help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-2476
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palming, J.
Right arrow Articles by Carlsson, L. M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palming, J.
Right arrow Articles by Carlsson, L. M. S.
Related Collections
Right arrow Diabetes and Insulin
Right arrow Metabolism
Right arrow Obesity
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 6 2346-2352
Copyright © 2007 by The Endocrine Society

The Expression of NAD(P)H:Quinone Oxidoreductase 1 Is High in Human Adipose Tissue, Reduced by Weight Loss, and Correlates with Adiposity, Insulin Sensitivity, and Markers of Liver Dysfunction

Jenny Palming1, Kajsa Sjöholm1, Margareta Jernås, Theodore C. Lystig, Anders Gummesson, Stefano Romeo, Lars Lönn, Malin Lönn, Björn Carlsson and Lena M. S. Carlsson

Sahlgrenska Center for Cardiovascular and Metabolic Research (J.P., K.S., M.J., T.C.L., A.G., B.C., L.M.S.C.), Department of Molecular and Clinical Medicine (M.L.), and Department of Radiology (L.L.), the Sahlgrenska Academy, Göteborg University, SE-413 45 Göteborg, Sweden; and Donald W. Reynolds Cardiovascular Clinical Research Center (S.R.), University of Texas Southwestern Medical Center, Dallas, Texas 75390

Address all correspondence and requests for reprints to: Kajsa Sjöholm, Vita Stråket 15, SE-413 45 Göteborg, Sweden. E-mail: kajsa.sjoholm{at}medic.gu.se.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: We have previously identified nicotinamide adenine dinucleotide phosphate:quinone oxidoreductase 1 (NQO1), an enzyme involved in the protection against oxidative stress, as a gene predominantly expressed in human adipocytes. Studies in mice deficient in NQO1 activity suggest that NQO1 may also play an important role in metabolism.

Objective: The aim of this study was to explore the expression and regulation of NQO1 in human adipose tissue (AT) and isolated adipocytes.

Patients and Results: The high expression of NQO1 in adipocytes was verified in human adipocytes and AT by real-time PCR. DNA microarray analysis showed that NQO1 was expressed at higher levels in large compared with small adipocytes, isolated from the same fat biopsy. Furthermore, NQO1 mRNA levels were positively correlated with adipocyte size (n = 7; P < 0.002). During an 18-wk diet regime (n = 24; mean weight loss 27 kg), the NQO1 expression in human sc AT was down-regulated (P < 0.0001), and mRNA levels correlated with body mass index (P = 0.0005), sc, and total abdominal AT areas, as determined by computerized tomography (P < 0.0001, both) and metabolic parameters. NQO1 mRNA levels were also positively correlated with aspartate aminotransferase (P = 0.0028) and alanine aminotransferase (P = 0.0219), markers known to be associated with severity of hepatic steatosis.

Conclusions: NQO1 is highly expressed in human AT, particularly in large adipocytes. AT NQO1 expression is reduced during diet-induced weight loss, and the expression levels positively correlate with adiposity, glucose tolerance, and markers of liver dysfunction. Together, these findings indicate a role for NQO1 in the metabolic complications of human obesity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
NICOTINAMIDE ADENINE dinucleotide phosphate:quinone oxidoreductase 1 (NQO1) is part of the antioxidant defense system, and has been extensively studied in relation to chemoprotection, cancer susceptibility, and antitumor agents (1). However, studies in mice deficient in NQO1 activity suggest that NQO1 also plays an important role in metabolism. The adult NQO1 knockout mice have markedly reduced abdominal adipose tissue (AT) mass, higher levels of triglycerides (TGs), and lower levels of glucose in the blood compared with wild-type mice. In addition, NQO1–/– mice have higher TG content in the liver compared with wild-type mice (2).

It is well known that NQO1 is involved in the body’s defense system against oxidative stress (1, 2). The enzymatic function of NQO1 is to catalyze the detoxification of quinones and their derivatives, preventing their participation in redox cycling and oxidative stress (2, 3). NQO1 has also attracted attention as a flavoenzyme associated with protection against mutagenesis and carcinogenesis (3, 4). A C609T substitution of the NQO1 gene, which contributes to an amino acid change, results in loss of NQO1 activity in humans (5). This polymorphism varies (range 4–22%) among ethnic groups (1).

NQO1 expression has been detected in many human tissues, and large variation in NQO1 expression and activity has been found (3). Although NQO1 expression has been reported in AT (2, 6) and adipocytes (7), we were surprised to find that NQO1 expression was most abundant in human adipocytes when performing a DNA microarray screen for adipocyte-specific genes (8, 9). The high expression in human adipocytes and the striking effects of NQO1 deficiency on abdominal AT mass in mice suggest a possible role for NQO1 in energy homeostasis and adipocyte function. Consequently, studies on this gene in humans may provide important information on the development of obesity and obesity associated metabolic disease. Because knowledge about the regulation of NQO1 expression in human AT is limited, the aim of this study was to analyze possible expression changes during diet-induced weight loss in obese subjects, possible correlations with parameters associated with metabolic complications of obesity, as well as to examine the expression of this gene in different human tissues, fat depots, and in adipocytes of different size. We also wanted to study if the previously identified C609T polymorphism in the NQO1 gene is associated with obesity and metabolic parameters.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects and samples

Obese subjects were treated with a very low-calorie diet (VLCD) (450 kcal/d, Cambridge diet or Modifast) for 16 wk, before a normal diet was gradually reintroduced. After 16 wk, one VLCD meal a day is replaced by an ordinary meal, and after 17 wk, two meals are replaced by ordinary meals. During wk 17 and 18, the body weight is stabilized. Abdominal sc AT biopsies were obtained before (wk 0), during (wk 8 and 16), and after (wk 18) diet-induced weight loss from 24 obese subjects (6 women and 18 men), and used for expression level analysis by DNA microarray (Table 1Go). Subjects analyzed by DNA microarray displayed a mean weight loss of 27 kg after 18 wk of diet. Abdominal sc AT biopsies were also obtained before (wk 0), during (wk 8), and after (wk 18) diet-induced weight loss from eight healthy obese men [baseline body mass index (BMI) 37 ± 3 kg/m2, mean weight loss 19 ± 9 kg] and used for expression level analysis by real-time PCR. For isolation and separation of small and large adipocytes, sc AT was obtained from six women (BMI 24 ± 2 kg/m2) and three men (BMI 27 ± 1 kg/m2) (10). In brief, adipocytes were isolated by collagenase treatment (11). The cell suspension was gently agitated, and cells that resurfaced within 30 sec were transferred to new tubes; this procedure was repeated once. These more buoyant cells were filtered through a nylon mesh (70 µm), and cells not passing through were considered the final preparation of large adipocytes. The adipocytes that did not resurface within 30 sec were filtered through a nylon mesh (50 µm), and cells passing through were considered the final preparation of small adipocytes (10). To study depot and gender differences, AT biopsies from the abdominal sc depot and the major omentum were obtained from seven obese men (BMI 42 ± 5 kg/m2) (12) and four obese women (BMI 54 ± 13 kg/m2) (8) undergoing laparoscopic bariatric surgery. Analysis of NQO1 expression in adipocytes and the stromal-vascular fraction from AT was performed in four obese subjects (BMI 43 ± 6 kg/m2). Analysis of NQO1 expression in individuals with different BMI was performed in 12 men and 12 women (obese n = 12, BMI range 33.2–51.4 kg/m2; overweight, n = 8, BMI range 25.0–29.0 kg/m2; lean, n = 4, BMI range 23.0–24.9 kg/m2). For genotype analysis, DNA was isolated from blood samples from the Swedish obese subjects (SOS) reference study (13) (189 lean, 131 healthy obese, and 250 dysmetabolic obese subjects) according to the adult treatment panel III (14). For verification, two additional populations were used: the (INTERGENE) case-control study (642 subjects with coronary artery disease and 642 healthy controls) (15); and the Dallas Heart Study (16, 17) (1830 African-Americans, 601 Hispanics, and 1045 European Americans). Regional Ethical Review Boards approved the studies, and all participants gave written informed consent. Characteristics of the cohorts used for genotyping are shown in Table 2Go.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Characteristics of the patients included in the VLCD study and association of NQO1 expression, analyzed by DNA microarray, with anthropometric measurements and metabolic parameters during diet-induced weight loss

 

View this table:
[in this window]
[in a new window]

 
TABLE 2. Characteristics of the patients used for the genotyping studies

 
RNA and DNA samples, and DNA microarray expression profiles

RNA was isolated as described by Chomczynski and Sacchi (18), and further purified with RNeasy clean-up columns (QIAGEN, Hilden, Germany) or using the RNeasy Lipid Tissue Kit (QIAGEN). The gene expression in AT depots, AT during diet-induced weight loss, and in adipocytes of different sizes have previously been analyzed using DNA microarray (Affymetrix, Santa Clara, CA) (8, 10, 12). Real-time PCR was used to confirm the results. For verification of the gene expression in different human tissues by real-time PCR, RNA from the Human Total RNA Master Panel II (CLONTECH, Palo Alto, CA) was used. Genomic DNA was isolated using a standard proteinase K DNA isolation protocol, FlexiGene DNA kit (QIAGEN), or Pure Gene (Gentra Systems, Minneapolis, MN).

Measurements

Computerized tomography (CT) was used to determine body composition before (wk 0) and during (wk 16) the VLCD treatment, as previously described (12). CT or proton nuclear magnetic resonance spectroscopy (MRS) (16) was used to determine hepatic fat content using attenuation and signal intensity values, respectively. Fasting glucose and insulin, oral glucose tolerance test (OGTT) glucose and insulin, TG, high-density lipoprotein (HDL), low-density lipoprotein (LDL), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) were analyzed at the Department of Clinical Chemistry, Sahlgrenska University Hospital (accredited according to the international standard ISO/IEC 17025).

Real-time PCR analysis

Reagents for real-time PCR analysis of NQO1 and peptidyl-prolyl isomerase A (PPIA) (cyclophilin A) (Assays-on-Demand, TaqMan Reverse Transcriptase reagents and TaqMan Universal PCR Master mix) were purchased from Applied Biosystems (Foster City, CA) and used according to the manufacturer’s protocol. cDNA synthesis was performed in a total volume of 50 µl using 500-ng total RNA. cDNA corresponding to 10 ng RNA per reaction was used for real-time PCR amplification and detection in the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) using default cycle parameters. A standard curve was plotted for each primer-probe set with a serial dilution of pooled AT cDNA. Human PPIA was used as a reference gene.

Genotyping

Primers and probes (primers; forward: 5'–GGGCGTCTGCTGGAGTGT, reverse: 5'–CCTCAGAGTGGCATTCTGCAT and probes; 5' VIC–ATGTCAGTTGAGGTTC–MGB, 5' FAM–ATGTCAGTTGAGATTC–MGB) for the NQO1 polymorphism C609T (rs1800566) were designed by Applied Biosystems. Primers, probes and TaqMan Universal PCR Master mix were purchased from Applied Biosystems and used according to the manufacturer’s protocol. The ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) was used for amplification and detection.

Statistical analysis

Values are expressed as mean ± SD unless otherwise stated. Difference in NQO1 expression between small and large adipocytes was analyzed using the Wilcoxon signed rank test. Difference in NQO1 expression between adipocyte and the stromal-vascular fraction was analyzed using the Mann-Whitney U test. The relationship between NQO1 gene expression and adipocyte size, as well as NQO1 expression and BMI was analyzed using the Spearman rank correlation test. Differences between TG levels and waist-to-hip ratio (WHR) by NQO1 genotype in the SOS reference study were analyzed using Student’s t test. Kruskal-Wallis or ANOVA was used for genotype association analysis in the INTERGENE and Dallas Heart Study populations.

The analyses of NQO1 gene expression, presented in Table 1Go, were initially performed with standard linear regression. Correlation of within-person longitudinal measurements was addressed with the use of generalized estimating equations (19). Tests of parameters within these models were performed with generalized Wald tests (20), which yielded standard Z statistics. We fit a common slope across the different weeks, which is presented in Table 1Go, but allowed for different intercept terms corresponding to week-specific levels of NQO1. Because the data were skewed, logarithmic transformations were applied to the various NQO1 variables and predictors. An exact binomial test was used to assess down-regulation. Down-regulation will be significant if most subjects have the highest expression level at wk 0. If the expression levels are equal across the weeks, no down-regulation will be detected. We used an {alpha} of 0.05 to assess significance of the various tests.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Expression of NQO1 in human tissues and AT depots

In previous studies we searched for genes that are predominantly expressed in human adipocytes using gene expression profiles generated by DNA microarray from adipocytes, and 32 other human tissues and cell types (8, 9). We showed that NQO1 was highly expressed in both human omental and sc adipocytes. The DNA microarray data indicated that NQO1 expression was highest in adipocytes and that trachea was the tissue with the second highest expression (Fig. 1AGo). To verify the results, we measured NQO1 expression by real-time PCR in human adipocytes and in a panel of 17 human tissues (Fig. 1BGo). The results confirmed the high expression in omental and sc adipocytes, although trachea and stomach had similar expression levels. To verify that NQO1 expression originates in the adipocyte fraction of AT, real-time PCR analysis on RNA from adipocytes and the stromal-vascular fraction was performed in four subjects. The results showed that adipocytes expressed over 4 times higher levels of NQO1 mRNA (Fig. 1CGo; P < 0.016). When performing the adipocyte isolation procedure, the stromal-vascular fraction will not be completely free from adipocytes. Therefore, contaminating adipocytes may be the reason for detectable levels in this fraction. We also compared NQO1 expression in paired AT biopsies from the sc and omental depots. However, the expression did not differ significantly between the two depots or between genders (data not shown).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 1. The relative expression of NQO1 as analyzed by U95A DNA microarray in sc (A sc) and omental adipocytes (A om), as well as trachea, the tissue with the second highest expression (A). Values correspond to the 38066_at probe set. NQO1 expression in a panel of 17 human tissues and cell types in addition to sc and omental adipocytes (black bars) analyzed by real-time PCR (B). NQO1 expression (mean ± SEM) in human adipocytes and stromal-vascular cells (SVC) (C).

 
Expression of NQO1 in lean, overweight, and obese subjects

RNA was isolated from AT biopsies from 12 obese, eight overweight, and four lean individuals (Fig. 2Go). The NQO1 expression was clearly correlated with BMI (r = 0.582; P = 0.03).


Figure 2
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 2. The expression of NQO1 (mean ± SEM) in AT from obese (n = 12), overweight (n = 8), and lean (n = 4) subjects. BMI was correlated with NQO1 expression (P = 0.003).

 
Expression of NQO1 in small and large adipocytes

Adipocytes isolated from human ATs biopsies were separated into populations of small and large cells (10). The NQO1 expression was 3.7-fold higher in large (99.4 ± 13.8 µm) compared with small (60.7 ± 10.7 µm) adipocytes in three paired samples analyzed by DNA microarray (10). The higher expression in large adipocytes was confirmed in adipocyte populations from seven subjects using real-time PCR. In all cases, NQO1 was expressed at higher levels in the large adipocytes (P = 0.0176), with a mean fold increase of 4.4 ± 3.2 compared with the expression in small adipocytes. In addition, there was a positive correlation between the NQO1 gene expression and adipocyte diameter (r = 0.763; P = 0.002; Fig. 3Go).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 3. NQO1 gene expression in small and large human adipocytes, isolated from a single biopsy (n = 7). Closed circles represent small adipocytes and open boxes large adipocytes. NQO1 gene expression was correlated with adipocyte size when analyzed by real-time PCR (P = 0.002).

 
Effect of weight loss on NQO1 expression in sc AT

To study the effects of weight loss, NQO1 mRNA expression was analyzed in sc AT from obese subjects before (wk 0), during (wk 8 and/or 16), and after (wk 18) VLCD treatment. The NQO1 mRNA levels were reduced during the diet-induced weight loss according to both the DNA microarray (P < 0.0001; Fig. 4AGo) and real-time PCR (P = 0.002; Fig. 4BGo) data.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 4. Effect of diet-induced weight loss on NQO1 gene expression in sc AT during VLCD. mRNA expression levels analyzed by U133A DNA microarray (A). Values correspond to the 201468_s_at probe set. The NQO1 expression was significantly down-regulated during the diet-induced weight loss (P < 0.0001; n = 24). The down-regulation of NQO1 expression was confirmed using real-time PCR (P = 0.002; n = 8), mean ± SEM (B). Note that NQO1 expression was significantly down-regulated both between baseline and 8 wk (P < 0.0001), and between 8 and 16 wk (P = 0.0017) when analyzed by DNA microarray.

 
Association of NQO1 expression with anthropometric measurements and metabolic parameters during diet-induced weight loss

Our observation that NQO1 is highly expressed in adipocytes, together with the down-regulation of NQO1 expression during diet-induced weight loss, led us to examine correlations between NQO1 expression and body composition, as well as metabolic parameters. These results are summarized in Table 1Go. The NQO1 mRNA levels positively correlated with total and sc abdominal AT area, as well as BMI during diet-induced weight loss. The NQO1 expression was also positively correlated with fasting insulin, as well as to levels of insulin and glucose during OGTT. NQO1 expression levels did not correlate significantly with levels of HDL, LDL, or TG. After adjustment for changes in BMI, NQO1 expression levels remained correlated with fasting levels of glucose as well as OGTT glucose and insulin, but not to fasting levels of insulin (Table 1Go).

NQO1 expression and hepatic function during diet-induced weight loss

It is well established that obesity is associated with the deposition of TG in the liver and nonalcoholic fatty liver disease (21). In mice deficient in NQO1, the TG concentration in the liver is markedly increased (2). Excessive TG accumulation in the liver has recently been the focus as a mediator of the metabolic complications seen in obese subjects (22). Therefore, we studied NQO1 expression in relation to markers of hepatic function in the subjects treated with VLCD. Positive correlations were seen between NQO1 expression and two markers of liver dysfunction (23): AST (P = 0.0028) and ALT (P = 0.0219) (Table 1Go). However, no correlation was seen between NQO1 expression and liver attenuation analyzed by CT (P = 0.2884). After adjustment for changes in BMI during diet-induced weight loss, NQO1 expression levels were correlated with AST levels, but not with levels of ALT (Table 1Go).

Associations between the NQO1 single nucleotide polymorphism (SNP) and metabolic parameters

A SNP in the coding region of NQO1 has previously been characterized (5). The polymorphism is a C to T substitution at position 609 of the NQO1 gene and results in a proline to serine change at position 187 of the NQO1 protein. Individuals heterozygous for the T allele display significantly lower NQO1 protein levels, and individuals homozygous for the T allele have no detectable levels of NQO1 protein (5). In subgroups from the SOS reference study population, we found an association between the non-CC genotype and lower WHR in healthy obese subjects (n = 131; P = 0.003), and an association between the non-CC genotype and higher serum TG levels in obese subjects with metabolic disease (n = 250; P = 0.049). However, we were not able to verify the associations between genotype and the parameters mentioned previously, or in the INTERGENE or Dallas Heart Study populations, which include both obese and nonobese subjects. In the INTERGENE study, no associations were found between NQO1 genotype and BMI, WHR, blood pressure, serum glucose, cholesterol, TG, HDL, or LDL in the complete patient material. No difference in genotype frequency was found between the case and control groups. In the Dallas Heart Study, no associations were found between NQO1 genotype and BMI, AT mass, blood pressure, serum glucose, serum insulin, cholesterol, TG, HDL, LDL, or hepatic TG content in either of the ethnic groups, regardless of gender. We found a TT genotype frequency of 1.75% in the SOS reference study, 2.41% in the INTERGENE study, and 3.4%, 4.7%, and 12.4%, respectively, in the European American, African-American, and Hispanic populations included in the Dallas Heart Study. These results are comparable with the ones previously reported (1).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Obesity is often accompanied by complications such as type 2 diabetes, hypertension, hyperlipidemia, hypercholesterolemia, and cardiovascular disease (24), as well as hepatic steatosis (21). Short-term studies on intentional weight loss have shown drastic improvement in all aspects of the metabolic syndrome (24), including improved glycemic control, decreased blood pressure, and reduced cholesterol levels. Furthermore, weight loss is associated with a decrease in liver TG content (25). In the present study we demonstrate that NQO1 is expressed at high levels in human adipocytes, and that the mRNA levels in AT during diet-induced weight loss are significantly correlated with several anthropometric measurements of obesity, AT depot size, measurements of glucose tolerance, and markers known to be associated with severity of hepatic steatosis.

It is known that adipocyte function and gene expression differ in adipocytes of different sizes (10, 26, 27). In this study all subjects analyzed had higher expression of NQO1 in large compared with small adipocytes. Enlargement of sc adipocytes is associated with insulin resistance, and the risk of metabolic complications increases with increasing adipocyte size (28). Furthermore, it has been shown that oxidative stress impairs insulin action in adipocytes in vitro (29) and that hyperglycemia leads to the generation of reactive oxygen species, resulting in oxidative stress in different tissues (30, 31). Dandona et al. (32) have reported that the oxidative damage to lipids, proteins, and amino acids is increased in obese subjects and that this damage is reduced by weight loss. However, it is not completely understood how obesity or metabolic disorders may cause oxidative stress. Whether NQO1 is a marker for oxidative stress and/or adipose dysfunction is unknown, but the data presented here indicate that enlargement of adipocytes is associated with increased oxidative stress in AT.

It has also been shown that obesity results in dysregulation of adipokines and a state of low-grade chronic inflammation (33). It is known that AT secretes a variety of inflammatory cytokines such as TNF-{alpha} and IL-6 (34), as well as acute phase proteins (8). Furthermore, AT contains many cell types other than adipocytes, such as fibroblasts, endothelial cells, leukocytes, monocytes, and macrophages, that together constitute the stromal-vascular fraction. Macrophages secrete pro-inflammatory cytokines, opening up the possibility for adipocyte and macrophage crosstalk (34) that may have an effect on NQO1 expression.

Several metabolic pathways are altered in NQO1 knockout mice. These mice are also suggested to be insulin resistant (2), which is somewhat surprising because reduced abdominal AT mass is usually associated with higher insulin sensitivity, at least in humans (24). However, extreme loss of AT, seen in patients who have lipodystrophy, results in insulin resistance (35). This indicates that an optimal level of AT mass gives the optimal insulin sensitivity. The knockout study suggests that NQO1 has important effects on fat storage and metabolism, at least in mice. In our study NQO1 expression in human sc AT was positively correlated with insulin levels, as well as OGTT levels of glucose and insulin. In contrast, no correlation was seen with levels of TG and glucose during diet-induced weight loss.

The human NQO1 C609T polymorphism causes variation in NQO1 protein levels (5), and NQO1 deficient mice have highly reduced abdominal AT mass (2). In line with this, we found that the non-CC genotype was associated with a lower WHR in a population of healthy obese subjects and with high TG levels in a population of dysmetabolic obese subjects. However, we were not able to find any associations in the complete study population, and we could not repeat these results in two other larger populations. Furthermore, in a recent Chinese case-control study (36) (mean BMI 25), no association was identified between the NQO1 polymorphism and type 2 diabetes.

NQO1–/– mice also display increased TG content in the liver (2), i.e. hepatic steatosis (21). Hepatic steatosis affects approximately 30 million Americans (21) and is almost always present in obese persons with high alcohol consumption. However, hepatic steatosis is more strongly associated with accumulation of excess body fat than with high alcohol intake. A recent study (37) indicates that abdominal fat accumulation, a risk factor of the metabolic syndrome, may be an independent predictor of hepatic steatosis (38). We found significant positive correlations between NQO1 mRNA levels and markers known to be associated with the severity of hepatic steatosis (ALT, AST) during diet-induced weight loss in obese subjects. However, no significant correlations were seen between NQO1 and the amount of hepatic fat in the VLCD study (expression; CT) or the Dallas Heart Study (genotype; MRS). The reason for this finding is unknown, but ALT and AST are markers for liver dysfunction, including steatosis, whereas CT (39) or, in particular, MRS (40) determination of hepatic fat content is more precise. Thus, it may be speculated that AT NQO1 expression may be related to some factor, other than fat accumulation, involved in liver dysfunction.

In conclusion, we have found that NQO1 is highly expressed in human adipocytes, and that there is a positive correlation between NQO1 expression and adipocyte size. Furthermore, NQO1 mRNA levels drastically decrease in AT during diet-induced weight loss and are highly correlated with metabolic parameters. Our findings, together with previous results from knockout studies in mice, support a link between NQO1 mRNA expression in AT and the metabolic complications of human obesity.


    Acknowledgments
 
We thank members of our research group for fruitful discussions; Anne Ridger, Rahil Hezaveh, and Camilla Glad for technical assistance; Louise Olofsson for discussions on SNP analysis; John Brandberg, Jan-Erik Angelhed, Lena Strid, and Eva Bergelin for performing and interpreting the CT data; and Dag S. Thelle and Helen H. Hobbs for kindly letting us analyze the NQO1 SNP in the INTERGENE and Dallas Heart Study patient materials.


    Footnotes
 
This work was supported by grants from The Swedish Research Council (11285, 14735, 529-2002-6671, and 521-2002-6536), the National Board of Health and Welfare, the Swedish Diabetes Foundation, the Sahlgrenska University Hospital Foundation, the IngaBritt and Arne Lundberg Research Foundation, the Fredrik and Ingrid Thuring Foundation, the Magn. Bergvall Foundation, the Tore Nilson Foundation for Medical Research, the Wilhelm och Martina Lundgren Science Foundation, the Adlerbertska Research Foundation, the Göteborg Medical Society, the Swedish Foundation for Strategic Research, and the Swedish Federal Government under the LUA/ALF agreement.

Disclosure Statement: J.P., M.J., A.G., and S.R. have nothing to declare. K.S. has equity interests in AstraZeneca AB and Pfizer AB. T.C.L. has equity interests in Amgen and AstraZeneca AB and is employed by AstraZeneca AB. L.L. and M.L. consult for Abbott, Mentice, and Johnson & Johnson, and received lecture fees from Medtronic, Biotronic, and Bard. B.C. has equity interests in Sahltech AB and AstraZeneca AB, and is employed by AstraZeneca AB. L.M.S.C. has equity interests in Progenit AB and Sahltech AB, and consults for AstraZeneca AB.

First Published Online April 3, 2007

1 J.P. and K.S. contributed equally. Back

Abbreviations: ALT, Alanine aminotransferase; AST, aspartate aminotransferase; AT, adipose tissue; BMI, body mass index; CT, computerized tomography; HDL, high-density lipoprotein; LDL, low-density lipoprotein; MRS, magnetic resonance spectroscopy; NQO1, quinone oxidoreductase 1; OGTT, oral glucose tolerance test; PPIA, peptidyl-prolyl isomerase A; SNP, single nucleotide polymorphism; SOS, Swedish obese subjects; TG, triglyceride; VLCD, very low-calorie diet; WHR, waist-to-hip ratio.

Received November 10, 2006.

Accepted March 26, 2007.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Ross D, Kepa JK, Winski SL, Beall HD, Anwar A, Siegel D 2000 NAD(P)H:quinone oxidoreductase 1 (NQO1): chemoprotection, bioactivation, gene regulation and genetic polymorphisms. Chem Biol Interact 129:77–97[CrossRef][Medline]
  2. Gaikwad A, Long II DJ, Stringer JL, Jaiswal AK 2001 In vivo role of NAD(P)H:quinone oxidoreductase 1 (NQO1) in the regulation of intracellular redox state and accumulation of abdominal adipose tissue. J Biol Chem 276:22559–22564[Abstract/Free Full Text]
  3. Joseph P, Xie T, Xu Y, Jaiswal AK 1994 NAD(P)H:quinone oxidoreductase1 (DT-diaphorase): expression, regulation, and role in cancer. Oncol Res 6:525–532[Medline]
  4. Benson AM, Hunkeler MJ, Talalay P 1980 Increase of NAD(P)H:quinone reductase by dietary antioxidants: possible role in protection against carcinogenesis and toxicity. Proc Natl Acad Sci USA 77:5216–5220[Abstract/Free Full Text]
  5. Siegel D, McGuinness SM, Winski SL, Ross D 1999 Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics 9:113–121[Medline]
  6. Martin LF, Patrick SD, Wallin R 1987 DT-diaphorase in morbidly obese patients. Cancer Lett 36:341–347[CrossRef][Medline]
  7. Siegel D, Franklin WA, Ross D 1998 Immunohistochemical detection of NAD(P)H:quinone oxidoreductase in human lung and lung tumors. Clin Cancer Res 4:2065–2070[Abstract]
  8. Sjöholm K, Palming J, Olofsson LE, Gummesson A, Svensson PA, Lystig TC, Jennische E, Brandberg J, Torgerson JS, Carlsson B, Carlsson LM 2005 A microarray search for genes predominantly expressed in human omental adipocytes: adipose tissue as a major production site of serum amyloid A. J Clin Endocrinol Metab 90:2233–2239[Abstract/Free Full Text]
  9. Sjöholm K, Palming J, Lystig TC, Jennische E, Woodruff TK, Carlsson B, Carlsson LM 2006 The expression of inhibin beta B is high in human adipocytes, reduced by weight loss, and correlates to factors implicated in metabolic disease. Biochem Biophys Res Commun 344:1308–1314[CrossRef][Medline]
  10. Jernås M, Palming J, Sjöholm K, Jennische E, Svensson PA, Gabrielsson BG, Levin M, Sjögren A, Rudemo M, Lystig TC, Carlsson B, Carlsson LM, Lönn M 2006 Separation of human adipocytes by size: hypertrophic fat cells display distinct gene expression. FASEB J 20:1540–1542[Abstract/Free Full Text]
  11. Smith U, Sjöström L, Björntorp P 1972 Comparison of two methods for determining human adipose cell size. J Lipid Res 13:822–824[Abstract]
  12. Gabrielsson BG, Johansson JM, Jennische E, Jernås M, Itoh Y, Peltonen M, Olbers T, Lönn L, Lönroth H, Sjöström L, Carlsson B, Carlsson LM, Lönn M 2002 Depot-specific expression of fibroblast growth factors in human adipose tissue. Obes Res 10:608–616[Medline]
  13. Sjöström L, Larsson B, Backman L, Bengtsson C, Bouchard C, Dahlgren S, Hallgren P, Jonsson E, Karlsson J, Lapidus L, Lindroos A-K, Lindstedt S, Lissner L, Narbro K, Näslund I, Olbe L, Sullivan M, Sylvan A, Wedel H, Ågren G 1992 Swedish obese subjects (SOS). Recruitment for an intervention study and a selected description of the obese state. Int J Obes Relat Metab Disord 16:465–479[Medline]
  14. Eckel RH, Grundy SM, Zimmet PZ 2005 The metabolic syndrome. Lancet 365:1415–1428[CrossRef][Medline]
  15. Berg CM, Lissner L, Aires N, Lappas G, Toren K, Wilhelmsen L, Rosengren A, Thelle DS 2005 Trends in blood lipid levels, blood pressure, alcohol and smoking habits from 1985 to 2002: results from INTERGENE and GOT-MONICA. Eur J Cardiovasc Prev Rehabil 12:115–125[CrossRef][Medline]
  16. Browning JD, Szczepaniak LS, Dobbins R, Nuremberg P, Horton JD, Cohen JC, Grundy SM, Hobbs HH 2004 Prevalence of hepatic steatosis in an urban population in the United States: impact of ethnicity. Hepatology 40:1387–1395[CrossRef][Medline]
  17. Victor RG, Haley RW, Willett DL, Peshock RM, Vaeth PC, Leonard D, Basit M, Cooper RS, Iannacchione VG, Visscher WA, Staab JM, Hobbs HH 2004 The Dallas Heart Study: a population-based probability sample for the multidisciplinary study of ethnic differences in cardiovascular health. Am J Cardiol 93:1473–1480[CrossRef][Medline]
  18. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  19. Zeger SL, Liang KY 1986 Longitudinal data analysis for discrete and continuous outcomes. Biometrics 42:121–130[CrossRef][Medline]
  20. Rotnitzky A, Jewell NP 1990 Hypothesis testing of regression parameters in semiparametric generalized linear models for cluster correlated data. Biometrika 77:485–497[Abstract/Free Full Text]
  21. Browning JD, Horton JD 2004 Molecular mediators of hepatic steatosis and liver injury. J Clin Invest 114:147–152[CrossRef][Medline]
  22. Marchesini G, Marzocchi R, Agostini F, Bugianesi E 2005 Nonalcoholic fatty liver disease and the metabolic syndrome. Curr Opin Lipidol 16:421–427[Medline]
  23. Eguchi Y, Eguchi T, Mizuta T, Ide Y, Yasutake T, Iwakiri R, Hisatomi A, Ozaki I, Yamamoto K, Kitajima Y, Kawaguchi Y, Kuroki S, Ono N 2006 Visceral fat accumulation and insulin resistance are important factors in nonalcoholic fatty liver disease. J Gastroenterol 41:462–469[CrossRef][Medline]
  24. Goldstein DJ 1992 Beneficial health effects of modest weight loss. Int J Obes Relat Metab Disord 16:397–415[Medline]
  25. Nomura F, Ohnishi K, Ochiai T, Okuda K 1987 Obesity-related nonalcoholic fatty liver: CT features and follow-up studies after low-calorie diet. Radiology 162:845–847[Abstract/Free Full Text]
  26. Björntorp P, Sjöström L 1972 The composition and metabolism in vitro of adipose tissue fat cells of different sizes. Eur J Clin Invest 2:78–84[Medline]
  27. Farnier C, Krief S, Blache M, Diot-Dupuy F, Mory G, Ferre P, Bazin R 2003 Adipocyte functions are modulated by cell size change: potential involvement of an integrin/ERK signalling pathway. Int J Obes Relat Metab Disord 27:1178–1186[CrossRef][Medline]
  28. Weyer C, Foley JE, Bogardus C, Tataranni PA, Pratley RE 2000 Enlarged subcutaneous abdominal adipocyte size, but not obesity itself, predicts type II diabetes independent of insulin resistance. Diabetologia 43:1498–1506[CrossRef][Medline]
  29. Rudich A, Kozlovsky N, Potashnik R, Bashan N 1997 Oxidant stress reduces insulin responsiveness in 3T3–L1 adipocytes. Am J Physiol 272:E935–E940
  30. Urakawa H, Katsuki A, Sumida Y, Gabazza EC, Murashima S, Morioka K, Maruyama N, Kitagawa N, Tanaka T, Hori Y, Nakatani K, Yano Y, Adachi Y 2003 Oxidative stress is associated with adiposity and insulin resistance in men. J Clin Endocrinol Metab 88:4673–4676[Abstract/Free Full Text]
  31. Evans JL, Goldfine ID, Maddux BA, Grodsky GM 2002 Oxidative stress and stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr Rev 23:599–622[Abstract/Free Full Text]
  32. Dandona P, Mohanty P, Ghanim H, Aljada A, Browne R, Hamouda W, Prabhala A, Afzal A, Garg R 2001 The suppressive effect of dietary restriction and weight loss in the obese on the generation of reactive oxygen species by leukocytes, lipid peroxidation, and protein carbonylation. J Clin Endocrinol Metab 86:355–362[Abstract/Free Full Text]
  33. Dandona P, Aljada A, Bandyopadhyay A 2004 Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 25:4–7[CrossRef][Medline]
  34. Sell H, Dietze-Schroeder D, Eckel J 2006 The adipocyte-myocyte axis in insulin resistance. Trends Endocrinol Metab 17:416–422[CrossRef][Medline]
  35. Garg A 2004 Acquired and inherited lipodystrophies. N Engl J Med 350:1220–1234[Free Full Text]
  36. Wang G, Zhang L, Li Q 2006 Genetic polymorphisms of GSTT1, GSTM1, and NQO1 genes and diabetes mellitus risk in Chinese population. Biochem Biophys Res Commun 341:310–313[CrossRef][Medline]
  37. Björntorp P 1991 Metabolic implications of body fat distribution. Diabetes Care 14:1132–1143[Abstract]
  38. Stranges S, Dorn JM, Muti P, Freudenheim JL, Farinaro E, Russell M, Nochajski TH, Trevisan M 2004 Body fat distribution, relative weight, and liver enzyme levels: a population-based study. Hepatology 39:754–763[CrossRef][Medline]
  39. Ricci C, Longo R, Gioulis E, Bosco M, Pollesello P, Masutti F, Croce LS, Paoletti S, de Bernard B, Tiribelli C, Dalla Palma L 1997 Noninvasive in vivo quantitative assessment of fat content in human liver. J Hepatol 27:108–113[CrossRef][Medline]
  40. Longo R, Pollesello P, Ricci C, Masutti F, Kvam BJ, Bercich L, Croce LS, Grigolato P, Paoletti S, de Bernard B, Tiribelli C, Dalla Palma L 1995 Proton MR spectroscopy in quantitative in vivo determination of fat content in human liver steatosis. J Magn Reson Imaging 5:281–285[Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
A. Saiki, M. Olsson, M. Jernas, A. Gummesson, P. G. McTernan, J. Andersson, P. Jacobson, K. Sjoholm, B. Olsson, S. Yamamura, et al.
Tenomodulin Is Highly Expressed in Adipose Tissue, Increased in Obesity, and Down-Regulated during Diet-Induced Weight Loss
J. Clin. Endocrinol. Metab., October 1, 2009; 94(10): 3987 - 3994.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. H. Hwang, D. W. Kim, E. J. Jo, Y. K. Kim, Y. S. Jo, J. H. Park, S. K. Yoo, M. K. Park, T. H. Kwak, Y. L. Kho, et al.
Pharmacological Stimulation of NADH Oxidation Ameliorates Obesity and Related Phenotypes in Mice
Diabetes, April 1, 2009; 58(4): 965 - 974.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Gummesson, M. Jernas, P.-A. Svensson, I. Larsson, C. A. M. Glad, E. Schele, L. Gripeteg, K. Sjoholm, T. C. Lystig, L. Sjostrom, et al.
Relations of Adipose Tissue CIDEA Gene Expression to Basal Metabolic Rate, Energy Restriction, and Obesity: Population-Based and Dietary Intervention Studies
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4759 - 4765.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palming, J.
Right arrow Articles by Carlsson, L. M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palming, J.
Right arrow Articles by Carlsson, L. M. S.
Related Collections
Right arrow Diabetes and Insulin
Right arrow Metabolism
Right arrow Obesity


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals