rs1990760 SNP in IFIH1 and the rs11568821 (PD1.3) SNP were genotyped using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of primer extension products (Sequenom iPlex System, Hamburg, Germany). Amplification primers, including tag sequences were as follows: rs1990760, ACGTTGGATGCTCCATGATGATTCTTTCCC and ACGTTGGATGTTTGATAGTCGGCACACTTC; rs11568821, ACGTTGGATGA GGCAGGCACACACATGGG and ACGTTGGATGCAACCTCAATCCCTAAAGCC. Extension primers were as follows: rs1990760, TTTACATTGTAAGAGAAAACAAA, and rs11568821, CATTGGCCGGGCACCCCCGGAGAC. All reactions were carried out in a final volume of 5 µl according to manufacturer’s conditions. Typing of 10% of the samples was repeated blind to confirm assay fidelity.

Statistical analysis

The case-control association studies were analyzed using {chi}2 tests on 2 x 2 and 2 x 3 contingency tables for allele and genotype frequencies, respectively. Odds ratios and confidence intervals were calculated using Woolf’s method. Heterogeneity between the odds ratios in our study and those from the published analysis of T1D (9) was examined using an interaction term in a logistic regression analysis. No significant deviation from Hardy Weinberg equilibrium was observed for either of the SNPs in this study (all P > 0.05). We estimated that the power of our GD study was more than 90%, assuming an allelic odds ratio of 1.3 and an allele frequency of 0.40, as previously determined in United Kingdom controls at rs1990760 ({alpha} = 0.05) (9). Assuming an OR of 1.16 (as previously found in T1D), we estimate that more than 900 probands and matched controls would be needed to give 80% power ({alpha} = 0.05).


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Both alleles and genotypes of the IFIH1 Ala946Thr (rs1990670) SNP were significantly associated with GD, with the Ala-carrying allele being present in 796 of 1204 (66%) GD patient alleles compared with 508 of 892 (57%) control subject alleles [odds ratio, 1.47 (5–95% confidence interval, 1.23–1.76); P = 1.9 x 10–5]. In contrast, no association with alleles of the same marker was found in AAD. Full genotype and allele frequencies for the rs1990670 IFIH1 marker are shown in Table 1Go.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Genotype and allele frequencies for rs1990760 in GD, Addison’s disease, and healthy controls

 
In contrast, there was no association found in either the GD or AAD patient cohorts when compared with healthy controls at the PD1.3 SNP (rs11568821). The minor allele frequency being 11.6% in the healthy control subjects, compared with 10.3% in the GD patients and 15.2% in the AAD cohort (full genotype and allele data are shown in Table 2Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Genotype and allele frequencies for rs11568821 in GD, Addison’s disease, and healthy controls

 
Heterogeneity testing according to the presence or absence of thyroid-associated ophthalmopathy in the GD patients showed no significant difference in genotypes between the two groups for either marker (data not shown). Similarly, when comparing patients with isolated AAD with type 2 polyendocrinopathy, there were no significant differences in genotype frequencies at either locus (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The first, exciting findings from a large-scale candidate variant study involving more than 6500 nonsynonymous SNPs in large cohorts of patients with T1D revealed the IFIH1 gene as a novel locus (9). In our current study, we confirm that the alanine-carrying allele at IFIH1 is also substantially associated with GD (P = 1.9 x 10–5). This result is important for several reasons. First, more than any previous form of genetic linkage or association analysis, genome-wide association studies test out numerous markers, and there is a possibility of generating highly significant false-positive results on account of the multiple hypotheses implicit in such a study. In the work of Smyth et al. (9), the positive association at IFIH1 was found in 1924 subjects with T1D and replicated both in a second cohort of 2329 T1D probands and in 2134 trio families affected with T1D. Although this initial analysis was robust by any standard, it is nevertheless still strongly reassuring to find that the association of autoimmune disease with IFIH1 alleles has now been independently extended to include another autoimmune disorder, GD.

Second, IFIH1 is thought to have a role in protecting the host from viral infection by sensing viral nucleic acid in the cytoplasm and triggering a cellular antiviral and apoptotic response (10, 11). Because Coxsackie and other enteroviral infections are epidemiologically linked to T1D incidence (17), it was suggested that IFIH1 polymorphism could form a molecular link between the specific viral trigger and the autoimmune response in T1D (9). The finding of strong association of IFIH1 alleles with GD, a condition with no established link to viral infection, suggests that IFIH1 might have an endogenous immunoregulatory effect, unrelated to any specific role as a viral receptor.

Last, the association of IFIH1 alleles with GD in our population appears to be stronger than that with T1D, with an odds ratio for association of 1.47, in contrast to 1.16 found with T1D. Although some of the variation in odds ratios may be stochastic, in particular relating to the slightly lower prevalence of the disease-associated alanine-carrying IFIH1 allele in our local healthy control population compared with the United Kingdom-wide controls used in the diabetes study (57.0 vs. 59.6%), there may be a genuinely stronger effect of IFIH1 in autoimmune thyroid diseases than in T1D, as has already been observed for alleles at the CTLA4 locus (18, 19). Our analysis suggests that there is genuine heterogeneity in the strength of association at IFIH1 found in our GD cohort and in the T1D cohorts (an interaction term in a logistic regression was highly significant, P = 10–16). Conversely, our study does not have the power to exclude a small effect of IFIH1 in AAD pathogenesis. If the strength of effect in AAD is of the same order as that found in T1D (odds ratio, 1.16), more than 900 AAD probands and matched controls would be needed to show association. AAD is a relatively rare autoimmune endocrinopathy, with a prevalence about one in 9000 in the United Kingdom (20), and sample cohorts of such a size currently do not exist. Collection and testing of such a larger Addison’s patient cohort would be a valuable future goal.

In summary, this study confirms IFIH1 as a novel autoimmunity locus, extending its known role in T1D to include a substantial role in Graves’ disease susceptibility. We can find no evidence to support an effect at the PDCD1 locus on susceptibility to either GD or AAD, underlining the differences in pathogenesis between these organ-specific autoimmune disorders and the non-organ-specific disorders, where PDCD1 polymorphism has been shown to have a role.


    Acknowledgments
 
We are grateful to the ADSHG and to all the patients and control subjects for donating blood samples.


    Footnotes
 
This work was supported by The Wellcome Trust. C.J.O. was a Medical Research Council Training Fellow.

Authors’ Disclosure: None of the authors have any conflict of interest to declare.

First Published Online May 29, 2007

Abbreviations: AAD, Autoimmune Addison’s disease; ADSHG, Addison’s disease self-help group; GD, Graves’ disease; SNP, single-nucleotide polymorphism; T1D, type 1 diabetes.

Received January 24, 2007.

Accepted May 22, 2007.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Pearce SH, Merriman TR 2006 Genetic progress towards the molecular basis of autoimmunity. Trends Mol Med 12:90–98[CrossRef][Medline]
  2. Tomer Y, Davies TF 2003 Searching for the autoimmune thyroid disease susceptibility genes: from gene mapping to gene function. Endocr Rev 24:694–717[Abstract/Free Full Text]
  3. Brix TH, Kyvik KO, Christensen K, Hegedus L 2001 Evidence for a major role of heredity in Graves’ disease: a population-based study of two Danish twin cohorts. J Clin Endocrinol Metab 86:930–934[Abstract/Free Full Text]
  4. Velaga MR, Wilson V, Jennings CE, Owen CJ, Herington S, Donaldson PT, Ball SG, James RA, Quinton R, Perros P, Pearce SHS 2004 The codon 620 tryptophan allele of the lymphoid tyrosine phosphatase (LYP) gene is a major determinant of Graves’ disease. J Clin Endocrinol Metab 89:5862–5865[Abstract/Free Full Text]
  5. Smyth D, Cooper JD, Collins JE, Heward JM, Franklyn JA, Howson JM, Vella A, Nutland S, Rance HE, Maier L, Barratt BJ, Guja C, Ionescu-Tirgoviste C, Savage DA, Dunger DB, Widmer B, Strachan DP, Ring SM, Walker N, Clayton DG, Twells RC, Gough SC, Todd JA 2004 Replication of an association between the lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus. Diabetes 53:3020–3023[Abstract/Free Full Text]
  6. Bennett ST, Todd JA 1996 Human type 1 diabetes and the insulin gene: principles of mapping polygenes. Ann Rev Genet 30:343–370[CrossRef][Medline]
  7. Hiratani H, Bowden DW, Ikegami S, Shirasawa S, Shimizu A, Iwatani Y, Akamizu T 2005 Multiple SNPs in intron 7 of thyrotropin receptor are associated with Graves’ disease. J Clin Endocrinol Metab 90:2898–2903[Abstract/Free Full Text]
  8. Dechairo B, Zabaneh D, Collins J, Brand O, Dawson GJ, Green AP, Mackay I, Franklyn JA, Connell JM, Wass JA, Wiersinga WM, Hegedus L, Brix T, Robinson BG, Hunt PJ, Weetman AP, Carey AH, Gough SC 2005 Association of the TSHR gene with Graves’ disease: the first disease specific locus. Eur J Hum Genet 13:1223–1230[CrossRef][Medline]
  9. Smyth DJ, Cooper JD, Bailey R, Field S, Burren O, Smink LJ, Guja C, Ionescu-Tirgoviste C, Widmer B, Dunger DB, Savage DA, Walker NM, Clayton DG, Todd JA 2006 A genome-wide association study of nonsynonymous SNPs identifies a type 1 diabetes locus in the interferon-induced helicase (IFIH1) region. Nat Genet 38:617–619[CrossRef][Medline]
  10. Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K, Foy E, Loo YM, Gale Jr M, Akira S, Yonehara S, Kato A, Fujita T 2005 Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175:2851–2858[Abstract/Free Full Text]
  11. Meylan E, Tschopp J, Karin M 2006 Intracellular pattern recognition receptors in the host response. Nature 442:39–44[CrossRef][Medline]
  12. Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg L, Magnusson V, Brookes AJ, Tentler D, Kristjansdottir H, Grondal G, Bolstad AI, Svenungsson E, Lundberg I, Sturfelt G, Jonssen A, Truedsson L, Lima G, Alcocer-Varela J, Jonsson R, Gyllensten UB, Harley JB, Alarcon-Segovia D, Steinsson K, Alarcon-Riquelme ME 2002 A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet 32:666–669[CrossRef][Medline]
  13. Ferreiros-Vidal I, Gomez-Reino JJ, Barros F, Carracedo A, Carreira P, Gonzalez-Escribano F, Liz M, Martin J, Ordi J, Vicario JL, Gonzalez A 2004 Association of PDCD1 with susceptibility to systemic lupus erythematosus: evidence of population-specific effects. Arthritis Rheum 50:2590–2597[CrossRef][Medline]
  14. Prokunina L, Padyukov L, Bennet A, de Faire U, Wiman B, Prince J, Alfredsson L, Klareskog L, Alarcon-Riquelme M 2004 Association of the PD-1.3A allele of the PDCD1 gene in patients with rheumatoid arthritis negative for rheumatoid factor and the shared epitope. Arthritis Rheum 50:1770–1773[CrossRef][Medline]
  15. Owen CJ, Kelly H, Eden JA, Merriman ME, Pearce SH, Merriman TR 2007 Analysis of the Fc-receptor like-3 (FCRL3) locus in Caucasians with autoimmune disorders suggests a complex pattern of disease association. J Clin Endocrinol Metab 92:1106–1111[Abstract/Free Full Text]
  16. Pearce SHS, Cheetham TD, Imrie H, Vaidya B, Barnes ND, Bilous RW, Carr D, Meeran K, Shaw NJ, Smith CS, Toft AD, Williams G, Kendall-Taylor P 1998 A common and recurrent 13-bp deletion in the autoimmune regulator gene in British kindreds with autoimmune polyendocrinopathy type 1. Am J Hum Genet 63:1675–1684[CrossRef][Medline]
  17. Lonnrot M, Korpela K, Knip M, Ilonen J, Simell O, Korhonen S, Savola K, Muona P, Simell T, Koskela P, Hyoty H 2000 Enterovirus infection as a risk factor for ß-cell autoimmunity in a prospectively observed birth cohort: the Finnish Diabetes Prediction and Prevention Study. Diabetes 49:1314–1318[Abstract]
  18. Vaidya B, Imrie H, Perros P, Young ET, Kelly WF, Carr D, Large DM, Toft AD, McCarthy MI, Kendall-Taylor P, Pearce SH 1999 The cytotoxic T lymphocyte antigen-4 is a major Graves’ disease locus. Hum Mol Genet 8:1195–1199[Abstract/Free Full Text]
  19. Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC 2003 Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature 423:506–511[CrossRef][Medline]
  20. Kong MF, Jeffcoate W 1994 Eighty-six cases of Addison’s disease. Clin Endocrinol (Oxf) 41:757–761[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
92/8/3338    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sutherland, A.
Right arrow Articles by Pearce, S. H. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sutherland, A.
Right arrow Articles by Pearce, S. H. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*SNP*UniGene
Related Collections
Right arrow Autoimmunity
Right arrow Thyroid


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals