| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinic of Obstetrics and Gynecology (M.G., U.H., U.L., G.D., C.W.), Medical University of Graz, 8036 Graz, Austria; Institute of Cell Biology, Histology and Embryology (M.G., A.B.), Center of Molecular Medicine, and Institute of Molecular Biology and Biochemistry (S.F.), Center of Molecular Medicine, Medical University of Graz, 8010 Graz, Austria; and Institute of Obstetrics and Gynecology (G.A., I.C.), Foundation Instituto di Ricovero e Cura a Carattere Scientifico Policlinico, Mangiagalli and Regina Elena, University of Milano, 20122 Milano, Italy
Address all correspondence and requests for reprints to: Martin Gauster, Institute of Histology, Cell Biology, and Embryology, Center of Molecular Medicine, Medical University of Graz, Harrachgasse 21/VII, 8010 Graz, Austria. E-mail: martin.gauster{at}meduni-graz.at.
| Abstract |
|---|
|
|
|---|
Objective: The objective of the study was to test the hypothesis that members of the triglyceride lipase gene (TLG) family are expressed in the human placenta at the maternoplacental (syncytiotrophoblast) and fetoplacental (endothelial cells) interface and that their expression is altered in pregnancy pathologies.
Design and Setting: Expression of TLG family members in primary placental cells (trophoblast and endothelial cells) and tissues of first-trimester and term human placenta was analyzed by microarrays, RT-PCR, Western blotting, and immunohistochemistry. Their expression was compared between normal pregnancies and those complicated with intrauterine growth restriction (IUGR).
Participants: Participants included women with uncomplicated pregnancies and pregnancies complicated by IUGR.
Results: Endothelial lipase (EL) and lipoprotein lipase (LPL) were the only lipases among the TLG family expressed in key cells of the human placenta. In first trimester, EL and LPL were expressed in trophoblasts. At term, EL was detected in trophoblasts and endothelial cells, whereas LPL was absent in these cells. Both lipases were found at placental blood vessels, EL in vascular endothelial cells and LPL in the surrounding smooth muscle cells. In total placental tissue EL expression prevails in first trimester and at term. Compared with normal placentas, EL mRNA was decreased (30%; P < 0.02), whereas LPL mRNA expression was increased (2.4-fold; P < 0.015) in IUGR.
Conclusion: EL is the predominant TLG family member in the human placenta present at both interfaces. EL and LPL are dysregulated in IUGR.
| Introduction |
|---|
|
|
|---|
The TLG family comprises secreted lipases that hydrolyze triglycerides and phospholipids. This gene family encodes hepatic lipase (HL) (1), endothelial lipase (EL) (2, 3), lipase H (4), lipoprotein lipase (LPL) (5), pancreatic lipase (PL) (6), pancreatic lipase-related protein-1 (7), pancreatic lipase-related protein-2 (8) and phosphatidylserine-specific phospholipase A1 (9). The best studied members among the TLG family are EL, HL, LPL and PL, which have established roles in human lipoprotein metabolism. They share high sequence homologies and conserved domains. As shown by phylogenetic alignments, the primary amino acid sequence of EL has homologies with LPL (44%), HL (41%), and PL (27%) (3). Despite their extensive sequence identity, they display in part different substrate specificity. LPL hydrolyzes triglycerides of triglyceride-enriched lipoproteins like chylomicrons, very low-density lipoproteins, and intermediate-density lipoprotein (10), whereas the phospholipase activity of LPL is relatively low (11). In contrast to LPL, HL hydrolyzes triglycerides as well as phospholipids of remnant lipoproteins and high-density lipoprotein in the liver (12). EL is primarily a phospholipase with high levels of phospholipase A1 activity and a restricted ability to release sn-2 bound unsaturated fatty acids from phospholipids (13). Triglyceride lipase activity of EL exists but is rather low, compared with that of LPL (11). The main substrates of EL are phospholipids derived from HDL and to a minor extent apolipoprotein B-containing lipoproteins (11). PL is involved in dietary lipid absorption, hydrolyzing dietary long-chain triacylglycerol to FFAs and monoacylglycerols in the intestinal lumen.
TLG family lipases are secreted glycoproteins, which are anchored to the surface of epithelial cells via heparan sulfate proteoglycans (HSPGs) (14, 15, 16, 17). This anchoring brings them into close contact with passing lipoproteins and allows them to mediate bridging between the cell surface and the lipoproteins. By their phospholipase and triglyceride lipase activity, respectively, they hydrolyze fatty acids from bridged lipoproteins. The FFAs in turn are taken up by the surrounding tissue in which they contribute to the intracellular fatty acid pool after incorporation into cellular lipids. The FFA proportion not used for reesterification mainly acts as an energy source for ß-oxidation.
Among all species the human fetus is characterized by the highest proportion of fat, most of which is accrued during the third trimester of gestation. Fetal growth abnormalities associated with fetal underweight, as in intrauterine growth restriction (IUGR) (18), is predominantly associated with changes in fetal fat mass. Despite some de novo synthesis of fatty acids in the fetus, the placenta is highly capable of fatty acid supply foremost in the form of FFAs. Available evidence suggests a significant contribution of maternal adipose tissue to transplacental transport of lipids (19). The pronounced fetal demand for FFAs and other precursor lipids during development requires an appropriate set of enzymes capable of lipolysis that needs to be located at the maternal-fetal interface.
The aim of this study was to test the hypothesis that TLG family members are expressed in the human placenta at the maternoplacental (syncytiotrophoblast) and fetoplacental [endothelial cells (ECs)] interface and that their expression is associated with fetal growth. To this end, major members of the TLG family were identified and localized in normal placentas, and their expression levels were compared with those of pregnancies complicated by IUGR.
| Patients and Methods |
|---|
|
|
|---|
The study was approved by the ethical committees of the Medical University of Graz and the Medical Faculty, University of Milano. Informed consent was obtained from the patients. First-trimester placentas were obtained from pregnancy terminations for psychosocial reasons. Tissue samples were collected in Medium 199 supplemented with penicillin/streptomycin (Life Technologies, Inc., Invitrogen, Carlsbad, CA), washed immediately in PBS, and snap frozen. Term placentas, delivered vaginally after uncomplicated pregnancy, were collected on ice and appropriate tissue samples were snap frozen.
Placental tissue from IUGR
Placenta tissue was obtained from appropriate for gestational age (AGA), and IUGR pregnancies. The characteristics of the study subjects are summarized in Table 3
. Babies with morphological malformations at birth and/or chromosomal abnormalities were excluded from the study. Control patients had an ultrasound scan at 3032 wk of gestation that confirmed a normal pattern of fetal growth and gave birth to healthy term neonates with a birth weight between the 10th and 90th percentile according to Italian standards (20). IUGR was defined on the basis of ultrasound measurements (21). Tissue sampling sites were within 3 cm of the cord insertion site or within 1 cm of the placental margin. After washing in PBS, they were stored at 80 C within 30 min.
|
First-trimester trophoblasts (FTs) were isolated from placental tissue as described previously (22, 23). Term trophoblasts (TTs) and ECs were isolated from term placentas following standard protocols (22, 23). For some experiments extravillous trophoblasts were enriched by immunoselection on the basis of their human leukocyte antigen class IbG (HLA-G) expression. The isolated pool of FTs was incubated with magnetic microbeads coated with anti-HLA-G antibody (MEM-G/9; EXBIO, Praha, Czech Republic) for 15 min at room temperature. Extravillous trophoblast cells, expressing HLA-G, were subsequently separated from villous trophoblasts, lacking HLA-G, by applying a magnet along the vial.
Culture of isolated human trophoblasts and placental ECs
FTs and TTs were cultured in DMEM (Life Technologies) with 10% fetal calf serum (vol/vol), 100 mg/ml streptomycin, and 100 IU/ml penicillin (Life Technologies). A representative proportion of trophoblasts was characterized by immunocytochemistry (22, 23, 24). Trophoblast viability was monitored by daily measurements of human chorionic gonadotropin hormone levels (25). Only preparations of 99% or greater purity were used for expression studies.
ECs were cultured in endothelial basal medium (Clonetics, Cambrex, Walkersville, MD) supplemented with the EGM-MV Bullet kit (Clonetics). They were cultured in 1% (vol/vol) gelatin-coated flasks or plates, respectively. Purity of ECs was tested by staining for the classical endothelial marker van Willebrandt factor and vimentin to identify cells of other origin.
RNA isolation of placental tissue and primary cells
Small slices of frozen tissue (200 mg) were homogenized in Tri reagent (Molecular Research Center, Cincinnati, OH) (1 ml) and were subsequently processed according to the manufacturers instructions. RNA from primary cells was isolated by directly lysing the cells with Tri reagent in the culture dishes. Cell lysates were processed as homogenized tissue samples. After isolation the quality of total RNA was assessed by a bioanalyzer (Agilent, Palo Alto, CA)
Semiquantitative RT-PCR
Primers targeting ribosomal protein L30 (RPL30) (CCTAAGGCAGGAAGATGGTG and CAGTCTGTTCTGGCATGCTT; product 351 bp; NM_000989), EL (CACCAACACCTTCCTGGTCT and CTCCACAGTGGGACTGGTTT; product 313 bp; NM_006033), LPL (GTCCGTGGCTACCTGTCATT and TGGATCGAGGCCAGTAATTC; product 367 bp; NM_000237), HL (CTGGCTGCCACTTCCTAGAG and GGCGTCTCAGTTTGGTTGAT; product 346 bp; NM_000236), HLA-G (AGGAGACACGGAACACCAAG and CCTCCAGGTAGGCTCTCCTT; product 300 bp; NM_002127), and PL (TCCCGAACTGGATACACACA and ACATCCAGGCATTTCCACTC; product 384 bp; NM_000936) were designed to get PCR products spanning exon-exon boundaries of mRNAs. The transcription of RPL30, which encodes the ribosomal protein L30, was used as an internal control (26). For semiquantitative RT-PCR a commercially available RT-PCR kit (OneStep RT-PCR kit; QIAGEN, Hilden, Germany) was used according to the manufacturers manual. Each PCR contained 100 ng total RNA from tissue or primary cells. Primer annealing temperature was 60 C for RPL30 (24 cycles) and HLA-G or 58 C for EL, LPL, HL, and PL (all 28 cycles). The PCR products were separated on 2% (wt/vol) agarose gels (SeaKem LE agarose; Cambrex), documented with the Eagle-Eye system (Stratagene, La Jolla, CA) and quantified using AlphaDigiDoc 1000 (Alpha Innotech, San Leandro, CA) software.
Quantitative real-time RT-PCR
Total RNA (1 µg) from placental tissue, placental primary cells, and a panel of 20 different human tissues (Human Total RNA Master Panel II; CLONTECH Laboratories, Mountain View, CA) was reversely transcribed to cDNA in a total volume of 20 µl, using SuperScript II reverse transcriptase (Invitrogen) according to the manufacturers instructions. Random hexamer primer were purchased from Fermentas (Hanover, MD) and deoxynucleotide triphosphate mix from Invitrogen. After cDNA synthesis, the reaction volume was diluted with H2O to a final volume of 100 µl (10 ng cDNA per microliter). Fifty nanograms cDNA (5 µl) of each reaction were subsequently subjected to quantitative real-time PCR using FAM-labeled TaqMan gene expression assays (EL: Hs00195812_m1; LPL: Hs00173425_m1; RPL30: Hs00265497_m1) and the TaqMan universal PCR mastermix (Applied Biosystems, Foster City, CA). Components were mixed according to the manufacturers instructions and amplified in 25 µl total volume per well (96-well plates; Applied Biosystems) using an AB7900 TaqMan. Threshold cycle values were defined automatically by the SDS 2.2.2 program (Applied Biosystems) and copy numbers of EL and LPL were assessed by the relative standard curve method.
Microarray analysis of placental primary cell RNA
Total RNA from 10 preparations per cell type, isolated from different placentas, was pooled and 5 µg RNA prepared for hybridization as described previously (27). For expression analysis, cRNA was hybridized against Affymetrix (Santa Clara, CA) HU133A chips according to the manufacturers instructions. Raw data were normalized globally and processed with Microarray Suite (version 5.0) and Data Mining Tool (Affymetrix) software. Annotations were obtained from NetAffx (Affymetrix) and the data screened for lipases. Genes encoding secreted lipases were sorted according to their expression level in placental cell types with Excel software (Microsoft, Redmond, WA).
Immunohistochemistry
Fresh tissue samples were fixed in 4% paraformaldehyde and embedded in paraffin. Serial sections (5 µm) cut from paraffin blocks were processed by heat antigen retrieval in epitope retrieval solution pH 9 (Eubio, Vienna, Austria). Endogenous peroxidase was blocked with 3% H2O2. Immunolocalization was visualized by the Ultravision-labeled polymer-horseradish peroxidase (HRP) detection system specific for mouse and rabbit antibodies and 3-amino-9-ethylcarbazolel (Lab Vision, Fremont CA) following the manufacturers protocol. Primary antibodies rabbit anti-EL (1:500), rabbit anti-LPL (1:500), and the negative control rabbit serum were diluted in protein protecting diluent buffer (Lab Vision). Between incubation steps the slides were washed in Tris-buffered saline containing 0.05% (vol/vol) Tween 20. Slides were counterstained with Mayers hemalaun (Merck, Darmstadt, Germany). In addition, as a positive control for the LPL antibody, paraffin sections cut from human heart muscle tissue were stained with anti-LPL (1:500).
Western blot analysis of lipases on trophoblast and EC surfaces
Placental cells (FTs, TTs, and ECs; 2 x 106/75 cm2 flasks) were cultured for 2 d in appropriate culture media as described above. The heparin releasable fraction of HSPG bound proteins was washed from cell surfaces by incubating cells with 100 IU/ml heparin (Heparin Immuno; Ebewe Pharma, Graz, Austria) in PBS for 20 min. Heparin releasable fractions (4 ml) were collected on ice and concentrated (100 µl) with centrifugal filter devices (Amicon Ultra; Millipore, Bedford, MA). Twenty microliters were separated on 10% SDS-PAGE gels (Precise protein gels; Pierce, Rockford, IL), proteins were blotted onto nitrocellulose membranes (Hybond-ECL; Amersham, Chalfont St. Giles, UK), and blocked for 30 min with 10% (wt/vol) nonfat dry milk (Bio-Rad, Hercules, CA) and 0.1% (vol/vol) Tween 20 (Sigma, St. Louis, MO) in 0.14 mol/l Tris-buffered saline (pH 7.3). Polyclonal anti-EL or anti-LPL antibodies (rabbit) were added to the blocking solution (1:1000 dilution). Blots were incubated overnight at 4 C followed by 60 min incubation at room temperature with secondary antibody, goat antirabbit IgG HRP conjugate (1:2000; Bio-Rad). Proteins were detected with the SuperSignal CL-HRP substrate system (Pierce) and hyperfilm (Amersham). Lysates from HepG2 cells that were infected with adenoviruses encoding either human EL or LPL (28) served as positive controls.
Data presentation and statistical analyses
Data are presented as mean ± SD unless stated otherwise. In case of normally distributed data (Kolmogorov-Smirnov test) unpaired Students t test was used to test for differences between groups. Otherwise, the Wilcoxon rank sum test was used. Linear regression analysis tested for linear dependence between variables. Significances were accepted at a level of 5% or better.
| Results |
|---|
|
|
|---|
The key placental cell types participating in transport of maternal nutrients to the fetal circulation are the trophoblast at the maternoplacental interface and the placental ECs at the fetoplacental aspect of human placenta (Fig. 1
). Trophoblasts were isolated from the first trimester (FTs) and term of gestation (TTs), whereas ECs could be isolated only from term placentas because of the low degree of placental vascularization early in gestation.
|
|
|
EL and LPL expression levels were compared among FTs, TTs, and ECs by quantitative real-time RT-PCR analyses (Fig. 2B
). In FTs expression of EL was 4.9-fold higher than that of LPL (P < 0.001). Trophoblast and ECs isolated from term placenta revealed only EL expression. EL expression in TTs was 62% lower than in FTs (P
0.0001).
A similar pattern was observed at the protein level. When cell surface bound lipases were released from cultured trophoblasts and ECs with heparin (Fig. 2C
), EL protein was abundantly detected by immunoblotting in the supernatant of ECs but was less synthesized in first-trimester and term trophoblasts. We were not able to detect LPL released from any isolated placental cell type. LPL was detected only in lysates of HepG2 cells overexpressing LPL.
FTs were separated into two different subpopulations, villous and extravillous trophoblast, according to their surface HLA-G expression (Fig. 1
) and the quality of separation controlled by HLA-G expression measurement (Fig. 2D
). Whereas EL was about equally expressed in both cell types, LPL was expressed only in villous trophoblasts of first-trimester tissue lacking HLA-G (Fig. 2D
).
Location of EL and LPL
Because not all cell types within the placenta can be isolated, immunohistochemistry was used to survey the whole tissue for localization of both lipases. In the first trimester of gestation, EL protein was localized in villous cytotrophoblasts, the villous syncytiotrophoblast, and extravillous trophoblasts (Fig. 3A
). In comparison, LPL was detected with a weaker signal in villous cytotrophoblasts and the syncytiotrophoblast (Fig. 3B
). At term of gestation, EL was also found in syncytiotrophoblast and the ECs of vascular vessels in stem villi (Fig. 3
, D and G) and intermediate villi. Occasionally there was a faint signal in vasculosyncytial membranes and capillaries of terminal villi (not shown). Moreover, EL was detected in extravillous trophoblasts of term tissue (Fig. 3J
). In contrast, LPL staining was confined to smooth muscle cells of vascular vessels (Fig. 3
, E and H) but was detected in neither the trophoblast compartment, i.e. syncytiotrophoblast, villous, or extravillous cytotrophoblasts (Fig. 3K
) nor the endothelial cells. Human heart muscle used as positive control was stained by the LPL antiserum (Fig. 3L
).
|
EL and LPL mRNA expression was measured in total placental tissue at various stages of pregnancy. Within the first trimester (Fig. 4A
), EL and LPL mRNA expression levels were unaltered between wk 6 and 12 of gestation (linear regression analysis). At term of gestation, EL expression levels were higher (P
0.05) by only about 30% than in the first trimester (Fig. 4B
). LPL, faintly expressed in first trimester tissue, was almost 20-fold (P
0.001) increased in term tissue. LPL expression in term placenta tissue reached only 35% (P
0.005) of EL expression levels at term. Expression levels of both lipases did not differ between the location at the periphery, compared with central parts of the placenta (not shown). The results of semiquantitative (Fig. 4A
) and quantitative (Fig. 4B
) real-time RT-PCR are in good agreement. The relative EL expression in isolated cells (Fig. 2B
) is higher than in whole placental tissue (Fig. 4B
) because the latter contains cellular constituents devoid of EL. LPL expression in term placental tissue (Fig. 4B
) despite absence in term trophoblast and ECs (Fig. 2B
) is in line with LPL presence solely in smooth muscle cells as identified by immunohistochemistry (Fig. 3H
).
|
Quantitative real-time RT-PCR was used to compare the expression levels of EL and LPL in placental tissue and isolated placental cells with other adult and fetal tissues (Table 2
). EL expression was 13-fold higher in thyroid gland, compared with testis, liver, and placenta, which had the highest levels among the tissues analyzed. Heart was the tissue with the strongest LPL expression, 60-fold higher than in placenta. Whereas first-trimester trophoblasts expressed LPL (see also Fig. 2B
), it was virtually absent in term trophoblasts and ECs.
|
When placental EL and LPL expression in IUGR pregnancies was compared with healthy control patients (Table 3
) by quantitative real-time RT-PCR, a dysregulation of placental EL and LPL, respectively, was found in IUGR. Compared with normal placentas, EL mRNA was decreased by 30% (P
0.02), whereas LPL mRNA expression was increased by 2.4-fold (P
0.015) in IUGR (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
The low-level expression of LPL in term placenta is in contrast to another study (29). Our results have been generated by a wide range of different methods including microarray, quantitative real-time RT-PCR, immunohistochemistry, and immunoblotting of heparin-released fractions. Moreover, we have been using multiple tissues from a large number of placentas, hence ruling out variations due to biological diversity. All results obtained here indicate a very low or even lack of LPL expression in term trophoblasts and ECs and a preponderance of EL. This is in line with earlier Northern blot analyses (3) revealing substantial EL and marginal LPL expression in placental tissue. The reason for the discrepant results (29, 30) is unclear but may be accounted for by antibody reactivity or specificity. In first-trimester placenta, the trophoblast is the predominant cell type expressing EL and LPL (Fig. 1
). Hence, at this period of gestation, both lipases are located at the maternoplacental interface to hydrolyze maternal lipoprotein-derived lipids. As gestation and placental development advance both lipases are significantly down-regulated at the maternal surface of the placenta. At the end of gestation, EL is still expressed, but LPL is virtually absent from the trophoblast. The raising expression of both lipases in total placental tissue between first-trimester and term of gestation strongly suggests the presence of EL and LPL on other, nontrophoblast cells that are present in the placenta at term but only at lower number, if at all, in the first-trimester tissue. Indeed, we found substantial EL expression in ECs and LPL in smooth muscle cells surrounding blood vessels (Fig. 1
). Vascularization of the placenta proceeds continuously and reaches its maximum at the end of gestation. Thus, placenta vessels account for increased expression of EL and LPL in term placenta. This appearance of the lipases on cells of the placental vasculature may reflect a different role both lipases play in the placental handling of lipids at the end of gestation.
At the beginning of gestation, the placenta, i.e. the trophoblast, is predominantly supplied with nutrients from endometrial glands. Their secretions, called uterine milk, are rich in lipids at least in other species. The presence of both EL and LPL in the cytotrophoblast and syncytiotrophoblast may serve to hydrolyze lipids from these secretions to sustain histiotrophic nutrition of the developing placenta. Later in gestation either EL or another yet unidentified triglyceride lipase can fully take over LPL function, and LPL in the trophoblast compartment is no longer needed. At that stage in gestation, the specific presence of LPL in smooth muscle cells suggests a local role in supply of fatty acids to the vessel and the subjacent tissue likely for generation of energy or vasoregulating eicosanoids. A translocation of LPL from the smooth muscle cell to the luminal aspect of the endothelium cannot definitely be ruled out (31).
EL and LPL are associated with the cell surface via HSPGs from which they can be released by heparin (28, 32). As found by Western blot analysis, the heparin released fractions of FTs, TTs, and ECs contained the 68 kDa EL protein but not LPL. The molecular mass corresponded to intact full-length EL. This is an important observation because EL as well as LPL can undergo proteolytic cleavage by proprotein convertases (28, 33). After cleavage, truncated lipase fragments (EL: 40 and 28 kDa; LPL: 35 and 20 kDa) are released from the cellular surface and are enzymatically inactive. Only intact, full-length, EL and LPL retained on the cellular HSPGs display lipolytic activity. Hence, trophoblast cells and placental endothelial cells not only express EL, which is in line with the present immunohistochemistry and RT-PCR results, but also are capable of synthesizing active EL in vitro. Because full-length EL is the enzymatically active form of EL, it is very likely that EL synthesized by trophoblast cells and placental cells is an active phospholipase. The absence of detectable LPL after heparin release from FT is in line with the weak immunohistochemistry signal and may reflect an amount released below the detection limit of immunoblotting.
Offspring with IUGR are characterized by a decrease in the proportion of fetal fat. The presumptive role of the lipases in maternal-fetal transport of lipids and lipase activity changes in IUGR (34) prompted us to hypothesize a change in the expression of EL and LPL in placentas obtained from those pregnancies. Both genes were markedly dysregulated in IUGR placentas. The observation of increased LPL expression in IUGR is in line with a previous study (35). The mechanism underlying the dysregulation remains elusive. A potential influence of shorter gestational age on increased placental LPL expression in IUGR can be excluded because tissue expression of LPL reaches highest level at term of gestation. Insufficient implantation, reduced supply of nutrients, and hypoxia are general characteristics of IUGR pregnancies. The IUGR subjects in the present study also showed hypoxia in the fetal circulation.
Collectively, the present study clearly demonstrates the preponderance of EL as the major placental lipase of the TLG family irrespective of time in gestation and its dysregulation in pregnancies associated with intrauterine growth restriction.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: There is no conflict of interest and nothing to disclose.
First Published Online March 13, 2007
1 G.D. and C.W. contributed equally to this work. ![]()
Abbreviations: AGA, Appropriate for gestational age; EC, primary placental endothelial cell; EL, endothelial lipase; FFA, free fatty acid; FT, first-trimester trophoblast; HL, hepatic lipase; HLA-G, human leukocyte antigen class IbG; HRP, horseradish peroxidase; HSPG, heparan sulfate proteoglycan; IUGR, intrauterine growth restriction; LPL, lipoprotein lipase; PL, pancreatic lipase; RPL30, ribosomal protein L30; TLG, triglyceride lipase gene; TT, term trophoblast.
Received November 2, 2006.
Accepted March 6, 2007.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Cetin, G. Alvino, and M. Cardellicchio Long chain fatty acids and dietary fats in fetal nutrition J. Physiol., July 15, 2009; 587(14): 3441 - 3451. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |