| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Nephrology Division (H.-W.C., T.-S.C., H.-Y.H., V.-C.W., Y.-M.C., B.-S.H., K.-D.W.), Department of Internal Medicine, and Department of Urology (S.-C.C.), National Taiwan University Hospital, Taipei, Taiwan 100
Address all correspondence and requests for reprints to: Kwan-Dun Wu, M.D., Ph.D., Room 1419, Clinical Research Building, Department of Internal Medicine, National Taiwan University Hospital, 7 Chung-Sun South Road, Taipei, Taiwan 100. E-mail: kdw{at}ntumc.org.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Objective: The objective of the study was to explore the role of the D2 dopamine receptor (D2R) on aldosterone synthesis and secretion and clarify the clinical importance of this role on aldosterone overproduction in APA.
Results: D2R expression in APA was examined in 24 patients and was much less than that in the nontumorous adrenal cortex. D2R mRNA levels in APA were inversely correlated with CYP11B2 mRNA levels and the patient’s plasma aldosterone concentration. Angiotensin II (AII)-stimulated aldosterone secretion and CYP11B2 mRNA expression in human adrenocarcinoma cells (H295R) was attenuated by the D2 agonist, bromocriptine (BMC). BMC selectively attenuated AII-induced protein kinase C (PKC)-µ phosphorylation and its translocation to the cell membrane. PKCµ-specific short-hairpin RNA significantly decreased AII-induced CYP11B2 mRNA expression and aldosterone secretion. BMC also attenuated the AII-induced increase in cytoplasmic calcium, partially through an inhibition of cytoplasmic inositol 1,4,5 triphosphate production. Despite similar total PKCµ levels in APA and the nontumorous adrenal cortex, expression of phosphorylated PKCµ in APA was much higher.
Conclusion: This is the first study to demonstrate that the D2R modulated aldosterone secretion and synthesis through a specific attenuation of PKCµ activity, as well as the intracellular calcium level. Down-regulation of the D2R in APA, in turn, increased PKCµ activity and led to overproduction of aldosterone in affected patients. The D2R may thus serve as a potential treatment target for primary aldosteronism.
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Although aldosterone secretion in patients with aldosterone-producing adenomas (APA) is autonomous, there is evidence that aldosterone secretion is subjected to dopaminergic inhibition (6, 7). Administration of metoclopramide (MCP), a D2R antagonist, can significantly increase the plasma aldosterone concentration (PAC) (8, 9). Our earlier study showed that elevation of PAC after administration of MCP in patients with APA was variable, and the response was inversely related to the mRNA level of aldosterone synthase (CYP11B2) in the tumors (10). We thus postulated that a higher elevation of PAC after MCP administration indicates greater dopaminergic inhibition and greater suppression of CYP11B2 transcription. A derangement of the dopaminergic system in the adrenal gland may therefore account for the overproduction of aldosterone.
Two D2-like receptors, the D2 and D4 dopamine receptors (D2R and D4R), are expressed in the normal adrenal cortex as well as in patients with APA (11). In human adrenocarcinoma cells (H295R), angiotensin II (AII)-stimulated aldosterone secretion is attenuated by the D2R but augmented by the D4R (11). Therefore, we hypothesized that a decreased expression of the D2R or an increased expression of the D4R may account for the overproduction of aldosterone in patients with APA. In this study, we determined the levels of these two D2-like receptors in tumorous and nontumorous portions of the APA. Both receptors were down-regulated in the tumorous portion. The expression of the D2R, but not the D4R, was inversely correlated with the PAC and CYP11B2 mRNA in the tumors. The inhibitory effects of the D2R on aldosterone secretion and CYP11B2 transcription of H295R cells were specifically mediated via inhibiting both protein kinase C (PKC)-µ activation and cytoplasmic calcium ([Ca2+]i) elevation. Consistent with in vitro data, phosphorylated PKCµ was significantly up-regulated in the tumors. We conclude that down-regulation of the D2R in APA plays an important role in the pathogenesis of PA.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The diagnosis of APA was established by the clinical manifestations of PA and confirmed histologically. The surgical specimen of the adrenal gland was separated grossly into tumorous and nontumorous portions; any suspicious nodule in the adrenal cortex was not collected as nontumorous portion. In the nontumorous portion, the adrenal medulla was dissected out, and no further separation of the cortex was done. The total RNA and protein were isolated from these specimens. All molecular biological procedures were conducted according to standard protocols. The PAC for analysis was the basal level of the captopril test, which was done after patients had discontinued all antihypertensive drugs for at least 2 wk and were permitted salt intake ab libitum. The study was approved by the ethical committee of the National Taiwan University Hospital.
Cell cultures
The human adrenocortical carcinoma cell line (H295R) was obtained from the American Type Culture Collection (Manassas, VA). The experiments pertaining to cell culture have been described previously (11). After testing the doses of the drugs that regulate aldosterone secretion/synthesis, AII (10 nM), bromocriptine (BMC; 1 µM), and raclopride (Racl; 1 µM) were used in all experiments unless otherwise indicated. All experiments were performed at least in triplicate; for each experiment the data for analysis was the mean of three measured samples.
Materials
AII, dopamine, BMC, and Racl were purchased from Sigma Chemical Co. (St. Louis, MO) and phospho-PKC-specific antibodies and PKC subtype-specific antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA). angiotensin II type 1 receptor (AT1R) antibody and its immunizing peptide were obtained from Santa Cruz (Santa Cruz, CA). AT1 N10, sc1173, D2R antibody, and its immunizing peptide were commercially available from Chemicon (Temecula, CA). Xestospongin C and dantrolene were obtained from Calbiochem (Cambridge, MA); an inositol 1,4,5 triphosphate (IP3) RRA kit (NEK064) was purchased from PerkinElmer Life Sciences (DuPont-NEN Life Science Products, Boston, MA); fura-2-tetra(acetoxymethyl)-ester (AM), Pluronic, and dimethyl bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid (BAPTA)-AM were obtained from Molecular Probes (Eugene, OR).
D4R antibody was designed to target the third intracellular domain. The antibody was purified from the serum of a rabbit immunized with synthesized oligopeptide, RAPRRPSGPGPPSPT, at the position of amino acids 233–247. The preimmunized serum of the same rabbit was also collected as a negative control. The antibody detected a single band, 50 kDa in size, in both the adrenal gland and H295R cells. There were no cross-reactions involving these three antibodies (data not shown).
Immunoblotting
For PKC assays, the surgical specimens, or H295R cells that were scraped 5 min after treatment, were solubilized in lysis buffer. Equal amounts of protein (10 µg for human tissue and 40 µg for H295R cells) were separated on a 10% polyacrylamide gel and transferred to Immobilon P. Blots were probed with different antibodies, followed by a horseradish peroxidase-coupled antirabbit secondary antibody. Immunoreactive proteins were visualized with enhanced chemiluminescence (Pierce, Rockford, IL).
Measurement of aldosterone
Culture supernatants and the cell lysates were collected 30 min or 24 h after treatment. The aldosterone levels were measured by RIA with commercial kits (Aldosterone Maia kit, Biochem Immunosystems, Bologna, Italy).
Quantitative real-time PCR
Total RNA was extracted from tissue samples and H295R using Trizol RNA isolation reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. RNA was subjected to deoxyribonuclease (DNase) treatment using 1 U DNase I (amp grade) pre microgram RNA in DNase reaction buffer for 15 min at 37 C (New England Biolabs, Beverly, MA) to remove genomic DNA contamination. The reaction was stopped by heating to 99 C for 5 min. RNA was reverse transcribed by using the RT system kit (Promega, Madison, WI) as described in the manufacturer’s protocol. The gene expression levels of CYP11B2, AT1R, D2R, and D4R were then quantified using TaqMan technology on an ABI PRISM 7900 sequence detection system (Applied Biosystems, Foster City, CA), assay ID Hs01597732_m1, Hs00258938_m1, Hs00241436_m1, and Hs00609526_m1, respectively. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; assay ID Hs99999905_m1) was used as an endogenous control in a TaqMan human endogenous control plate. Sample dilutions were comprised of 100 ng template cDNA. All samples were tested in a total volume of 20 µl in triplicate. The cycle to threshold (CT) value was recorded for statistical analysis.
The mRNA level of AT1R, D2R, D4R, and CYP11B2 were corrected with the mRNA level of GAPDH and expressed as 2–
CT, where CT = (CTx – CTGAPDH and X = AT1R, D2R, D4R, or CYP11B2). The mRNA level of the tumorous portion was corrected with that of the nontumorous portion.
Isolation of membrane protein
Cells were scraped in ice-cold 1x PBS and centrifuged at 600 x g for 5 min. The pellet was resuspended and homogenized in solubilization buffer without detergent [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA 1 mM phenylmethylsulfonyl fluoride, 10 mM NaF, 25 µg/ml leupeptin, and 0.1 mg/ml aprotinin]. This homogenate was then centrifuged at 1000 x g in 4 C for 5 min to separate the nuclear portion. The supernatant was centrifuged again at 53,000 x g in 4 C for 30 min. The pellet containing the membrane portion was resuspended in radioimmunoprecipitation assay buffer [20 mM Tris-HCl, (pH 7.4), 150 mM NaCl, 2M EDTA, 0.1% Triton X-100, 2.5 mM Na-pyrophosphate, 1 mM Na3VO4, and 1 mM phenylmethylsulfonyl fluoride]. The supernatant contained cytosolic protein.
Expression of PKCµ and D2R short-hairpin RNA (shRNA)
The sense strands for the synthesis of D2R and PKCµ shRNA were CAAGGCTGTTAGAGAGATAATTGGA and CCAGAGCACATAACGAAGTTT, respectively. The control plasmid with conjugated enhanced green fluorescent protein was purchased from Open Biosystems Inc. (Huntsville, AL). Lentiviruses carrying the target nucleotides were generated by cotransfecting 9 µg of lentiviral vector (Plko1), 4.5 µg of pHCMV-G (envelope system: VSV-G), and 6.75 µg of pCMVR8.2 (packaging vector: env, tat, rev, vpr, vpu, vif, and nef) in 293T cells by using calcium phosphate reagent (2x HEPES buffer 750 µl, 2.5 M CaCl2 75 µl, and H2O 750 µl (12). Supernatants were collected 48 and 72 h after transfection, filtered through a 0.45-µm membrane (Amicon Ultra-15 100K; Millipore, Bedford, MA), centrifuged at 4000 x g for 30 min at 4 C, and used directly to infect H295R. The experiments were carried out 48 h after infection.
Cytoplasmic Ca2+ measurement
The cells were suspended in PBS containing 2 mM EDTA by periodic shaking, washed in a Ca2+-containing solution [140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 11 mM glucose, 10 mM HEPES (pH 7.4), and 0.1% BSA], and incubated in 4 µM fura-2-AM with 0.04% Pluronic for 35 min. Cells were then washed and resuspended in the Ca2+-containing solution and maintained on ice throughout the duration of the experiments. Intracellular Ca2+ was measured in cells suspended in Ca2+-containing solution at the ratio of fluorescence with 340 and 380 nm excitation and 510-nm emission (fluorolog 2; Spex Industries, Edison, NJ). The fluorescent ratio was calibrated by adding digitonin to a final concentration of 75 µg/ml and then adding 1 mM EDTA at a 1:50 dilution and 10 mN NaOH at a 1:700 dilution, and [Ca2+]i was calculated as described (13).
Determination of IP3
Cells were washed twice and preincubated 30 min at 37 C in an incubation buffer [145 mM NaCl, 5.6 mM KCl, 5.6 mM glucose, 0.01% BSA, and 10 mM HEPES (pH 7.4)]. After treatment in 1 ml of warmed incubation buffer for 10 sec, 250 µl ice-cold perchloric acid (10% vol/vol) was added to terminate the response. After scraping, the cells were washed with 250 µl 10% perchloric acid and centrifuged at 12,000 x g for 5 min at 4 C. The supernatants were neutralized with 50 µl 1.5 M NaOH in the presence of universal indicator. IP3 levels were measured by a specific competitive binding assay kit (PerkinElmer Life Sciences). Each incubation contained 500 µl receptor preparation/[3H]IP3 tracer 1:15 (vol/vol), 100 µl of standard IP3 (0–120 pmol per 0.1 ml), or cell extract. The tubes were agitated and incubated for 45 min on ice. Incubations were terminated by centrifugation at 12,000 x g for 5 min at 4 C. The supernatant was removed by aspiration and the pellet was dissolved in scintillation liquid and counted.
Statistics
Statistical analysis was performed with the Mann-Whitney U test, using the Stat View software package (Abacus Concepts, Inc., Berkeley, CA). Statistical significance was considered at the 5% level.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The levels of the D2R and the D4R expressed in APA and nontumorous adrenal cortex from 24 patients were examined. Seven of the levels are illustrated in Fig. 1A
. Both the expression of the D2R and D4R were decreased in APA in comparison with the nontumorous adrenal cortex (Fig. 1B). There was no difference in AT1R levels between APA and the nontumorous adrenal cortex.
|
). The mRNA levels of the D2R and D4R in APA were lower than in the nontumorous adrenal cortex (CT = 14.88 ± 3.9 vs. 9.95 ± 3.3, P < 0.001 and CT = 19.9 ± 1.44 vs. 15.89 ± 2.64, P < 0.001 for the D2R and D4R, respectively; Fig. 2A). The AT1R mRNA levels between APA and the nontumorous adrenal cortex did not differ (CT = 11.18 ± 3.28 vs. 10.68 ± 3.89, P > 0.05). As expected, the APA expressed the CYP11B2 mRNA more abundantly than the nontumorous adrenal cortex (CT = 2.57 ± 2.07 vs. 8.18 ± 3.25, P < 0.001).
|
) or the D4R (data not shown) in APA. The CYP11B2 mRNA levels of the APA were inversely correlated with the D2R mRNA levels but not with either the AT1R or the D4R (Fig. 2C). In the nontumorous adrenal cortex, the CYP11B2 mRNA level did not correlate with the AT1R, D2R, or D4R mRNA levels or the PAC (data not shown). The inverse correlation between the CYP11B2 and D2R mRNA levels in the APA implied that D2R down-regulates CYP11B2 transcription. To test this hypothesis, an in vitro study with H295R cells was conducted.
D2R modulated AII-stimulated aldosterone secretion and CYP11B2 transcription
BMC, a D2R agonist, attenuated AII-stimulated aldosterone secretion dose dependently (Fig. 3A). This inhibitory effect of BMC was reversed by the simultaneous addition of the D2R antagonist, Racl (Fig. 3B). BMC also decreased the CYP11B2 mRNA level that was elevated by AII, which was reversed by Racl (Fig. 3C). Neither BMC nor Racl alone altered the basal aldosterone secretion or the CYP11B2 mRNA level.
|
, D and E). Although not altering AII-stimulated aldosterone secretion or CYP11B2 transcription in wild-type H295R cells, dopamine enhanced AII effects in cells infected with D2R shRNA. Addition of Racl further increased aldosterone secretion and CYP11B2 mRNA levels in both native and D2R-depleted cells. D2R modulated AII-stimulated acute aldosterone secretion
The elevation of aldosterone levels in cell supernatants occurred as early as 30 min after adding AII. This acute response to AII was also attenuated by BMC and partially reversed by Racl (Fig. 3F). To test whether steroid-producing cells maintain steroid-containing vesicles ready for secretion, we measured the intracellular aldosterone contents. AII increased not only aldosterone secretion but also the intracellular aldosterone content, which was attenuated by BMC; Racl reversed BMC’s effect (Fig. 3F). There was no change in the CYP11B2 mRNA level at 30 min after AII treatment (data not shown), suggesting that the acute effect of AII on aldosterone secretion was independent of CYP11B2 transcription.
Taken together, these findings suggest the following: 1) the D2R plays a significant inhibitory effect on aldosterone secretion and CYP11B2 transcription, 2) there exists a basal level of activity of the D2R in H295R cells or a direct interaction of the D2R with AT1R to modify AII-stimulated aldosterone secretion/synthesis, and 3) the presence of other dopamine receptors that possess an opposite effect on AII-stimulated aldosterone secretion/synthesis; as in our previous report, the D4 may account for these findings.
The D2R specifically affected PKCµ activity
Immunoblotting with phosphorylated-PKC-specific antibodies demonstrated that AII increased the phosphorylation of PKC
/ßII, PKC
, PKCµ (Ser 744/748), and PKCµ (Ser 916) of H295R cells but not PKC
, PKC
, PKC
, or PKC
(Fig. 4A). BMC (1 µM) did not change the basal or AII-stimulated phosphorylation of PKC, PKCß/ßII, and PKCµ (Ser 744/748) but attenuated the phosphorylation of PKCµ (Ser 916), the effect of which was reversed by Racl.
|
, PKCß II, PKC, and PKCµ showed a predominant cytosol localization of these PKC isoforms. AII translocated these PKC isoforms to the cell membrane with a reciprocal change of the cytosol levels (Fig. 4B), but only the translocation of PKCµ was affected by the D2R, and Racl reversed BMC’s effect. The role of PKCµ in AII-stimulated aldosterone secretion and CYP11B2 transcription
To explore whether the D2R’s attenuation of AII-stimulated PKCµ activation is translated to aldosterone secretion/synthesis, we infected H295R cells with PKCµ shRNA. The infection selectively inhibited the expression of PKCµ but not the expression of PKC, -ßII, or - isoforms (Fig. 5A). This shRNA selectively decreased AII-stimulated phospho-PKCµ (ser916; Fig. 5B). Both the CYP11B2 mRNA expression and aldosterone secretion by AII were attenuated in the cells expressing PKCµ-shRNA but not in the cells with mock transfection (Fig. 5, C and D). Accordingly, PKCµ activation played a role in AII-stimulated aldosterone secretion and synthesis.
|
Figure 5E shows the immunoblotting of 14 APA samples with anti-PKC antibodies. The total PKCµ levels were not different between the APA and nontumorous adrenal cortex, but the phosphorylated PKCµ (Ser916) in APA was much greater than that of the nontumorous adrenal cortex (Fig. 5E). The expression of PKC/ßII, either the total or phosphorylated protein, was variable in both APA and the nontumorous adrenal cortex. The expression of PKC was minimally detected in both APA and nontumorous adrenal cortex (data not shown).
These findings strengthen the specificity of PKCµ (Ser916) phosphorylation as a second messenger in the regulation of CYP11B2 transcription and aldosterone secretion and suggest the importance of the D2R in the pathogenesis of aldosterone overproduction from APA.
The D2R attenuated AII-stimulated [Ca2+]i increase
The elevation of [Ca2+]i by AII was decreased when intracellular [Ca2+]i was chelated with BAPTA (data not shown), which was accompanied by decreases in aldosterone secretion at 30 min and 24 h, and CYP11B2 mRNA levels at 4 h (Fig. 6A and B). Addition of 1 µM BMC decreased the elevation of [Ca2+]i by AII; not only a decrease in the peak [Ca2+]i level but also a deceleration in the rate of [Ca2+]i accumulation (the slope) and a decrease in the plateau level of [Ca2+]i achieved after the surge (Fig. 6C). Therefore, the modulation of AII-stimulated aldosterone secretion by the D2R, acute and late phases, is mediated via a decrease of [Ca2+]i.
|
). The IP3-gated Ca2+ channel antagonist, xestospongin C, rather than the ryanodine-responsive Ca2+ channel antagonist, dantrolene, attenuated the AII-stimulated elevation of [Ca2+]i and, in turn, expression of CYP11B2 mRNA and secretion of aldosterone (Fig. 6, E and F). These results suggest that the decrease in [Ca2+]i by the D2R is through an inhibition of IP3 release. |
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Despite the evidence that showed a significant regulation of aldosterone secretion by dopamine and the expression of D2R and D4R in the zona glomerulosa and the APA (10, 22), the role of the dopaminergic system in the pathophysiology of PA has rarely been studied (10, 11, 23). The present study revealed strong evidence that D2R plays a crucial role in the overproduction of aldosterone in patients with APA. In contrast to AT1R, the D2R in APA was significantly down-regulated and, interestingly, presented with a reciprocal expression of the CYP11B2 mRNA level and the PAC. This presumption was further proved by our in vitro study that showed activation of D2R decreases AII-stimulated aldosterone secretion, in both the acute and chronic phases. A down-regulation of D4R in the tumor was also observed, but there was no correlation between the D4R and PAC or CYP11B2. Because the D4R augmented aldosterone secretion by AII (11), a down-regulation of the D4R in APA cannot account for the pathogenesis of aldosterone overproduction.
It was thought that the dopaminergic regulation of aldosterone secretion was limited to acute tonic inhibition; however, our previous study had shown that the responsiveness of the PAC to MCP was inversely correlated to CYP11B2 mRNA levels in APA (10), implying that that the D2R exerts not only acute tonic inhibition of aldosterone secretion but also an inhibitory effect on CYP11B2 transcription. In the present study, we confirmed this hypothesis. The AII-stimulated CYP11B2 mRNA level was significantly decreased by the D2R. Because the in vitro study showed that dopamine alone had no effect on aldosterone secretion and CYP11B2 transcription, one may doubt the role of the D2R in aldosterone overproduction in APA, a condition with very low AII levels. However, dopamine alone may not have an indolent role on the regulation of aldosterone synthesis/secretion in vitro. The absence of a dopamine effect may be due to the counteraction to the D2R by other dopamine receptor(s), such as the D4R.
Both extracellular Ca2+ influx and PKC activation were shown to be critical messengers for the increased transcription of steroidogenic acute regulatory protein induced by AII (24). The involvement of PKC in the regulation of adrenal steroidogenic genes has been shown in several studies (25, 26). Paradoxically, transfection with constitutional active conventional PKC isoforms led to an inhibition of AII-stimulated CYP11B2 gene expression (27, 28). It was suggested, therefore, that the expression of the CYP11B2 gene may be differentially regulated by PKC isoforms. In the present study, we observed that AII activated some, but not all, PKC isoforms in H295R cells. PKCµ is probably the most important isoform that signals AII effects because inhibition of PKCµ markedly decreased AII-stimulated aldosterone secretion and synthesis, with an 80% reduction. More importantly, the inhibitory effect of the D2R on aldosterone secretion and CYP11B2 mRNA expression occurred through specifically affecting PKCµ activity. Therefore, the D2R is a major counteracting regulator of aldosterone synthesis/secretion stimulated by AII.
These in vitro findings can be extended to clinical observations. As shown in Fig. 5E, the phosphorylation of PKCµ (Ser916) was much greater in the APA than the nontumorous adrenal cortex, despite a similar expression of the total PKCµ protein in APA and nontumorous adrenal cortex. The other PKC isoforms not affected by the D2R, i.e. PKC, -ß, and -, were either minimally expressed or expressed in variable levels. Speculated to be the most important PKC isoform in the regulation of aldosterone secretion/synthesis, the up-regulated activity of PKCµ in APA plays an important role in the pathogenesis of aldosterone overproduction. Therefore, a down-regulated D2R in APA leads to an increased phosphorylation of PKCµ and, in turn, the overexpression of CYP11B2 in the tumors.
AII-induced aldosterone secretion and CYP11B2 transcription are mediated by an increase of [Ca2+]i (29, 30), and a sustained influx of Ca2+ into cells to maintain the effects (31, 32). AII activates both T- and L-type Ca2+ channels (33, 34), and the former is believed to be responsible for AII-stimulated aldosterone secretion and synthesis. It has been shown that the T-type Ca2+ current in cultured rat adrenal glomerulosa cells can be blocked by D2R activation (35). It is not clear, however, whether the D2R also modulates the first Ca2+-releasing phase from intracellular stores. Our study demonstrated that the D2R attenuated both the [Ca2+]i peak and slope of the [Ca2+]i rise induced by AII, which was accompanied by a decrease of intracellular IP3 level.
In conclusion, our study suggests that D2R can modulate aldosterone secretion and synthesis in both acute and chronic phases. The signals involve both decreases in [Ca2+]i and PKCµ activity. PKCµ may be the most important signal involving AII-stimulated aldosterone synthesis/secretion. The results of the in vitro studies can be extrapolated to what is known to occur in patients with APA. The down-regulation of the D2R in APA, leading to an up-regulation of PKCµ activity, plays a crucial role in the overproduction of aldosterone in these patients.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online February 13, 2007
Abbreviations: AM, Tetra(acetoxymethyl)-ester; AII, angiotensin II; APA, aldosterone-producing adenoma; AT1R, angiotensin II type 1 receptor; BAPTA, bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid; BMC, bromocriptine; [Ca2+]i, cytoplasmic calcium; CT, cycle to threshold; D2R, D2 dopamine receptor; D4R, D4 dopamine receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP3, inositol 1,4,5 triphosphate; MCP, metoclopramide; PA, primary aldosteronism; PAC, plasma aldosterone concentration; PKC, protein kinase C; Racl, raclopride; shRNA, short-hairpin RNA.
Received October 25, 2006.
Accepted February 1, 2007.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  H.-W. Chang, V.-C. Wu, C.-Y. Huang, H.-Y. Huang, Y.-M. Chen, T.-S. Chu, K.-D. Wu, and B.-S. Hsieh D4 dopamine receptor enhances angiotensin II-stimulated aldosterone secretion through PKC-{varepsilon} and calcium signaling Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E622 - E629. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, L. A. Chen, C. M. Townsend Jr., and B. M. Evers PKD1, PKD2, and Their Substrate Kidins220 Regulate Neurotensin Secretion in the BON Human Endocrine Cell Line J. Biol. Chem., February 1, 2008; 283(5): 2614 - 2621. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V.C. Wu, S.C. Chueh, H.W. Chang, W.C. Lin, K.L. Liu, H.Y. Li, Y.H. Lin, K.D. Wu, and B.S. Hsieh Bilateral aldosterone-producing adenomas: differentiation from bilateral adrenal hyperplasia QJM, January 1, 2008; 101(1): 13 - 22. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
, vs. AII+BMC, P < 0.05. The effect of shRNA of D2R on AII-stimulated aldosterone secretion (D) and CYP11B2 mRNA expression (E) in presence of dopamine (DA) and Racl (1 µM) are shown. C, Control; AII, 10 nM; *, P < 0.02 vs. wild type; 
, P < 0.02 vs. AII+DA in D2R-shRNA cells. The role of BMC (1 µM) and Racl (1 µM) in the acute regulation of aldosterone secretion (F) is shown. Aldosterone in the supernatant (
) and intracellular fraction (
) was measured at 30 min after AII stimulation. *, P < 0.05 vs. AII alone; 
) fraction were expressed as the ratio to their respective control levels; *, vs. AII, P < 0.05; 
