help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-2106
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Ain, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Ain, K. B.
Related Collections
Right arrow Thyroid
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 3 1080-1087
Copyright © 2007 by The Endocrine Society

Protein Synthesis Inhibitors, in Synergy with 5-Azacytidine, Restore Sodium/Iodide Symporter Gene Expression in Human Thyroid Adenoma Cell Line, KAK-1, Suggesting Trans-Active Transcriptional Repressor

Wei Li, Gopalakrishnan M. Venkataraman and Kenneth B. Ain

Thyroid Cancer Research Laboratory, Medical Service, Veterans Affairs Medical Center, Lexington, Kentucky 40511; and the Thyroid Oncology Program, Division of Hematology/Oncology, Department of Internal Medicine, University of Kentucky Medical Center, Lexington, Kentucky 40536-0093

Address all correspondence and requests for reprints to: Kenneth B. Ain, M.D., Thyroid Oncology Program, Division of Hematology/Oncology, Department of Internal Medicine, Room CC448, University of Kentucky Medical Center, 800 Rose Street, Lexington, Kentucky 40536-0093. E-mail: kbain1{at}uky.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Context: Therapy of thyroid carcinoma uses its radioiodine concentration ability for treatment. Dedifferentiated cells lose radioiodine uptake from human sodium-iodide symporter (hNIS) gene transcription failure consequent to genomic structure (chromatin compaction) and composition (CpG methylation).

Objective and Methods: We explored restoring hNIS expression in human thyroid carcinoma cells using thyroid adenoma and carcinoma cell lines: KAK-1, NPA87, BHT-101, and KAT-4B, with quantitative RT-PCR, chromatin immunoprecipitation, deoxyribonuclease I sensitivity assays, and luciferase reporter construct transfections containing hNIS promoter regions.

Results: Combined 5-azacytidine and sodium butyrate restores hNIS gene transcription in KAK-1 to levels approaching radioiodine-treatable tumors. Despite induction of H4 acetylation, there was no deoxyribonuclease I sensitivity enhancement in two regions of the hNIS gene promoter. Cycloheximide in cells transfected with luciferase reporter construct, 1.3 kb hNIS gene promoter, stimulated normalized luciferase expression, singly and synergistically with 5-azacytidine, in a dose-dependent, time course-dependent, cell type-specific, and promoter-specific fashion. Both anisomycin and emetine, but not puromycin, had similar effects. Cycloheximide also increased endogenous hNIS mRNA. Transfections with reporter constructs containing consecutive deletions of hNIS gene promoter sequences revealed responsible sequences at –427 to –131 bp. Deletion of 1.2 kb promoter region upstream of –131 bp enhanced basal luciferase reporter activity 3-fold above the activity of full length promoter construct, supporting inhibitory properties of this region.

Conclusions: This suggests that trans-active protein factor(s) represses endogenous hNIS transcription in KAK-1 cells under basal conditions, accounting for loss of iodine uptake. Inhibition of this repressive activity increases endogenous hNIS transcription and presents a novel target to restore hNIS expression in dedifferentiated thyroid carcinoma.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID CARCINOMAS ARE unique among cancers because expression of sodium-iodide symporter (NIS) protein permits therapy with radioactive iodine. Iodide uptake is lost in 10% of differentiated, and in most dedifferentiated, thyroid carcinomas, making treatment problematic for lack of alternative systemic therapies (1). Potential causes of loss of iodide transport include: NIS gene mutation (2), inhibition of NIS gene transcription, and defective posttranslation processing or trafficking of NIS protein (3). We described loss of NIS expression as consequent to gene transcriptional failure, rather than mutation, and restored it pharmacologically. This was shown when thyroid cancer cell lines (NPA87 and KAK-1) received sodium butyrate (NaB) and 5-azacytidine (azaC), restoring human NIS (hNIS) mRNA as well as functional iodide uptake (4). These compounds reputedly inhibit DNA methyltransferase (5, 6, 7) and histone deacetylase, respectively (8, 9), causing decompression of chromatin structures resulting from enhanced histone acetylation and improving accessibility of transcription factors for gene transcription (10). This suggests a therapeutic direction for restoration of iodide transport in dedifferentiated thyroid cancers.

A direct epigenetic mechanism for azaC and NaB effects on the NIS gene is not certain. Recent studies suggest that these agents might regulate gene transcription through alternative mechanisms. For example, azaC indirectly restores TGF-ß type II receptor expression in the pancreatic cancer cell, MIA PaCa-2, by raising suppressed levels of Sp1 transcription factor (11). NaB augments Sp1 function, inducing transcription from G{alpha}i2 gene promoter attributed to activation of the MAPK kinase (MEK)-ERK signal transduction pathway (12). Moreover, inhibition of the MEK-ERK signal transduction pathway using MEK inhibitor U0126 or suppression of ERK with antisense oligonucleotide inhibited NaB-induced transcription of the G{alpha}i2 gene without affecting trichostatin A (TSA)-induced transcription. Accordingly, we sought to define the mechanism for azaC and NaB effects on restoring NIS expression in thyroid cancer cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell lines

Human papillary thyroid carcinoma cells, NPA87, and anaplastic thyroid carcinoma, DRO, were received from G. J. F. Juillard (Los Angeles, CA). ATC cell line, BHT-101 (BHT), were received from Dr. I. Pályi (Budapest, Hungary) (13). KAT-4B is an ATC cell line, and KAK-1 came from histologically benign follicular adenoma (14) in our laboratory. HepG2 (hepatocellular carcinoma) came from American Type Culture Collection (Manassas, VA). Additional cell lines received from Dr. Michael Kilgore were MCF-7 (breast carcinoma) and 22RV-1 (prostate carcinoma).

Cell culture conditions

High-glucose, phenol red-free DMEM with 10 µg/ml insulin, 1x antibiotic/antimycotic solution (Abx/Antimyc), 1x L-glutamine, 1x sodium pyruvate, 25 mmol/liter HEPES, and 10% fetal bovine serum (FBS) was used for MCF-7 cells. DMEM/F12 (1:1) media with 50 mmol/liter L-glutamine, 1 µg/ml human insulin, and 10% FBS was for HepG2 cultures. RPMI 1640 phenol red-free media with Abx/Antimyc and 10% FBS was used for 22RV-1 cultures. Culture media and supplements were from GIBCO/Invitrogen Corporation (Grand Island, NY). Thyroidal cells grew in phenol red-free RPMI 1640 (10% FBS, 100 nmol/liter sodium selenite, 0.1 nmol/liter bovine TSH at 37 C in 5% CO2). Treatments used the reagents NaB (1 mmol/liter), azaC (0.5 µmol/liter), and TSA (40 ng/ml), or combinations. Media with reagents was replenished every 2 d. All chemicals, including cycloheximide (CHX), puromycin dihydrochloride, anisomycin, and emetine dihydrochloride hydrate, were from Sigma Chemical Company (St. Louis, MO).

Total RNA isolation and quantitative PCR (qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen Corp.), genomic DNA contamination removed using DNA-free kit (Ambion Inc., Austin, TX), and cDNA synthesized from 2 µg total RNA using Advantage RT-for-PCT kit (BD Biosciences Clontech, Palo Alto, CA) with random hexamer primers. TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) and Assay-on-Demand Gene Expression Product (Hs00166567_m1 for hNIS mRNA and Hs99999901_s1 for 18S RNA, respectively; Applied Biosystems) were used for RNA quantitation. Primers, NIS-F (5'-ctgcgtggctctctcagtc-3') and NIS-R (5'-ccctccagctccttctgc-3'), amplified hNIS fragment (1446–1865, +1 is translation initiation codon "A"), followed by ligation into pCR2.1 vector (Invitrogen). The same procedures were followed using 18S-F (5'-atggtgaccacgggtgacg-3') and 18S-R (5'-ttattcctagctgcggtatcc-3') for 18S qPCR standard. These two plasmid DNAs were used, diluted, in qPCRs for quantitation standard curves.

General deoxyribonuclease (DNase) I sensitivity assay

General DNase I sensitivity assay was performed per Kramer et al. (15). To extract nuclei, cells were washed with Hank’s Balanced Salt Solution, trypsinized, pelleted by centrifugation, and suspended in Buffer-1 (Tris-HCl 50 mmol/liter, pH 7.5, MgCl2 10 mmol/liter, CaCl2 1 mmol/liter, 0.1% Nonidet P-40) at a concentration of 3 x 106 cells/ml for 5 min on ice. Suspensions were centrifuged at 580 x g for 5 min (25 C). Nuclei, washed in 3 ml Buffer-2 (Buffer-1 without Nonidet P-40), were resuspended in Buffer-2 at 30 x 106 nuclei/ml. DNase I (Worthington Biochemical Corp., Lakewood, NJ) was added to 1.75 U/ml, and reactions were terminated by adding EGTA (50 mmol/liter). Reaction mixture 100-µl aliquots were collected for genomic DNA isolation (AquaPure Genomic DNA Isolation Kit; Bio-Rad, Hercules, CA).

hNIS gene sequence analysis used RepeatMasker program (www.repeatmasker.org). PCR primers were designed for nonrepeated regions of NIS promoter using PRIMER-3 program (Whitehead Institute, MIT): A–F (5'-ccagttaacccaaggataagc-3', –4686 to –4664); A–R (5'-ctgactcaggagcagaagtgc-3', –4493 to –4513); B–F (5'-gggtggaaggagaaagaactagg-3', –1759 to –1737); B–R (5'-cctctggcctaccctctgc-3', –1525 to –1543); C–F (5'-atctgcaacccacaatcacg-3', –52 to –33); C-R (5'-gttaggaatctatgggctgtcg-3', +177 to +156); D–F (5'-cactgtagaagacctcatcaaacc-3', +10026 to +10049); D–R (5'-ccgtagatgagtgctgtagtgg-3', +10189 to +10168). Transcription initiation site is numbered +1.

Genomic DNA preparations, digested with HindIII plus EcoRI, were quantified using Herchest 33258 fluorescence assay. qPCR was performed in 30-µl volumes containing: 1 U Hotstart Taq DNA polymerase (QIAGEN Inc., Valencia, CA), 400 µmol/liter each dNTP, 105-fold diluted SYBR Green-1 stock (Molecular Probes, Eugene, OR), 10 pmol of each primer and 60 ng HindIII/EcoRI-digested genomic DNA. Reaction mixtures, amplified in Opticon-2 Cycler (MJ Research, Reno, NV), used the following parameters: 15 min at 95 C heat activation, denaturation for 25 sec at 95 C, 25 sec at 61 C annealing, and 25 sec at 72 C elongation for 40 cycles. Copy numbers of genomic DNA after DNase I digestion were normalized to respective genomic DNA.

Construction of promoter constructs with serial deletions

Maximal length hNIS promoter fragment, F-1 (–1320 to –1) was amplified from HindIII/EcoRI-digested genomic DNA of KAK-1 using forward primer F1 (5'-gaggtaccatgtgccaccacgcctcgcta-3') and reverse primer R1 (5'-agaagcttggaggtcgccttggggcttac-3'). Using F-1 as the template, seven forward primers were used: F2 (5'-acggtaccatgcccggcctctgacgc-3'), F3 (5'-acggtaccgccctgagatgacagctc-3'), F4 (5'-gtggtacctgatagggacaagccaga-3'), F5 (5'-gaggtacctgaaaccctgaaagtgaa-3'), F6 (5'-acggtaccacctgtcaacagcagac-3'), F7 (5'-acggtaccagtccagggctgaaagg-3'), together with reverse primer R1. Amplified fragments were: F-2 (–1175 to –1), F-3 (–995 to –1), F-4 (–905 to –1), F-5 (–427 to –1), F-6 (–283 to –1), and F-7 (–131 to –1) (KpnI and HindIII sites are underlined). Genomic DNA fragment-A (–49 to +549), amplified from HindIII/EcoRI-digested KAK-1 genomic DNA, used forward primer A1 (5'-tgcaacccacaatcacgagc-3') and reverse primer R2 (5'-agaagcttgaagctggcagacagcgaca-3').

Fragment-A was template for fragment-A1 (–49 to +425) amplification: forward primer A1 and reverse primer R-A1-M (5'-acaccaggagcaagagggcaaagac-3'). Reverse primer R-A1-M contains A to T mutation at position +414 eliminating potential translation initiation codon; with the same rationale for fragment-A2 (+338 to +549): forward primer F-A2-M (5'-acccgccctcaaggaggccgtgg-3'; T349 changed to A eliminating ATG codon) and reverse primer R2. Fragment-A-M (–49 to +549, T/A349, A/T414) was generated using fragment-A1 and fragment-A2 template mixture: forward primer A1 and reverse primer R2. Fragment F8 (+1 to +549, T/A349, A/T414) amplification used forward primer F8 (5'-gaggtaccgctgtcagcgctgagcacagcg-3') and reverse primer R2 (fragment-A-M was the template). With three putative translation start sites within F8, site-directed mutations (T349A and A414T) were introduced eliminating two potential out-of-frame initiation sites causing open reading frames. DNA fragments, F1 to F8, inserted into pGL3-basic vector (Promega, Madison, WI) at HindIII and KpnI sites, individually, obtained eight luciferase reporter constructs with consecutively shortened hNIS promoter sequences. HSV-Tk promoter fragment was from pRL-Tk plasmid (Promega) after BglII and BamHI digestions, isolated using gel electrophoresis, ligated into pGL3-basic vector in the same insertion sites, and generated pTk-pGL3-Basic plasmid. pGL3-control plasmid and phRG-B plasmid were from Promega.

Transient transfection assay with luciferase reporter constructs

Treatment reagents were administered 24 h after plating. Plasmid/phRG-B/pUC18 were transfected, using Lipofectamine 2000 (Invitrogen), 24 h later. After 24 h, transfection mixtures were replaced with fresh media with reagents. Luciferase and Rennilar luciferase activities were determined 24 h later with the Dual-luciferase Assay Kit (Promega). Normalizing luciferase activity to Rennilar activities, accounted for transfection efficiency and protein-inhibition effects, to compare activities between treatment groups: azaC (0.5 µmol/liter), NaB (1 mmol/liter), TSA (40 ng/ml), and CHX (10 µmol/liter). Triplicate transfections were performed per plasmid, and data were presented as mean ± SD.

Chromatin immunoprecipitation (ChIP) assay and PCR analysis

ChIP assays, using acetyl-histone specific antibodies, were performed to manufacturer’s protocol (Upstate Biotechnology, Lake Placid, NY). Cell cultures were washed with basal medium, formaldehyde added to 1%, rocked x 10 min 25 C, and crosslinking terminated by glycine. Monolayers, washed with EDTA-free protease inhibitors, were scraped and pelleted by centrifugation, resuspended in lysis buffer, and sonicated. Agarose gel electrophoresis revealed DNA in the 200- to 800-bp range. Sonicated chromatin preparations were centrifuged, supernatant diluted 10-fold in ChIP dilution buffer, and precleared by sonicated salmon sperm DNA/protein-A agarose (20 µl per 200 µl) incubation and then incubated overnight with 5 µl of acetylated histone-H3 (acH3) or H4 (AcH4) specific antibody or nonspecific rabbit IgG at 4 C. Immune complexes were precipitated with 20 µl sonicated salmon sperm DNA/protein-A agarose slurry, centrifuged, and washed. Immune complexes were eluted in 0.4 ml buffer (1% sodium dodecyl sulfate, 0.1 M NaHCO3) in two steps. NaCl was added to 200 mmol/liter and crosslinking reversed by heating at 65 C x 4 h. DNA was recovered by phenol/chloroform extraction and ethanol precipitation.

PCR of immunoprecipitated DNA involved activation at 95 C for 5 min; then 37 cycles of denaturation at 95 C for 20 sec, annealing at 64 C for 1 min, and extension at 72 C for 1 min. Primers (upstream 5' to 3'/downstream 5' to 3'): ctgacgctgtttctttcaccc/gaccaccagggaggtagagtc, hNIS-P3; ctggcacagggccaactctca/tcagggtttcaggggacccata, hNIS-P2; gagtgctgaagcaggctgtgc/gggagcagctcgtgattgtgg, hNIS-P1; ctgggactacggggtctttgc/tgccagtggggcaggtccta, hNIS-E1; tgggatggaacctcaggatgg/cagggctgcagcgtctaatact, hNIS-3' untranslated region 1 (UTR1); and tacaggcgtaagctaccatgcc/ccatgtggggtctgaatcatcc, hNIS-3'UTR2. Sequences are numbered according to start codon ATG on the genomic DNA for promoter region primer pairs: P3, P2, and P1, and exonic primer pair, E1, whereas 3' UTR primer pairs are numbered according to ATG on hNIS cDNA sequence: hNIS-P3 (–1511 to –1490/–1216 to –1236; 296 bp); hNIS-P2 (–1147 to –1127/–762 to –783; 385 bp); hNIS-P1 (–692 to –672/–370 to –390; 323 bp); hNIS-E1 (42 to 62/399 to 380; 237 bp); hNIS-3'UTR1 (1962 to 1982/2159 to 2138; 198 bp); and hNIS-3'UTR2 (2476 to 2497/2742 to 2721; 266 bp). The first three primer pairs amplify regions shown to be part of the minimal essential hNIS promoter (16). Primer pair, E1, maps to the first exon, and the other amplified regions (3'UTR1 and 3'UTR2) are immediately downstream of the stop codon and within the transcribed region.

Statistical analysis

Statistical analysis of data used GraphPad Prism 4 software for Macintosh (GraphPad Software, Inc., San Diego, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Restoration of hNIS mRNA expression by 5-azaC and NaB

KAK-1 and NPA87 have no hNIS mRNA under basal cell culture conditions. Adding 5-azaC (0.5 µM) and NaB (1.0 mM) for 3 to 6 d increased hNIS mRNA (Table 1Go). Maximal hNIS mRNA was seen with combination azaC/NaB. After 6 d, KAK-1 cells were replaced with media devoid of these agents to evaluate persistent effects. Culture dishes, analyzed for hNIS mRNA at 1, 2, and 4 d later, showed 30, 19, and 13% of levels before washing, respectively. Although azaC and NaB are individually capable of stimulating hNIS mRNA, their combination increased hNIS expression synergistically; hNIS mRNA levels increased 327-fold and 542-fold for KAK-1 and NPA87 after 6-d treatment and 249-fold and 220-fold for KAK-1 and NPA87 after 3-d treatment, respectively. Conversely, 40 ng/ml TSA did not increase hNIS mRNA despite 3 d of treatment.


View this table:
[in this window]
[in a new window]

  		TABLE 1. NIS mRNA in KAK-1 cells treated with azaC, NaB, and TSA

 
General DNase I sensitivity assay

A total of 5 kb of hNIS gene, 4.8 kb upstream of transcription initiation site (TIS) to 0.2 kb downstream of TIS, was analyzed using the RepeatMasker program. Repetitive sequence regions were excluded from DNase I sensitivity analyses as were those shorter than 200 bp. Three regions were chosen, located 4.5 kb (A, –4686 to –4493 bp) and 1.5 kb (B, –1759 to –1525 bp) upstream of TIS and a region spanning this site (C, –52 to +177 bp). A region, 10 kb downstream of TIS, spanning exon 9 and 10 was included for DNase I assay to assess chromatin status in the middle of hNIS gene (D). These regions (A, B, C, and D) were subjected to DNase I sensitivity assays comparing digestion rates of each region in basal and mRNA-evoking conditions. Regions A and D were resistant to DNase I digestion, both basally and with azaC/NaB, using identical enzyme concentration (1.7 U/ml) that digested regions B and C in basal conditions with regions B and C selected for further analysis.

DNase I digestion sensitivity is reported as time for 50% reduction of corresponding genomic template (D50). Cells, grown 4 d in basal medium, azaC 0.5 µmol/liter and NaB 1 mmol/liter (azaC/NaB), and 40 ng/ml TSA, were evaluated in triplicate experiments. Basal conditions D50 for region B were 5.5 ± 2.2 min (mean ± SD). azaC/NaB increased D50 for region B to 31.6 ± 6.6 min (P < 0.05). With D50 region B at 4.2 ± 0.9 min for control cells, TSA did not alter D50 (4.3 ± 0.2). Under basal conditions, D50 for region C was 12.5 ± 1.8 min. azaC/NaB increased D50 for region C to more than 60 min (P < 0.05). DNase I at 10 U/ml produced similar basal D50 for region D and azaC/NaB treatment resulted in similarly increased D50 for region D (D50 9.5 min basal vs. 30 min azaC/NaB). These results suggest that azaC/NaB treatment, able to restore hNIS transcription, did not open chromatin structure increasing sensitivity to DNase I digestion; instead, suggesting that regions tested were less accessible. This prompted exploration of alternative mechanisms for azaC/NaB to restore hNIS expression. Figure 1Go shows representative DNase I digestion curves. TSA, also expected to reduce D50, was unable to alter DNase I digestion sensitivity for region B.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 1. Representative curves of the relative sensitivity of each hNIS amplicon to digestion by exogenously added DNase I in KAK-1 cells treated with azaC/NaB or TSA for 4 d. A, Basal vs. azaC/NaB treatment for hNIS region B in cells exposed to 1.7 U/ml DNase I. B, Basal vs. TSA treatment for hNIS region B in cells exposed to 1.7 U/ml DNase I. C, Basal vs. azaC/NaB treatment for hNIS region C in cells exposed to 1.7 U/ml DNase I. D, Basal vs. azaC/NaB treatment for hNIS region D in cells exposed to 10 U/ml DNase I. The quantity of each amplicon was plotted relative to the quantity of the product from the undigested amplicon at t = 0 min of digestion. In each graph, the treatment is represented by the dotted line and the control by the solid line.

 
Transient transfection of KAK-1 with luciferase reporter constructs

Considering that trans-active factor(s) could be epigenetically regulated, we used hNIS promoter/luciferase reporter plasmid. F1 construct transfections reproduced effects of NaB seen on endogenous hNIS transcription. NaB treatment increased luciferase activity showing reporter system responsiveness. Conversely, azaC failed to increase luciferase expression with F1. Synergy of NaB/azaC treatment on hNIS mRNA levels was not recapitulated as dramatically as NaB/azaC with F1 construct (Fig. 2Go). We explored whether this was from up-regulation of trans-active stimulating factor(s). If so, CHX should diminish NaB stimulation of luciferase activity.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 2. Effect of azaC and NaB, singly and in combination on luciferase activity of pGL3-basic plasmid and construct F1 in KAK-1 cells. The asterisk indicates that the treatment significantly (P < 0.05) increases the luciferase activity compared with the basal group transfected with the same plasmid. The dagger indicates that the relative luciferase activity in KAK-1 cells transfected with construct F1 under basal conditions is significantly (P < 0.05) higher than that in the same cells transfected with pGL3-basic plasmid under the same conditions. The luciferase activities were normalized by respective transfection efficiencies and by the luciferase activity of KAK-1 cells transfected with pGL3-basic plasmid under basal culture conditions.

 
CHX stimulates luciferase activity in promoter-specific, cell type-specific fashion

Surprisingly, KAK-1 cells, transfected with F1 construct given CHX, increased normalized luciferase activity (Fig. 3Go). With dose response (Fig. 4Go), CHX at 2 µg/ml increased luciferase activity with further increases at higher concentrations. The time course shows this increasing over 2 d of treatment but declining by d 3. Then, cells revealed morphological evidence of stress, suggesting CHX toxicity.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 3. The effect of CHX and other treatments on the luciferase expression from KAK-1 cells transfected with the reporter construct F1. All luciferase activities were normalized by the respective transfection efficiencies and the luciferase activity in KAK-1 cells transfected with construct F1 under basal culture conditions. The asterisks indicate that the treatment significantly (P < 0.05) increased the luciferase activities compared with the control group. The daggers indicate significant (P < 0.05) increases in the luciferase activities for cells undergoing treatments with CHX compared with cells under the same respective treatment without CHX.

 

Figure 4
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 4. The dose effect of CHX on luciferase expression in KAK-1 cells transfected with the reporter construct F1. The asterisks indicate significantly increased luciferase activities compared with the group without CHX (P < 0.05).

 
Testing promoter specificity, pGL3-control plasmid (containing SV40 early promoter and enhancer) and pTk-pGL3-basic (containing HSV-thymidine kinase promoter) were separately transfected into KAK-1 and then received CHX (10 µg/ml). CHX treatment stimulated luciferase activity driven by SV40 promoter, less than by F1 construct, but not HSV-TK promoter, revealing promoter specificity of CHX effects not consequent to indiscriminant cellular effects.

Different cell lines tested cell type specificity of CHX effects on luciferase activity after transfection with F1 construct. Three response groups are revealed (Fig. 5Go). Group I (BHT101, KAT4B, KAK-1, NPA87, and ARO) showed low basal luciferase activity yet were highly responsive to CHX, suggesting expression of putative trans-active repressor ("NIS repressor"). Group II, HepG2 and 22RV-1, showed low basal luciferase activities that were not CHX inducible. Group III, MCF-7 and DRO, revealed higher basal expression of luciferase than the other groups but only slightly increased with CHX treatment.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 5. Cell-type specific effects of CHX on the luciferase expression in different cell lines transfected with reporter construct F1. The first bar of each group of four represents the basal luciferase activity in the specified cells transfected with pGL3-basic plasmid, the second bar represents activity in the same cells transfected with pGL3-basic plasmid with CHX treatment, the third bar of each represents the basal luciferase activity in the same cells transfected with the reporter construct F1, and the fourth bar represents the luciferase activity in the same cells transfected with the reporter F1 with CHX treatment. The first five cell lines, group I (BHT-101, KAT-4B, KAK-1, NPA87, and ARO), represent human thyroid carcinoma cells that exhibit low basal luciferase activity and increased activity in response to CHX. Group II cell lines, Hep G2 (human hepatocellular carcinoma) and 22RV-1 (human prostate carcinoma), are unresponsive to CHX. Group III cell lines, MCF-7 (human breast carcinoma) and DRO-90 (human anaplastic thyroid carcinoma), responded to CHX but had higher basal expression of luciferase with the F1 reporter construct.

 
CHX effect on promoter deletion constructs demonstrates regional specificity

Transfections with seven reporter constructs, each with longer deletions from 5' end of hNIS promoter, were performed to determine a CHX-responsive region in hNIS promoter. Normalized luciferase activity response to CHX (Table 2Go) showed sequential deletions of hNIS promoter (with constructs F1–F7) exhibited similar response to CHX treatment until promoter region –427 to –283 was deleted (F6). Additional deletion of region –283 to –131 (F7) reduced luciferase response to CHX similarly as to pGL3-basic plasmid and F8 construct. This (Fig. 6Go) suggests a CHX-responsive region of hNIS promoter lies between –427 and –131 bp and is obligatory for CHX-induced hNIS transcription.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Luciferase activities (normalized to control cultures) of different reporter plasmids with NaB and CHX treatment

 

Figure 6
View larger version (37K):
[in this window]
[in a new window]

  		FIG. 6. Relative luciferase activities from KAK-1 cells transfected with different deletion reporter constructs under basal, NaB, and CHX treatments. Luciferase activities were normalized by the respective transfection efficiencies and by the luciferase activity in KAK-1 cells transfected with pGL3-basic plasmid under basal culture conditions. In all groups, except the group transfected with the pGL3-basic plasmid, the differences between the luciferase activities of each treatment and each corresponding control were significant (P < 0.05).

 
Additional protein synthesis inhibitors affect F1 luciferase reporter activities

KAK-1 was treated with anisomycin at 0.1, 0.4, and 1.0 µg/ml with F1 construct transfected and with pGL-3 basic reference plasmid and assayed at 48 h. Luciferase activity with pGL-3 basic plasmid showed 4.8-fold increase with lowest anisomycin concentration but declined with two higher doses. The F1 construct showed greater response to anisomycin, increasing activity over vehicle with increasing doses: 3.3-fold increase with 0.1 µg/ml, 19.9-fold increase with 0.4 µg/ml, and 25.7-fold increase with 1.0 µg/ml. Likewise, emetine at 0.5, 1.0, and 2.0 µg/ml increased luciferase activity with pGL-3 basic plasmid by 2.3-fold with the lowest emetine dose and no further changes with two higher doses. Similarly, F1 construct activity revealed greater dose response to emetine: 1.8-fold increase with 0.5 µg/ml, 6.3-fold increase with 1.0 µg/ml, and 8.6-fold increase with 2.0 µg/ml. Conversely, puromycin had no effect on pGL-3 basic plasmid and lack of response with F1 luciferase construct.

Restoration of hNIS mRNA level by CHX, NaB, and 5-azaC singly and combined

To verify luciferase reporter assay results reflected endogenous hNIS promoter response, we tested CHX treatment on endogenous hNIS mRNA levels in KAK-1 using quantitative RT-PCR (Table 3Go). CHX, 10 µg/ml for 3 d, increased hNIS mRNA levels 24-fold in KAK-1 cells alone and more than 350-fold combined with azaC. This synergy was not seen with CHX combined with NaB, producing only additive effects. Effects of azaC/NaB/CHX were similar to those with azaC/CHX, because addition of NaB did not further augment hNIS mRNA levels.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Normalized hNIS mRNA levels in KAK-1 cells treated for 3 d with combinations of azaC, NaB, and CHX

 
Acetylated-histone-specific antibodies immunoprecipitate a specific region of the hNIS promoter in 5-azaC- and NaB-treated cells

ChIP assays of chromatin from control and treated NPA87 and KAK-1 cells analyzed genomic DNA fragments corresponding to regions of the hNIS promoter (P1, P2, and P3), the first exon and two proximate 3' UTRs. AcH4 antibodies immunoprecipitated the P2 region of hNIS promoter in both cell lines treated with NaB but not in chromatin from control cells. Also, AcH4 immunoprecipitated the P2 region in azaC-treated NPA87 cells. AcH3-specific antibodies were similarly able to immunoprecipitate the P2 region in NaB-treated KAK-1 cells and not in control cells; however, this antibody did not immunoprecipitate the P2 region in NPA87 cells despite hNIS mRNA-restoring treatments. P1 and P3 regions showed both H3 and H4 acetylation under basal conditions unaffected by azaC (in NPA87). H4 acetylation slightly increased by NaB (in both cell lines), but H3 acetylation was unaffected by NaB in those regions.

azaC did not affect H3 or H4 acetylation in hNIS exon 1 (E1) or in the 3'UTR1 and 3'UTR2 regions of NPA87 cells. These regions had slight basal acetylation of both H3 and H4 in both NPA87 and KAK-1 cells (except for lack of H3 acetylation in E1 of NPA87). In NPA87 cells, NaB enhanced H3 and H4 acetylation of E1 region and H3 acetylation of 3'UTR1 region. NaB effects in KAK-1 were to enhance acetylation of H4 in both E1 and 3'UTR1 regions. The only consistent acetylation findings, correlated with hNIS mRNA expression in both cell lines, were limited to H4 of the P2 region.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Epigenetic silencing is generally accepted as causing loss of NIS expression in thyroid carcinoma cells based on absence of hNIS mutations in dedifferentiated cells, presence of hNIS promoter hypermethylation (4), and restoration of hNIS transcription using putative epigenetic agents (4, 17, 18, 19, 20). ChIP analysis, analyzing effects of azaC and NaB treatments, seemed to suggest that H4 acetylation of the P2 hNIS promoter region presaged active hNIS transcription. For validation of this mechanism, DNase I digestion sensitivity was used to assess hNIS chromatin openness (accessibility to transcriptional machinery). Surprisingly, these two agents that restored hNIS transcription, azaC and NaB, did not enhance DNase I sensitivity. Additionally, despite histone deacetylase inhibition by TSA, putatively restoring gene expression from compacted chromatin, it did not restore hNIS mRNA expression. Notwithstanding two reports that TSA increased hNIS mRNA levels in thyroid carcinoma cell lines (17, 21), this was not seen with multiple thyroid cancer lines in our laboratory (this study and unreported results).

Our previous study, demonstrating azaC restoration of hNIS expression, suggested "direct" effects by altering methylation status of the hNIS promoter (4). Alternatively, a parallel mechanism, reexpressing requisite trans-active transcription factors by preventing methylation of their respective promoters, is "indirect" in respect to the hNIS gene. Puppin et al. (21) could not correlate NaB-induced expression of hNIS with parallel increases in TTF-1, TTF-2, nor Pax-8, suggesting consideration of alternative transcription factors for an indirect mechanism. NaB mechanisms are uncertain. Butyrates may increase histone acetylation status (23), permitting gene transcription as a direct effect; however, indirect mechanisms, suggested by Nakano et al. (24), involve NaB activating transcription by unspecified interactions with Sp1-binding sites in promoter regions of WAF1/Cip1 in colon cancer cells. Likewise, similar NaB effects on G{alpha}i2 were ascribed to activation of MEK/ERK pathways, interacting with G{alpha}i2 promoter Sp1-binding sites in a leukemia line (12). Clearly, precise mechanisms of butyrate effects are not fully understood. Lack of enhanced hNIS DNase I sensitivity after combination NaB/azaC treatments suggests alternative processes from hNIS histone acetylation changes, an indirect mechanism.

Potential technical pitfalls implicit in DNase I sensitivity assays include clumping of nuclei preparations causing difficult assay standardization and extreme sensitivity to DNase I concentrations in the digestion mixture requiring careful reagent titration. Nonetheless, results were consistent and reproducible for two different promoter regions, 1.3 kb away from each other, despite use of different DNase I concentrations. Although not excluding all direct effects on hNIS chromatin structure, as suggested by H4 acetylation effects in the P2 promoter region, we considered alternative mechanisms.

Combination NaB/azaC treatment is more than additive in stimulating hNIS mRNA, suggesting synergistic hNIS transcription effects. Lack of azaC effect on the F1 construct luciferase activity is likely consequent to lack of plasmid CpG methylation. Conversely, NaB stimulated significant luciferase activity with no greater response with the NaB/azaC combination. Nonintegrated transfected plasmid DNA is capable of nucleosome assembly with response to NaB by enhanced histone acetylation, increased gene expression, and greater DNase I digestion sensitivity (25). This might explain how NaB increased F1 construct luciferase activity; however, differences between plasmid nucleosome structure and native hNIS preclude this assumption (26). Alternative explanations for NaB effects involve changes in trans-active factors, an indirect effect.

In contrast, Furuya et al. (18) treated ARO (anaplastic) and BHP18–21v (papillary thyroid cancer) lines with CHX during studies of depsipeptide effects on hNIS, thyroid peroxidase (TPO) and thyroglobulin (TG) expression. At CHX 30 µg/ml, they did not see increased hNIS mRNA compared with CHX 10 µg/ml used in our study, suggesting cellular toxicity with the higher dose, although CHX induced TPO and TG mRNA. This inspired them to postulate the presence of a protein inhibitor of only TPO and TG gene expression. We also found CHX to increase TPO and TG mRNA in KAK-1 cells (data not shown). Our results show CHX activating both native hNIS and promoter constructs in a similar fashion, suggesting an endogenous transacting protein inhibitor of hNIS transcription.

Transcription factors and signaling pathways, important for NIS expression and membrane targeting, include: TSHr (27), TTF-1 (28), and Pax-8 (29). We suggest that a cellular milieu containing these factors constitutes a permissive environment for hNIS expression such as in breast and thyroid-derived cells capable of expressing hNIS in vivo. Conversely, liver and prostate-derived cells, without native hNIS, constitute a nonpermissive environment despite treatment with CHX (Fig. 5Go), revealing F1 luciferase activity reflecting these differences. Despite a permissive environment, inhibitory agents may prevent hNIS expression. We suggest a candidate agent is a trans-active inhibitor (NIS repressor) binding to the hNIS promoter region approximately –427 to –131 bp from the transcriptional start site.

Although CHX, anisomycin, and emetine are protein synthesis inhibitors, they have additional effects. Both CHX and anisomycin induce cyclooxygenase-2 expression by phosphorylating the p38 MAPK (30). Alternatively, CHX decreased phosphorylation of p53 in HepG2 cells (31), whereas Wu et al. (32) showed that it enhanced mRNA levels of phosphorylation genes, perhaps related to a mRNA stabilization effect (33), a process known as superinduction (34, 35). Phosphorylation effects are seen with anisomycin and puromycin (36). There may be gene regulation effects of anisomycin independent of both protein synthesis inhibition and MAPK phosphorylation (37). This suggests potential effects on hNIS from altered processing such as phosphorylation of a trans-active factor binding to hNIS promoter, also an indirect effect on hNIS transcription. This could alter a requisite stimulatory transcription factor so that it no longer binds to the promoter. The NIS repressor promoter binding site covers two binding sites for PAX-8 (28) and one for NIS-TSH response factor, NTF-1 (38). These, or other uncharacterized transcriptional factors, may be candidate substrates for differential processing.

Treatments with combinations of azaC/NaB or azaC/CHX stimulate hNIS transcription approximately 350-fold over baseline expression in KAK-1 cells, representing hNIS mRNA levels 5 to 10% of those in normal thyroid tissue. Differentiated thyroid carcinomas, clinically responsive to radioiodine therapy, concentrate radioiodine 3- to 17-fold less than normal thyroid tissue (22). Therapeutic targeting of the NIS repressor seems capable of restoring iodine avidity to a level sufficient to permit clinical responses to radioiodine therapy. Further characterization and identification of this trans-active inhibitor of hNIS transcription could illuminate this target to restore the effectiveness of radioiodine treatment.


   Acknowledgments
 
We are indebted to Dr. Stephen A. Krawetz (Department of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, Wayne State University School of Medicine) for his assistance with DNase I sensitivity methodology, to Dr. Louis Hersh for his advice, and to Dr. Michael Kilgore for providing MCF-7 and 22RV-1 cell lines.


   Footnotes
 
This work was supported by VA Merit Review 596-0003, National Cancer Institute Grant K24CA82116, and the Ephraim McDowell Cancer Research Foundation, Lexington, Kentucky (all to K.B.A.).

Disclosure Statement: W.L. has nothing to declare. K.B.A. and G.M.V are inventors on U.S. Patent No. 6,015,376 (issued 1/18/00) and U.S. Patent No. 7,029,879 (issued 4/18/06).

First Published Online December 12, 2006

Abbreviations: azaC, 5-Azacytidine; ChIP, chromatin immunoprecipitation; CHX, cycloheximide; DNase, deoxyribonuclease; FBS, fetal bovine serum; hNIS, human NIS; MEK, MAPK kinase; NaB, sodium butyrate; NIS, sodium-iodide symporter; qPCR, quantitative PCR; TG, thyroglobulin; TIS, transcription initiation site; TPO, thyroid peroxidase; TSA, trichostatin A; UTR, untranslated region.

Received September 26, 2006.

Accepted December 1, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Robbins J, Merino MJ, Boice Jr JD, Ron E, Ain KB, Alexander HR, Norton JA, Reynolds J 1991 Thyroid cancer: a lethal neoplasm. Ann Intern Med 115:133–147[CrossRef][Medline]
  2. Pohlenz J, Refetoff S 1999 Mutations in the sodium/iodide symporter (NIS) gene as a cause for iodide transport defects and congenital hypothyroidism. Biochimie (Paris) 81:469–476
  3. Pohlenz J, Duprez L, Weiss RE, Vassart G, Refetoff S, Costagliola S 2000 Failure of membrane targeting causes the functional defect of two mutant sodium iodide symporters. J Clin Endocrinol Metab 85:2366–2369[Abstract/Free Full Text]
  4. Venkataraman GM, Yatin M, Marcinek R, Ain KB 1999 Restoration of iodide uptake in dedifferentiated thyroid carcinoma: relationship to human Na+/I-symporter gene methylation status. J Clin Endocrinol Metab 84:2449–2457[Abstract/Free Full Text]
  5. Santi DV, Norment A, Garrett CE 1984 Covalent bond formation between a DNA-cytosine methyltransferase and DNA containing 5-azacytosine. Proc Natl Acad Sci USA 81:6993–6997[Abstract/Free Full Text]
  6. Gabbara S, Bhagwat AS 1995 The mechanism of inhibition of DNA (cytosine-5-)-methyltransferases by 5-azacytosine is likely to involve methyl transfer to the inhibitor. Biochem J 307:87–92
  7. Juttermann R, Li E, Jaenisch R 1994 Toxicity of 5-aza-2'-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc Natl Acad Sci USA 91:11797–11801[Abstract/Free Full Text]
  8. Sawa H, Murakami H, Ohshima Y, Murakami M, Yamazaki I, Tamura Y, Mima T, Satone A, Ide W, Hashimoto I, Kamada H 2002 Histone deacetylase inhibitors such as sodium butyrate and trichostatin A inhibit vascular endothelial growth factor (VEGF) secretion from human glioblastoma cells. Brain Tumor Pathol 19:77–81[CrossRef][Medline]
  9. Zhou JF, Liu WL, Chen G, Lu YP, Ma D 2002 [Molecular mechanism of inhibition of sodium butyrate on activation of tumor associated aromatase promoters.] Ai Zheng 21:1283–1287[Medline]
  10. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  11. Venkatasubbarao K, Ammanamanchi S, Brattain MG, Mimari D, Freeman JW 2001 Reversion of transcriptional repression of Sp1 by 5 aza-2' deoxycytidine restores TGF-ß type II receptor expression in the pancreatic cancer cell line MIA PaCa-2. Cancer Res 61:6239–6247[Abstract/Free Full Text]
  12. Yang J, Kawai Y, Hanson RW, Arinze IJ 2001 Sodium butyrate induces transcription from the G {alpha}(i2) gene promoter through multiple Sp1 sites in the promoter and by activating the MEK-ERK signal transduction pathway. J Biol Chem 276:25742–25752[Abstract/Free Full Text]
  13. Palyi I, Peter I, Daubner D, Vincze B, Lorincz I 1993 Establishment, characterization and drug sensitivity of a new anaplastic thyroid carcinoma cell line (BHT-101). Virchows Arch B Cell Pathol Incl Mol Pathol 63:263–269[Medline]
  14. Ain KB, Taylor KD 1994 Somatostatin analogs affect proliferation of human thyroid carcinoma cell lines in vitro. J Clin Endocrinol Metab 78:1097–1102[Abstract]
  15. Kramer JA, Krawetz SA 1997 Determining the potentiative state of a chromatin domain. Biotechniques 22:879–882[Medline]
  16. Venkataraman GM, Yatin M, Ain KB 1998 Cloning of the human sodium–iodide symporter promoter and characterization in a differentiated human thyroid cell line, KAT-50. Thyroid 8:63–69[Medline]
  17. Zarnegar R, Brunaud L, Kanauchi H, Wong M, Fung M, Ginzinger D, Duh QY, Clark OH 2002 Increasing the effectiveness of radioactive iodine therapy in the treatment of thyroid cancer using Trichostatin A, a histone deacetylase inhibitor. Surgery 132:984–990; discussion 990[CrossRef][Medline]
  18. Furuya F, Shimura H, Suzuki H, Taki K, Ohta K, Haraguchi K, Onaya T, Endo T, Kobayashi T 2004 Histone deacetylase inhibitors restore radioiodide uptake and retention in poorly differentiated and anaplastic thyroid cancer cells by expression of the sodium/iodide symporter thyroperoxidase and thyroglobulin. Endocrinology 145:2865–2875[Abstract/Free Full Text]
  19. Fortunati N, Catalano MG, Arena K, Brignardello E, Piovesan A, Boccuzzi G 2004 Valproic acid induces the expression of the Na+/I- symporter and iodine uptake in poorly differentiated thyroid cancer cells. J Clin Endocrinol Metab 89:1006–1009[Free Full Text]
  20. Kitazono M, Robey R, Zhan Z, Sarlis NJ, Skarulis MC, Aikou T, Bates S, Fojo T 2001 Low concentrations of the histone deacetylase inhibitor, depsipeptide (FR901228), increase expression of the Na(+)/I(-) symporter and iodine accumulation in poorly differentiated thyroid carcinoma cells. J Clin Endocrinol Metab 86:3430–3435[Abstract/Free Full Text]
  21. Puppin C, D’Aurizio F, D’Elia AV, Cesaratto L, Tell G, Russo D, Filetti S, Ferretti E, Tosi E, Mattei T, Pianta A, Pellizzari L, Damante G 2005 Effects of histone acetylation on sodium iodide symporter promoter and expression of thyroid-specific transcription factors. Endocrinology 146:3967–3974[Abstract/Free Full Text]
  22. Pochin EE 1971 Radioiodine therapy of thyroid cancer. Semin Nucl Med 1:503–515[Medline]
  23. Lea MA, Randolph VM, Hodge SK 1999 Induction of histone acetylation and growth regulation in eryrthroleukemia cells by 4-phenylbutyrate and structural analogs. Anticancer Res 19:1971–1976[Medline]
  24. Nakano K, Mizuno T, Sowa Y, Orita T, Yoshino T, Okuyama Y, Fujita T, Ohtani-Fujita N, Matsukawa Y, Tokino T, Yamagishi H, Oka T, Nomura H, Sakai T 1997 Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line. J Biol Chem 272:22199–22206[Abstract/Free Full Text]
  25. Reeves R, Gorman CM, Howard B 1985 Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells. Nucleic Acids Res 13:3599–3615[Abstract/Free Full Text]
  26. Smith CL, Hager GL 1997 Transcriptional regulation of mammalian genes in vivo. A tale of two templates. J Biol Chem 272:27493–27496[Free Full Text]
  27. Riedel C, Levy O, Carrasco N 2001 Post-transcriptional regulation of the sodium/iodide symporter by thyrotropin. J Biol Chem 276:21458–21463[Abstract/Free Full Text]
  28. Schmitt TL, Espinoza CR, Loos U 2001 Transcriptional regulation of the human sodium/iodide symporter gene by Pax8 and TTF-1. Exp Clin Endocrinol Diabetes 109:27–31[CrossRef][Medline]
  29. Pasca di Magliano M, Di Lauro R, Zannini M 2000 Pax8 has a key role in thyroid cell differentiation. Proc Natl Acad Sci USA 97:13144–13149[Abstract/Free Full Text]
  30. Shafer LM, Slice LW 2005 Anisomycin induces COX-2 mRNA expression through p38(MAPK) and CREB independent of small GTPases in intestinal epithelial cells. Biochim Biophys Acta 1745:393–400[Medline]
  31. Bai J, Cederbaum AI 2006 Cycloheximide protects Hepg2 cells from serum withdrawal induced apoptosis by decreasing p53 and phosphorylated p53 levels. J Pharmacol Exp Ther 319:1435–1443[Abstract/Free Full Text]
  32. Wu Y, Rozenfeld S, Defferrard A, Ruggiero K, Udall JA, Kim H, Llewellyn DJ, Dennis ES 2005 Cycloheximide treatment of cotton ovules alters the abundance of specific classes of mRNAs and generates novel ESTs for microarray expression profiling. Mol Genet Genomics 274:477–493[CrossRef][Medline]
  33. Hershko DD, Robb BW, Wray CJ, Luo GJ, Hasselgren PO 2004 Superinduction of IL-6 by cycloheximide is associated with mRNA stabilization and sustained activation of p38 map kinase and NF-{kappa}B in cultured caco-2 cells. J Cell Biochem 91:951–961[CrossRef][Medline]
  34. Edwards DR, Mahadevan LC 1992 Protein synthesis inhibitors differentially superinduce c-fos and c-jun by three distinct mechanisms: lack of evidence for labile repressors. EMBO J 11:2415–2424[Medline]
  35. Pontecorvi A, Tata JR, Phyillaier M, Robbins J 1988 Selective degradation of mRNA: the role of short-lived proteins in differential destabilization of insulin-induced creatine phosphokinase and myosin heavy chain mRNAs during rat skeletal muscle L6 cell differentiation. EMBO J 7:1489–1495[Medline]
  36. Joiakim A, Mathieu PA, Elliott AA, Reiners Jr JJ 2004 Superinduction of CYP1A1 in MCF10A cultures by cycloheximide, anisomycin, and puromycin: a process independent of effects on protein translation and unrelated to suppression of aryl hydrocarbon receptor proteolysis by the proteasome. Mol Pharmacol 66:936–947[Abstract/Free Full Text]
  37. Vazquez-Macias A, Ruiz-Mendoza AB, Fonseca-Sanchez MA, Briones-Orta MA, Macias-Silva M 2005 Downregulation of Ski and SnoN co-repressors by anisomycin. FEBS Lett 579:3701–3706[CrossRef][Medline]
  38. Ohmori M, Endo T, Harii N, Onaya T 1998 A novel thyroid transcription factor is essential for thyrotropin-induced up-regulation of Na+/I- symporter gene expression. Mol Endocrinol 12:727–736[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
M. S. Fenton, K. M. Marion, and J. M. Hershman
Identification of Cyclic Adenosine 3',5'-Monophosphate Response Element Modulator as an Activator of the Human Sodium/Iodide Symporter Upstream Enhancer
Endocrinology, May 1, 2008; 149(5): 2592 - 2606.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Ain, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Ain, K. B.
Related Collections
Right arrow Thyroid

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals