help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2007-0702
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Das, S.
Right arrow Articles by McCarthy, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Das, S.
Right arrow Articles by McCarthy, M. I.
Related Collections
Right arrow Pediatric Endocrinology
Right arrow Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 8 3219-3223
Copyright © 2007 by The Endocrine Society

Detailed Analysis of Variation at and around Mitochondrial Position 16189 in a Large Finnish Cohort Reveals No Significant Associations with Early Growth or Metabolic Phenotypes at Age 31 Years

Sreena Das1, Amanda J. Bennett1, Ulla Sovio, Aimo Ruokonen, Hannu Martikainen, Anneli Pouta, Anna-Liisa Hartikainen, Stephen Franks, Paul Elliott, Joanna Poulton, Marjo-Riitta Järvelin and Mark I. McCarthy

Women’s Centre Level 3 (S.D., J.P.), Nuffield Department of Obstetrics and Gynecology, John Radcliffe Hospital, Oxford Centre for Diabetes, Endocrinology, and Metabolism (S.D., A.J.B., M.I.M.), and Wellcome Trust Centre for Human Genetics (M.I.M.), University of Oxford, Oxford OX3 7LJ, United Kingdom; Department of Epidemiology and Public Health (U.S., P.E., M.-R.J.), and Institute of Reproductive and Developmental Biology (S.F.), Imperial College London, London SW7 2AZ, United Kingdom; and Departments of Clinical Chemistry (A.R.), Obstetrics and Gynecology (H.M., A.P., A.-L.H.), and Public Health Science and General Practice (M.-R.H.), University of Oulu, and National Public Health Institute (A.P.), 90220 Oulu, Finland

Address all correspondence and requests for reprints to: Professor Mark I. McCarthy, Oxford Centre for Diabetes, Endocrinology, and Metabolism, University of Oxford, Oxford OX3 7LJ, United Kingdom. E-mail: mark.mccarthy{at}drl.ox.ac.uk; or Professor Joanna Poulton, Nuffield Department of Obstetrics and Gynecology, John Radcliffe Hospital, Oxford University, Oxford OX3 9DU, United Kingdom. E-mail: joanna.poulton{at}obs-gyn.ox.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Mitochondrial dysfunction is increasingly implicated in pathogenesis of adult metabolic disease. Rare mitochondrial (mt) DNA mutations impair glucose homeostasis, but the contribution of common variants is unclear. In small studies, variation within the OriB origin of replication (at mt16189 in particular) has been associated with both early growth and adult metabolic phenotypes and may contribute to life-course relationships between the two.

Objective: The aim was to study a large well-characterized cohort to determine whether previously reported small-scale associations between OriB sequence variation and early growth and adult metabolic phenotypes are robust.

Design/Setting/Participants: This was a genetic association study of 5470 individuals from the population-based Northern Finland Birth Cohort of 1966, followed prospectively from pregnancy to age 31 yr.

Main Outcome Measures: We measured indices of early growth (including birth weight, placental weight, and ponderal index) and adult metabolic homeostasis (including body mass index, fasting glucose and insulin, indices of insulin action and secretion) and their relationship to variation in the OriB region.

Results: Previously reported associations could not be confirmed. There were no significant (P < 0.01, uncorrected) associations between OriB sequence variation and measures of early growth including birth weight (P = 0.52, comparing individuals with mt16189T to those with a homopolymeric C-tract) and placental weight (P = 0.49). There were no significant associations with adult metabolic phenotypes including fasting glucose (P = 0.07), fasting insulin (P = 0.42), and homeostatic model assessment-derived measures of insulin sensitivity or secretion (P = 0.45 and P = 0.56, respectively).

Conclusion: Despite substantial power to detect previously reported effects, mtDNA variations around OriB are not major contributors to variation in early growth and metabolic phenotypes during early adulthood.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
THERE IS INCREASING evidence that mitochondrial dysfunction contributes to many human phenotypes, especially those related to aging and metabolic disease (1). Evidence implicating mitochondrial dysfunction in the latter derives from two main sources. First, clinical studies have demonstrated altered expression of genes involved in oxidative phosphorylation in insulin-resistant individuals (2, 3) and documented impaired mitochondrial (mt) activity in the insulin-resistant offspring of parents with type 2 diabetes (T2D) (4). Second, genetic studies have revealed that mitochondrial variants (such as that at mt3243) can result in diabetes (typically accompanied by neurological features) (5).

Such rare variants account for only a minority of diabetes, and the contribution of more frequent mitochondrial variants remains unclear. The suggestion that common mtDNA variants may have been influenced by natural selection during adaptation to cold climates (6) is consistent with a role in phenotypes related to energy homeostasis. It has also been proposed that mitochondrial sequence variation may contribute to observed associations between poor early growth and adult metabolic disease (7).

An extensive survey of common mitochondrial variation in 3304 T2D case-control pairs recently reported no convincing evidence for associations with T2D, adiposity or measures of insulin secretion or action (8). However, this study did not feature systematic analysis of the hypervariable D-loop and as such did not (apart from reporting failure to detect association with T2D) consider the contribution of variation at and around mt16189.

Interest in variation at mt16189 derives from previous association studies (see below) and growing evidence that this site lies within an important origin for mtDNA replication, termed OriB (9). Conversion of the wild-type T at mt16189 to a C will, in most individuals, generate a homopolymeric C-tract vulnerable to replication slippage and expansion and with the potential to impact on mitochondrial number and function.

There have been numerous reports of associations between mt16189 and T2D (10, 11), body mass index (BMI) (12, 13), and T2D-related intermediate traits including insulin resistance (11, 14, 15). In addition, the 16189C variant has been associated with lower birth weight (16), lower ponderal index (7, 16), and higher placental weight (12).

Interpretation of these findings is constrained by three factors. First, sample sizes have generally been small. For realistic genetic models of complex-trait susceptibility, this can translate into a high false-positive report probability (17). Second, the distribution of positive findings has been patchy, with only limited replication (in the strict sense of same allele, same phenotype). For example, three recent case-control studies (8, 16, 18) could not replicate previously reported associations between mt16189 and T2D (10, 11), and whereas the C-tract has been associated with thinness in early life (12), the association may be reversed in later life (12, 13). Third, many studies have used genotyping methods susceptible to error or liable to miss potentially relevant variation elsewhere in the OriB region (e.g. interruptions to the homopolymeric C-tract at positions other than 16189).

The present study set out to capture detailed information on sequence variation at and around mt16189 and explore relationships with early growth and adult metabolic phenotypes in a large Finnish birth cohort.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Subjects

The Northern Finnish Birth Cohort of 1966 (NFBC1966) initially ascertained data from pregnant women in the northernmost two provinces of Finland with expected dates of delivery during 1966 [12,058 live births: 96% ascertainment (19)]. Extensive data were collected on parental environment, maternal phenotypes (including maternal height and weight before pregnancy), pregnancy progress, and outcome. Early growth phenotypes (including birth weight, birth length, and placental weight) were captured using standardized methods. Ponderal index was calculated from the ratio of birth weight and birth length cubed. Follow-up data collected at 6 and 12 months included weight and head circumference at the latter time point (in 90.2% of the sample). Questionnaire data obtained for 97% of the sample at age 14 (n = 11,399) included self-reported height and weight. At 31 yr, all offspring living in northern Finland or the Helsinki area (n = 8463) were invited for clinical examination (response rate, 71%) including anthropometric and blood pressure measures and fasting samples for assays of glucose, insulin, and lipids. Phenotyping procedures and biochemical assays are detailed elsewhere (20, 21). Paired fasting glucose and insulin levels were used to generate measures of the homeostatic model assessment method of ß-cell function (HOMA%B) and insulin sensitivity (HOMA%S) using the homeostatic model assessment (HOMA) model (22).

A total of 5470 DNA samples were available for the present study (91% of those attending the 31 yr examination). The principal phenotypic characteristics of these samples are shown in Table 1Go. The subset with DNA is representative of the whole cohort in terms of early factors, and the 31-yr sample for adult demographic factors. All subjects gave fully informed consent, and the study was approved by ethics committees in Oulu and Oxford and in accordance with the Declaration of Helsinki.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Characteristics of the NFBC1966 study sample

 
Genotyping

We developed a pyrosequencing assay to provide explicit sequence information for mt16189 and flanking bases. This provides a robust tool for detecting interruption of the mt16180–16193 sequence by a T at 16189 or elsewhere. However, precise quantification of the number of Cs within homopolymeric C-tract sequences is limited by loss of linearity in long homopolymeric sequences and heteroplasmic tract inflation. PCR amplification used 5'-biotinylated forward (CATAAAAACCCAATCCACATC) and reverse (TGTACTGTTAAGGGTGGGTAGGTT) oligonucleotides under standard conditions (available from the authors). Pyrosequencing was initiated from a primer complementary to the forward strand (5'-GTACTTGCTTGTAAGCAT) and extended through the mt16180–16193 region. All reagents and equipment were supplied by Biotage AB (Uppsala, Sweden).

We used two additional assays for confirmation. First, all samples were typed using an Amplifluor assay (KBiosciences, Hoddesdon, Herts, UK) designed to detect variation at mt16189. However, we found (see below) that this assay lacked perfect discrimination between sequences featuring a T at 16189 and those containing T elsewhere within the C-tract.

Second, we analyzed 1116 samples using Sanger cycle sequencing. We used this for samples in which pyrosequencing traces were difficult to interpret and/or discrepant to those obtained by amplifluor (n = 87); to confirm a proportion of uninterrupted C-tracts (n = 372); and for quality-control in 657 randomly chosen samples.

Genotyping success rates for pyrosequencing and Amplifluor assays were 94.8 and 95.9%, respectively. Of 87 samples that appeared discrepant between the methods, 39 could be attributed to heteroplasmy and 23 to a failure of the Amplifluor assay to discriminate between Ts at 16189 and adjacent positions. Of the remaining 25, cycle-sequencing concurred with pyrosequencing in 22. In the remaining three, we took the cycle-sequencing result to be correct. Only three of 657 random samples revealed discrepancies between pyrosequencing and cycle-sequencing (error rate < 0.3%).

Statistical analysis

Our principal analyses compared trait values among the four major sequence groups observed (Table 2Go): 1) those with a T at 16189 alone (wild type: T16189); 2) those with an uninterrupted C-tract (Ctract); 3) those with a T at 16189 and another T elsewhere in the sequence of interest (T16189+); and 4) those in whom C-tract sequence was interrupted by a T other than at 16189 (Tother). We also directly compared the first two groups (T16189 vs. Ctract). These groupings were defined before analysis and reflected what we considered to be the most relevant categories. To capture additional features of regional sequence variation, we also performed exploratory analyses that compared the effect of adjacent A-tract length (4As vs. < 4) among individuals from the Ctract group and those with a T at position 16192 (irrespective of 16189 status) against Ctract.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Sequence variants and their frequencies observed in the NFBC1966 sample

 
Continuous phenotypes were transformed to normality as appropriate. Between-group comparisons were conducted using general linear models. We performed unadjusted analyses as well as analyses adjusted for sets of variables, which within NFBC1966, show strong univariate associations with either the early growth or adult outcomes. These variables are listed in the footnotes to the respective analysis tables. We also performed analyses after stratification by gender, parity (first born vs. later born) and postnatal growth realignment [defining the change-up, nonchanger, and change-down subgroups using a first-year weight-change threshold of 0.67 of a SD score (23)].

In addition, we examined BMI at age 14 yr (adjusted for contemporaneous parental socioeconomic status). Given maternal transmission of mitochondrial genotype, we also related inferred maternal genotype to maternal BMI before pregnancy (after removing outliers and using adjustment for maternal socioeconomic status).

All analyses were conducted in SPSS (version 14.0; SPSS Inc., Chicago, IL). Given the large number of tests performed, but noting the extensive correlation between those tests (at both the genotype and phenotype level), we have chosen to report uncorrected results as nominally significant when P < 0.01.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
Patterns of regional sequence variation are documented in Table 2Go. In NFBC1966, 59.6% were classified as T16189, 22.2% displayed an uninterrupted C-tract (Ctract), 9.3% were T16189+, 7.9% were Tother, and 1.1% were heteroplasmic. The frequency of 16189C (i.e. Ctract plus Tother) is slightly higher than previous reports from Finland (16), presumably reflecting the regional provenance of the cohort.

Relationships between mitochondrial sequence variation and early growth phenotypes are summarized in Table 3Go (and detailed in supplementary Tables 1 and 2, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://jcem.endojournals.org). We found no significant between-group differences in any of the early growth phenotypes whether we compared all four groups or simply the Ctract and T16189 subjects. This was the case for both unadjusted and adjusted analyses and also when stratified by gender. Exploratory analyses of A-tract length and comparing T16192 and Ctract subjects (see Subjects and Methods) also generated no significant associations (P > 0.01), as did analyses performed after stratification for parity and postnatal growth realignment (data not shown).


View this table:
[in this window]
[in a new window]

  		TABLE 3. Early growth variables and OriB sequence variation in the NFBC1966 sample

 
The equivalent analyses for adult variables are summarized in Table 4Go (and detailed in supplementary Tables 3–6, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://jcem.endojournals.org). We observed nominally significant differences (restricted to males) between genotype groups for fasting insulin and HOMA%S (lowest insulin and highest HOMA%S values in the Tother group, Padj = 0.001, 0.01, respectively). This pattern was not replicated in females and did not feature in the direct comparison of Ctract and T16189 groups. As before, exploratory between-group comparisons, and stratification by parity and postnatal growth realignment failed to reveal significant associations. Analyses of cohort BMI at 14 yr and maternal BMI prepregnancy were also unremarkable (Table 4Go).


View this table:
[in this window]
[in a new window]

  		TABLE 4. Adult variables and OriB sequence variation in the NFBC1966 sample

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
Despite a sample size substantially larger than that deployed in previous studies of variation in the OriB region, we have been unable to substantiate previous associations with birth weight (16), ponderal index (7, 16), placental weight (12), adiposity (12, 13), or insulin sensitivity (11, 14, 15).

The strengths of the present study reside in the large sample size, the prospective nature and population base of the cohort studied, and the extent of the phenotype measures. Our cohort has, for the traits studied and the comparison of the Ctract and T16189 groups, over 80% power to detect between-group differences exceeding 12% of a SD (at our chosen alpha = 0.01). The validity and accuracy of the phenotyping in NFBC1966 is supported by our capacity to replicate expected trait relationships (e.g. between birth weight and adult traits and between components of the metabolic syndrome) (24). DNA sample fidelity has been confirmed by gender checks and our capacity to replicate established genotype-phenotype associations, such as those between GCK and TCF7L2 variants and fasting glucose, and between APOAV variants and triglycerides (our unpublished data).

One potential limitation of our cohort is the relatively young age (31 yr) at which metabolic phenotypes were ascertained as well as the absence of dynamic tests of glucose homeostasis. However, it is widely accepted, based on longitudinal data, that abnormalities of basal ß-cell function and insulin sensitivity are detectable long before the onset of T2D and that variation in such phenotypes in early adulthood is generally predictive of future disease (25). It is also important to recognize that the relationship among genetic sequence variation, early growth, and adult disease phenotypes may be subject to modification by factors such as genetic background and environmental exposure (e.g. nutritional status), which may attenuate the capacity to observe replication across studies conducted in different ethnicities and at different times.

In conclusion, this study of more than 5000 individuals from a well-characterized Finnish birth cohort has failed to detect significant associations between variation in the OriB region of interest (and specifically the 16189 variant) and either early growth or adult metabolic and anthropometric phenotypes. These data raise substantial doubts about the validity of previous reports of the phenotypic consequences of this variant. They are also consistent with three recent large-scale case-control studies (involving more than 10,000 individuals combined), which were unable to replicate previous small-scale associations between mt16189 variation and T2D status (8, 16, 18). The analyses performed in this study appear to exclude a strong direct relationship between OriB mtDNA variation, early growth and metabolic phenotypes, at least when measured in early adulthood.


   Acknowledgments
 
We thank Professor Leena Peltonen-Palotie and Ms. Outi Törnwall (Helsinki, Finland) for their assistance with DNA quantification and distribution. We are grateful to the many patients, relatives, nurses, and physicians who contributed to this cohort.


   Footnotes
 
This work was supported by the Academy of Finland, Wellcome Trust (Project Grant GR069224), the U.K. Medical Research Council, the Royal Society, and the Cephalosporin Scholarship awarded by Lady Margaret Hall College, University of Oxford (to S.D.).

Disclosure Information: All authors have nothing to disclose.

First Published Online May 29, 2007

1 S.D. and A.J.B. contributed equally to this work. Back

Abbreviations: BMI, Body mass index; HOMA%B, homeostatic model assessment method of ß-cell function; HOMA%S, homeostatic model assessment method of insulin sensitivity; mt, mitochondrial; NFBC1966, Northern Finnish Birth Cohort of 1966; T2D, type 2 diabetes.

Received March 27, 2007.

Accepted May 21, 2007.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Taylor RW, Turnbull DM 2005 Mitochondrial DNA mutations in human disease. Nat Rev Genet 6:389–402[Medline]
  2. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC 2003 PGC-1{alpha}-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34:267–273[CrossRef][Medline]
  3. Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S, Miyazaki Y, Kohane I, Costello M, Saccone R, Landaker EJ, Goldfine AB, Mun E, DeFronzo R, Finlayson J, Kahn CR, Mandarino LJ 2003 Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1. Proc Natl Acad Sci USA 100:8466–8471[Abstract/Free Full Text]
  4. Petersen KF, Dufour S, Befroy D, Garcia R, Shulman GI 2004 Impaired mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. N Engl J Med 350:664–671[Abstract/Free Full Text]
  5. Maassen JA, Kadowaki T 1996 Maternally inherited diabetes and deafness: a new diabetes subtype. Diabetologia 39:375–382[Medline]
  6. Ruiz-Pesini E, Mishmar D, Brandon M, Procaccio V, Wallace DC 2004 Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 303:223–226[Abstract/Free Full Text]
  7. Casteels K, Ong K, Phillips D, Bendall H, Pembrey M 1999 Mitochondrial 16189 variant, thinness at birth, and type-2 diabetes. ALSPAC study team. Avon Longitudinal Study of Pregnancy and Childhood. Lancet 353:1499–1500[CrossRef][Medline]
  8. Saxena R, de Bakker PI, Singer K, Mootha V, Burtt N, Hirschhorn JN, Gaudet D, Isomaa B, Daly MJ, Groop L, Ardlie KG, Altshuler D 2006 Comprehensive association testing of common mitochondrial DNA variation in metabolic disease. Am J Hum Genet 79:54–61[CrossRef][Medline]
  9. Yasukawa T, Yang MY, Jacobs HT, Holt IJ 2005 A bidirectional origin of replication maps to the major noncoding region of human mitochondrial DNA. Mol Cell 18:651–662[CrossRef][Medline]
  10. Poulton J, Luan J, Macaulay V, Hennings S, Mitchell J, Wareham NJ 2002 Type 2 diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study. Hum Mol Genet 11:1581–1583[Abstract/Free Full Text]
  11. Liou CW, Lin TK, Huei Weng H, Lee CF, Chen TL, Wei YH, Chen SD, Chuang YC, Weng SW, Wang PW 2007 A common mitochondrial DNA variant and increased body mass index as associated factors for development of type 2 diabetes: additive effects of genetic and environmental factors. J Clin Endocrinol Metab 92:235–239[Abstract/Free Full Text]
  12. Parker E, Phillips DI, Cockington RA, Cull C, Poulton J 2005 A common mitchondrial DNA variant is associated with thinness in mothers and their 20-yr-old offspring. Am J Physiol Endocrinol Metab 289:E1110–E1114
  13. Kim JH, Park KS, Cho YM, Kang BS, Kim SK, Jeon H.. Kim SY, Lee HK 2002 The prevalence of the mitochondrial DNA 16189 variant in non-diabetic Korean adults and its association with higher fasting glucose and body mass index. Diabet Med 19:681–684[CrossRef][Medline]
  14. Poulton J, Brown MS, Cooper A, Marchington DR, Phillips DI 1998 A common mitochondrial DNA variant is associated with insulin resistance in adult life. Diabetologia 41:54–58[CrossRef][Medline]
  15. Crispim D, Fagundes NJ, Canani LH Gross JL, Tschiedel B, Roisenberg I 2006 Role of the mitochondrial m. 16189T>C variant in type 2 diabetes mellitus in southern Brazil. Diabetes Res Clin Pract 74:204–206[CrossRef][Medline]
  16. Mohlke KL, Jackson AU, Scott LJ, Peck EC, Suh YD, Chines PS, Watanabe RM, Buchanan TA, Conneely KN, Erdos MR, Narisu N, Enloe S, Valle TT, Tuomilehto J, Bergman RN, Boehnke M, Collins FS 2005 Mitochondrial polymorphisms and susceptibility to type 2 diabetes-related traits in Finns. Hum Genet 118:245–254[CrossRef][Medline]
  17. Wacholder S, Chanock S, Garcia-Closas M, El Ghormli L, Rothman N 2004 Assessing the probability that a positive report is false: an approach for molecular epidemiology studies. J Natl Cancer Inst 96:434–442[Abstract/Free Full Text]
  18. Chinnery PF, Elliott HR, Patel S, Lambert C, Keers SM, Durham SE, McCarthy MI, Hitman GA, Hattersley AT, Walker M 2005 Role of the mitochondrial DNA 16184–16193 poly-C tract in type 2 diabetes. Lancet 366:1650–1651[CrossRef][Medline]
  19. Rantakallio P 1988 The longitudinal study of the northern Finland birth cohort of 1966. Paediatr Perinat Epidemiol 2:59–88[Medline]
  20. Taponen S, Martikainen H, Jarvelin MR, Sovio U, Laitinen J, Pouta A, Hartikainen AL, McCarthy MI, Franks S, Paldanius M, Ruokonen A 2004 Metabolic cardiovascular disease risk factors in women with self-reported symptoms of oligomenorrhea and/or hirsutism: Northern Finland Birth Cohort 1966 Study. J Clin Endocrinol Metab 89:2114–2118[Abstract/Free Full Text]
  21. Bennett A, Sovio U, Ruokonen A, Martikainen H, Pouta A, Taponen S, Hartikainen AL, Franks S, Peltonen L, Elliott P, Jarvelin MR, McCarthy MI 2005 No association between insulin gene variation and adult metabolic phenotypes in a large Finnish birth cohort. Diabetologia 48:886–891[CrossRef][Medline]
  22. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC 1985 Homeostasis model assessment: insulin resistance and ß-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28:412–419[CrossRef][Medline]
  23. Dunger DB, Ong KK, Huxtable SJ, Sherriff A, Woods KA, Ahmed ML, Golding J, Pembrey ME, Ring S, Bennett ST, Todd JA 1998 Association of the INS VNTR with size at birth. ALSPAC Study Team. Avon Longitudinal Study of Pregnancy and Childhood. Nat Genet 19:98–100[Medline]
  24. Jarvelin MR, Sovio U, King VJ, Laurén L, Baizhuany X, McCarthy MI, Hartikainen A-L, Laitinen J, Zitting P, Rantakallio P, Elliott P 2004 Early life factors and blood pressure at age 31 in the 1966 Northern Finland Birth Cohort. Hypertension 44:838–846[Abstract/Free Full Text]
  25. Kahn SE 2003 The relative contributions of insulin resistance and ß-cell dysfunction to the pathophysiology of type 2 diabetes. Diabetologia 46:3–19[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Das, S.
Right arrow Articles by McCarthy, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Das, S.
Right arrow Articles by McCarthy, M. I.
Related Collections
Right arrow Pediatric Endocrinology
Right arrow Metabolism

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals