This Article Abstract Full Text (PDF) All Versions of this Article: 92/6/2387    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, Y. Articles by Xing, M. Search for Related Content PubMed PubMed Citation Articles by Wang, Y. Articles by Xing, M. Related Collections Thyroid Endocrine Oncology

High Prevalence and Mutual Exclusivity of Genetic Alterations in the Phosphatidylinositol-3-Kinase/Akt Pathway in Thyroid Tumors

Division of Endocrinology and Metabolism (Y.W., P.H., M.J., D.L., S.C., M.X.), The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; The Affiliated Hospital of Qingdao Medical College (Y.W., W.W., S.Z., S.Y., X.S., G.Z.), Qingdao University, Qingdao 266003, People’s Republic of China; Changzheng Hospital (H.Y.), The Second Military Medical University, Shanghai 200433, People’s Republic of China; and The First Affiliated Hospital of Medical College (B.S.), Xi’an Jiaotong University, Xi’an 710061, People’s Republic of China

Address all correspondence and requests for reprints to: Michael Mingzhao Xing, M.D., Ph.D., Division of Endocrinology and Metabolism, The Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287. E-mail: mxing1{at}jhmi.edu.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Context: Genetic alterations in the phosphatidylinositol-3-kinase (PI3K)/Akt pathway and their role in thyroid tumor pathogenesis in Chinese people remain undefined.

Objective: The objective of the study was to examine the major genetic alterations and their relationship in the PI3K/Akt pathway in differentiated thyroid tumors in a Chinese cohort.

Design: We used real-time quantitative PCR for the analysis of PIK3CA copy gain and direct DNA sequencing for the detection of PIK3CA, RAS, and PTEN mutations on genomic DNA isolated from 234 thyroid tumors, including 31 follicular thyroid cancer (FTC), 141 papillary thyroid cancer (PTC), and 62 follicular thyroid adenoma (FTA).

Results: We found PIK3CA copy gain (defined as four or more copies) in nine of 31 FTC (29%), 20 of 141 PTC (14%), and five of 62 FTA (8%); PIK3CA gene mutations in four of 31 FTC (13%), one of 141 PTC (1%), and none of 62 FTA (0%); Ras mutations in three of 31 FTC (10%) and none of the 141 PTC and 62 FTA; and PTEN mutations in two of 31 FTC (6%) and none of 62 FTA (0%). Collectively, nine of 31 FTC (29%) vs. none of 62 FTA (0%) (P < 0.01) harbored one of the mutations, and when PIK3CA copy gain was included, 16 of 31 FTC (52%) vs. five of 62 FTA (8%) (P < 0.01) harbored any genetic alteration in the PI3K/Akt pathway. Mutual exclusivity was seen among all these PI3K/Akt pathway-related genetic alterations in all thyroid tumors except for two cases that harbored two genetic alterations.

Conclusion: These data from a Chinese cohort provide further genetic evidence suggesting that dysregulated PI3K/Akt pathway plays a significant role in the pathogenesis of thyroid tumors, particularly FTC.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
DIFFERENTIATED FOLLICULAR thyroid cell-derived tumors can be classified into follicular thyroid adenoma (FTA), follicular thyroid cancer (FTC), and papillary thyroid cancer (PTC). Genetic alterations in major signaling pathways are common in thyroid tumors (1). For example, BRAF mutation in the MAPK pathway is frequently seen in PTC (2, 3), whereas genetic alterations in the phosphatidylinositol-3-kinase (PI3K)/Akt pathway are often seen in FTA and FTC. The potential role of the PI3K/Akt pathway in thyroid tumor pathogenesis has drawn particular attention recently (4). Dysregulation of this pathway plays a role in the pathogenesis of many cancers (1, 5, 6, 7). Signaling of the PI3K/Akt pathway involves generation of phosphatidylinositol-3, 4, 5-trisphosphate (PIP₃) catalyzed by PI3K. PIP₃ recruits phosphoinositide-dependent kinase 1 and the Ser/Thr kinase Akt to cell membrane in which the latter is phosphorylated and activated by the former. Activated Akt phosphorylates downstream protein effectors and promotes cell proliferation and survival. Phosphatase and tensin homolog deleted from chromosome 10 (PTEN), a lipid phosphatase, antagonizes PI3K/Akt signaling by degrading PIP₃ and therefore functions as a tumor suppressor (8). PI3K is composed of a heterodimer of a p85 regulatory subunit and one of several p110 catalytic subunits. Mutation and amplification of the gene for PIK3CA, a p110 subunit, was shown in many human cancers (7, 9). Through interactions with Ras-binding domains of PI3K subunits, Ras also plays a role in the signaling of the PI3K/Akt pathway.

Thyroid tumor-related genetic alterations in the PI3K/Akt pathway have been explored in some populations but not the Chinese people. These alterations include copy gain of the PIK3CA gene (10) and mutations of the PIK3CA (11), Ras (12), and PTEN (13, 14) genes. These previous studies were focused on individual genetic alterations but not their collective occurrence and relationship in the PI3K/Akt pathway. The present study was conducted to investigate these genetic alterations and their relationship in thyroid tumors in a Chinese cohort.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Thyroid tumor samples, clinicopathological data collection, and DNA isolation

With the institutional review board approval, paraffin-embedded thyroid tumor samples were randomly and consecutively selected at the Affiliated Hospital of Qingdao University in Qingdao, Changzheng Hospital of the Second Military Medical University in Shanghai, and the Affiliated Hospital of Xian Medical College of Jiaotong University in Xian, P. R. China. A total of 234 tumor samples from 234 patients were collected, including 141 PTC, 31 FTC, and 62 FTA samples. Genomic DNA was isolated from tumors as previously described (10), using xylene to remove paraffin and sodium dodecyl sulfate and proteinase K to digest tissues, followed by phenol-chloroform extraction and ethanol precipitation of DNA.

Copy number analysis of the PIK3CA gene with real-time quantitative PCR

In a previous study using florescence in situ hybridization, we validated a quantitative real-time PCR technique in evaluating copy number gain of the PIK3CA gene in thyroid tumors (10). This technique was used in the present study with the same ABI 7900HT TaqMan sequence detector (PE Applied Biosystems, Foster City, CA) and primers/probes for PIK3CA and ß-actin (reference) genes.

Analysis of the PIK3CA, Ras, PTEN, and BRAF genes for mutations

All the mutations were analyzed by direct genomic DNA sequencing. We chose to analyze exons 9 and 20 for PIK3CA mutations because they harbored more than 80% of known PIK3CA mutations (9), using our previously described primers and PCR conditions (10). For Ras mutations, we analyzed N2-Ras, H1-Ras, H2-Ras, and K1-Ras because a vast majority of the Ras mutations in thyroid tumors was found in these exons, using previously described primers and modified PCR conditions (12). Mutations in the PTEN gene had been reported mostly in exons 5, 6, 7, and 8 human cancers (15, 16), which were selected for analysis here using the following primers: CTTATTCTGAGGTTATCTTTTTACC (forward) and CTCAGAATCCAGGAAGAGGA (reverse) for exon 5; TTGGCTTCTCTTTTTTTTCTG (forward) and ACATGGAAGGATGAGAATTTC (reverse) for exon 6; ACAGAATCCATATTTCGTGTA (forward) and TAATGTCTCACCAATGCCA (reverse) for exon 7; and ACACATCACATACATACAAGTC (forward) and GTGCAGATAATGACAAGGAATA (reverse) for exon 8. The T1799A transversion BRAF mutation in exon 15 of the BRAF gene was analyzed as described previously (17). Sequencing analysis was achieved using Big Dye reagents and an ABI PRISM 3700 DNA analyzer (Applied Biosystems).

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
High prevalence of genetic alterations in the PI3K/Akt pathway in Chinese thyroid tumors

As summarized in Table 1, with a gene copy number of four or more defined as PIK3CA copy gain, in this Chinese cohort, we observed PIK3CA copy gain in nine of 31 FTC (29%), 20 of 141 PTC (14%), and five of 62 FTA (8%). Similar to the finding in a previous study consisting mainly of Caucasian patients (10), the highest prevalence of PIK3CA copy gain in this Chinese cohort was also seen in FTC. We found PIK3CA gene mutations in four of 31 FTC (13%), one of 141 PTC (1%), and none of 62 FTA (0%). We found RAS mutations in three of 31 FTC (10%) and none of 141 PTC and 62 FTA, and PTEN mutations in four of 31 FTC (13%) and none of FTA 62 (0%). All these gene mutations individually also showed the highest prevalence in FTC. Because previous studies revealed a very low or zero prevalence of PTEN mutation in PTC in different populations (13, 14), we did not examine this mutation in PTC in the present study. Collectively we found that nine of 31 FTC (29%) vs. none of 62 FTA (0%) (P < 0.01, per two-tailed Fisher’s exact test) harbored one of the PI3K/Akt pathway-related gene mutations. When PIK3CA copy gain was also included, 16 of 31 FTC (52%) vs. five of 62 FTA (8%) (P < 0.01, per two-tailed Fisher’s exact test) harbored at least one of these genetic alterations. The collective prevalence of genetic alterations in PTC, excluding PTEN mutations, which were not examined, was 21 of 141 (15%). Thus, a high collective prevalence of either gene mutations or total genetic alterations (i.e. mutations plus PIK3CA copy gain) in the PI3K/Akt pathway was particularly seen in FTC.

Because PIK3CA copy gain is the most common genetic alteration in the PI3K/Akt pathway in thyroid tumors in this Chinese cohort, we analyzed its relationship with each of the gene mutations in the PI3K/Akt pathway. As shown in Table 1, PIK3CA gene copy gain was uncommonly overlapped with gene mutations in FTC; mutations were mostly seen in the group of FTC without PIK3CA copy gain. The mutual exclusivity between PIK3CA copy gain and any of the PIK3CA, Ras, and PTEN mutations was not statistically significant, probably due to the small number of each of these mutations. The mutual exclusivity of these genetic alterations is even more clearly seen in Table 2, which shows all the individual cases with respect to their genetic status. As shown in Table 2, only two cases harbored coexisting PIK3CA copy gain and a gene mutation, and all the remaining cases with PIK3CA copy gain were excluded from additionally harboring PIK3CA, Ras, or PTEN mutations. Moreover, complete mutual exclusivity among the mutations of PIK3CA, Ras, and PTEN mutations existed; there was not a single overlap among these mutations (Table 2). In contrast, overlap of the T1799A BRAF mutation with PIK3A copy gain was seen in a number of cases of PTC (data not shown). This may be expected because the two genetic alterations belong to two unrelated signaling pathways.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

Among the PI3K/Akt pathway-related genetic alterations, we found that PIK3CA copy gain was the single most common genetic alteration and was mutually exclusive with gene mutations in the PI3K/Akt pathway. This represents strong genetic evidence that PIK3CA copy gain possesses similar oncogenic function as the classical gene mutations in this pathway in thyroid tumor pathogenesis. PIK3CA copy gain was correlated with increased Akt phosphorylation and activity and tumor progression in lung and uterine cancers (18, 19, 20). We previously demonstrated a correlation of PIK3CA copy gain with increased phosphorylation of Akt in thyroid cancer cell lines (10). Our recent study on a series of Caucasian cases showed a correlation of PIK3CA copy gain with increased PIK3CA protein expression in thyroid tumors (21), supporting the functional relevance of this genetic alteration. Consistent with these results, in the present study on this Chinese cohort, we found a strong tendency of association of PIK3Ca copy gain with several high-risk clinicopathological characters of thyroid cancer (data not shown), suggesting a possible role of this genetic alteration in thyroid tumor progression.

The collective prevalence of genetic alterations in the PI3K/Akt pathway was particularly high in FTC (52%), suggesting a significant role of the PI3K/Akt pathway in the pathogenesis of this cancer. The mutual exclusivity among these genetic alterations suggests that each of them may individually be sufficient to drive thyroid tumor pathogenesis through the PI3K/Akt pathway. The high collective prevalence and mutual exclusivity of the PI3K/Akt pathway-related genetic alterations in this Chinese cohort were similar to our recent findings in a Caucasian cohort (21). Unlike in other studies (10, 11, 12), Ras mutation was absent in PTC and FTA and PIK3CA and PTEN mutations were relatively common in FTC in this Chinese cohort. This likely represents an ethnic and geographical variation. The absence of Ras mutation in PTC could also be attributed to the small number (only four) of follicular variant PTC included in the present study because this is the main PTC subtype that harbors Ras mutations (22). The PIK3CA copy gain also occurred in some FTA, consistent with a possibility that dysregulated PI3K/Akt signaling may promote transformation of FTA to FTC. Deletion of the tumor suppressor PTEN gene did not seem to be a major genetic event in the tumors in the present study because our quantitative real-time PCR analysis on a group of FTC samples showed the copy number of the gene to be 2.48 ± 0.67 (mean ± SD, n = 22); none of these samples showed a copy number less than 1.5 (rounding up to 2.0), suggesting no deletion of the gene.

In summary, we found a high prevalence of genetic alterations in the PI3K/Akt pathway in a Chinese cohort of thyroid tumors, particularly FTC, which were mutually exclusive. The data provide further genetic evidence supporting the notion that dysregulated PI3K/Akt pathway plays an important role in the pathogenesis of thyroid tumors, particularly FTC, regardless of ethnic backgrounds.

	Footnotes

 
This work was supported by American Cancer Society Research Scholar Grant RSG 05-199-01-CCE (to M.X.).

The authors have nothing to disclose.

First Published Online April 10, 2007

¹ Y.W. and P.H. contributed equally. Y.W. was a Ph.D. candidate from Qingdao University, Qingdao, People’s Republic of China.

Abbreviations: FTA, Follicular thyroid adenoma; FTC, follicular thyroid cancer; PI3K, phosphatidylinositol-3-kinase; PIP₃, phosphatidylinositol-3, 4, 5-trisphosphate; PTC, papillary thyroid cancer; PTEN, phosphatase and tensin homolog deleted from chromosome 10.

Received September 14, 2006.

Accepted March 29, 2007.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Kondo T, Ezzat S, Asa SL 2006 Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nat Rev Cancer 6:292–306[CrossRef][Medline]
2. Xing M 2005 BRAF mutation in thyroid cancer. Endocr Relat Cancer 12:245–262[Medline]
3. Ciampi R, Nikiforov YE 2005 Alterations of the BRAF gene in thyroid tumors. Endocr Pathol 16:163–172[CrossRef][Medline]
4. Shinohara M, Chung YJ, Saji M, Ringel MD 2006 Akt in thyroid tumorigenesis and progression. Endocrinology 148:942–947[CrossRef][Medline]
5. Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, Gonzalez-Baron M 2004 PI3K/Akt signalling pathway and cancer. Cancer Treat Rev 30:193–204[CrossRef][Medline]
6. Bader AG, Kang S, Zhao L, Vogt PK 2005 Oncogenic PI3K deregulates transcription and translation. Nat Rev Cancer 5:921–929[CrossRef][Medline]
7. Samuels Y, Ericson K 2006 Oncogenic PI3K and its role in cancer. Curr Opin Oncol 18:77–82[Medline]
8. Sansal I, Sellers WR 2004 The biology and clinical relevance of the PTEN tumor suppressor pathway. J Clin Oncol 22:2954–2963[Abstract/Free Full Text]
9. Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S, Yan H, Gazdar A, Powell SM, Riggins GJ, Willson JK, Markowitz S, Kinzler KW, Vogelstein B, Velculescu VE 2004 High frequency of mutations of the PIK3CA gene in human cancers. Science 304:554
10. Wu G, Mambo E, Guo Z, Hu S, Huang X, Gollin SM, Trink B, Ladenson PW, Sidransky D, Xing M 2005 Uncommon mutation, but common amplifications, of the PIK3CA gene in thyroid tumors. J Clin Endocrinol Metab 90:4688–4693[Abstract/Free Full Text]
11. Garcia-Rostan G, Costa AM, Pereira-Castro I, Salvatore G, Hernandez R, Hermsen MJ, Herrero A, Fusco A, Cameselle-Teijeiro J, Santoro M 2005 Mutation of the PIK3CA gene in anaplastic thyroid cancer. Cancer Res 65:10199–10207[Abstract/Free Full Text]
12. Vasko V, Ferrand M, Di Cristofaro J, Carayon P, Henry JF, de Micco C 2003 Specific pattern of RAS oncogene mutations in follicular thyroid tumors. J Clin Endocrinol Metab 88:2745–2752[Abstract/Free Full Text]
13. Dahia PL, Marsh DJ, Zheng Z, Zedenius J, Komminoth P, Frisk T, Wallin G, Parsons R, Longy M, Larsson C, Eng C 1997 Somatic deletions and mutations in the Cowden disease gene, PTEN, in sporadic thyroid tumors. Cancer Res 57:4710–4713[Abstract/Free Full Text]
14. Halachmi N, Halachmi S, Evron E, Cairns P, Okami K, Saji M, Westra WH, Zeiger MA, Jen J, Sidransky D 1998 Somatic mutations of the PTEN tumor suppressor gene in sporadic follicular thyroid tumors. Genes Chromosomes Cancer 23:239–243[CrossRef][Medline]
15. Minaguchi T, Yoshikawa H, Oda K, Ishino T, Yasugi T, Onda T, Nakagawa S, Matsumoto K, Kawana K, Taketani Y 2001 PTEN mutation located only outside exons 5, 6, and 7 is an independent predictor of favorable survival in endometrial carcinomas. Clin Cancer Res 7:2636–2642[Abstract/Free Full Text]
16. Konopka B, Paszko Z, Janiec-Jankowska A, Goluda M 2002 Assessment of the quality and frequency of mutations occurrence in PTEN gene in endometrial carcinomas and hyperplasias. Cancer Lett 178:43–51[CrossRef][Medline]
17. Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G, Tolaney S, Holt EH, Hui P, Umbricht CB, Basaria S, Ewertz M, Tufaro AP, Califano JA, Ringel MD, Zeiger MA, Sidransky D, Ladenson PW 2005 BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. J Clin Endocrinol Metab 90:6373–6379[Abstract/Free Full Text]
18. Massion PP, Taflan PM, Shyr Y, Rahman SM, Yildiz P, Shakthour B, Edgerton ME, Ninan M, Andersen JJ, Gonzalez AL 2004 Early involvement of the phosphatidylinositol 3-kinase/Akt pathway in lung cancer progression. Am J Respir Crit Care Med 170:1088–1094[Abstract/Free Full Text]
19. Massion PP, Kuo WL, Stokoe D, Olshen AB, Treseler PA, Chin K, Chen C, Polikoff D, Jain AN, Pinkel D, Albertson DG, Jablons DM, Gray JW 2002 Genomic copy number analysis of non-small cell lung cancer using array comparative genomic hybridization: implications of the phosphatidylinositol 3-kinase pathway. Cancer Res 62:3636–3640[Abstract/Free Full Text]
20. Bertelsen BI, Steine SJ, Sandvei R, Molven A, Laerum OD 2006 Molecular analysis of the PI3K-AKT pathway in uterine cervical neoplasia frequent PIK3CA amplification and AKT phosphorylation. Int J Cancer 118:1877–1883[CrossRef][Medline]
21. Hou P, Liu D, Shan Y, Hu S, Studeman K, Condouris S, Wang Y, Trink A, El-Naggar AK, Tallini G, Vasko V, Xing M 2007 Genetic alterations and their relationship in the phosphatidylinositol 3-kinase/Akt pathway in thyroid cancer. Clin Cancer Res 13:1161–1170[Abstract/Free Full Text]
22. Zhu Z, Gandhi M, Nikiforova MN, Fischer AH, Nikiforov YE 2003 Molecular profile and clinical-pathologic features of the follicular variant of papillary thyroid carcinoma. An unusually high prevalence of ras mutations. Am J Clin Pathol 120:71–77[CrossRef][Medline]

This article has been cited by other articles:

				S. Wee, D. Wiederschain, S.-M. Maira, A. Loo, C. Miller, R. deBeaumont, F. Stegmeier, Y.-M. Yao, and C. Lengauer PTEN-deficient cancers depend on PIK3CB PNAS, September 2, 2008; 105(35): 13057 - 13062. [Abstract] [Full Text] [PDF]

				Z. Liu, P. Hou, M. Ji, H. Guan, K. Studeman, K. Jensen, V. Vasko, A. K. El-Naggar, and M. Xing Highly Prevalent Genetic Alterations in Receptor Tyrosine Kinases and Phosphatidylinositol 3-Kinase/Akt and Mitogen-Activated Protein Kinase Pathways in Anaplastic and Follicular Thyroid Cancers J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3106 - 3116. [Abstract] [Full Text] [PDF]

				J. Abubaker, Z. Jehan, P. Bavi, M. Sultana, S. Al-Harbi, M. Ibrahim, A. Al-Nuaim, M. Ahmed, T. Amin, M. Al-Fehaily, et al. Clinicopathological Analysis of Papillary Thyroid Cancer with PIK3CA Alterations in a Middle Eastern Population J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 611 - 618. [Abstract] [Full Text] [PDF]

				N. Yeager, C. Brewer, K. Q. Cai, X.-X. Xu, and A. Di Cristofano Mammalian Target of Rapamycin Is the Key Effector of Phosphatidylinositol-3-OH Initiated Proliferative Signals in the Thyroid Follicular Epithelium Cancer Res., January 15, 2008; 68(2): 444 - 449. [Abstract] [Full Text] [PDF]

				L. Santarpia, A. K. El-Naggar, G. J. Cote, J. N. Myers, and S. I. Sherman Phosphatidylinositol 3-Kinase/Akt and Ras/Raf-Mitogen-Activated Protein Kinase Pathway Mutations in Anaplastic Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 278 - 284. [Abstract] [Full Text] [PDF]

				D. W. Ball, N. Jin, D. M. Rosen, A. Dackiw, D. Sidransky, M. Xing, and B. D. Nelkin Selective Growth Inhibition in BRAF Mutant Thyroid Cancer by the Mitogen-Activated Protein Kinase Kinase 1/2 Inhibitor AZD6244 J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4712 - 4718. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 92/6/2387    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, Y. Articles by Xing, M. Search for Related Content PubMed PubMed Citation Articles by Wang, Y. Articles by Xing, M. Related Collections Thyroid Endocrine Oncology