Journal of Clinical Endocrinology & Metabolism
, doi:10.1210/jc.2006-1963
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 3 1008-1014
Copyright © 2007 by The Endocrine Society
Normal Female Phenotype and Ovarian Development Despite the Ovarian Expression of the Sex-Determining Region of Y Chromosome (SRY) in a 46,XX/69,XXY Diploid/Triploid Mosaic Child Conceived after in Vitro FertilizationIntracytoplasmic Sperm Injection
Ozgur Oktem1,
Darius A. Paduch1,
KangPu Xu,
Anna Mielnik and
Kutluk Oktay
Center for Reproductive Medicine and Infertility (O.O., D.A.P., K.X., K.O.) and the Department of Urology (D.A.P.), Weill Medical College of Cornell University, New York, New York 10021; and The Population Council, Center for Biomedical Research (D.A.P., A.M.), New York, New York 10021
Address all correspondence and requests for reprints to: Dr. Kutluk Oktay, Center for Reproductive Medicine and Infertility, Weill Medical College of Cornell University, 505 East 70th Street, Suite HT300, New York, New York 10021. E-mail: koktay{at}fertilitypreservation.org.
 |
Abstract
|
|---|
Context: Diploid/triploid mosaicism (mixoploidy) is a rare chromosomal abnormality characterized by mental and growth retardation, hypotonia, and dysmorphic features such as facial asymmetry, low-set ears, and syndactyly. All 46,XX/69,XXY cases fall into three phenotypic groups: male with testicular development, ovotestis disorder of sex development (DSD), or undervirilized male DSD. All phenotypic females with diploid/triploid mosaic reported so far had 46,XX/69,XXX karyotype.
Patient: We report an 8-year-old girl conceived after in vitro fertilizationintracytoplasmic sperm injection with normal internal/external genital and ovarian development despite 46,XX/69,XXY mosaicism and normal expression of sex-determining region of Y chromosome (SRY) in her gonads.
Intervention: Because of the increased risk of gonadoblastoma resulting from Y chromosome mosaicism, her ovaries were removed by laparoscopy. Ovarian tissue was analyzed histologically as well as by fluorescence in situ hybridization, PCR, and RT-PCR amplification to determine the localization of Y chromosome and expression of SRY and DAX1 mRNA. Methylation-specific PCR was used to assess the inactivation pattern of X chromosomes.
Results: By laparoscopy, internal female genital anatomy appeared to be normal. Cytogenetic and molecular methods confirmed the presence of intact and functionally active Y chromosome in the ovary. Strikingly, histological assessment of the gonads showed normal ovarian architecture with abundant primordial follicles despite the presence of the Y chromosome in ovarian follicles and the expression of SRY mRNA in gonadal tissue.
Conclusion: This case illustrates that normal ovarian development is possible in the presence of Y chromosome in ovarian follicles and despite the expression of SRY in ovarian tissue. Furthermore, this is the first documented case of mixoploidy after in vitro fertilizationintracytoplasmic sperm injection and the only phenotypic female with 46,XX/69,XXY karyotype.
 |
Introduction
|
|---|
DIPLOID/TRIPLOID MOSAICISM (mixoploidy; a mixture of cell populations whose component cells differ in their chromosome numbers irrespective of whether these numbers are euploid or aneuploid) is a rare dysmorphic syndrome characterized by mental and growth retardation, facial asymmetry, truncal obesity, syndactyly, hypotonia, and low-set ears (1). Although all reported 46,XX/69,XXX cases were phenotypically females (2, 3, 4, 5, 6, 7, 8), all mosaic patients with 46,XX/69,XXY karyotype had male phenotype or ovotestis disorder of sex development (9, 10, 11, 12, 13, 14, 15) (Table 1
). The latter conforms to the accepted paradigm that the presence of functional Y chromosome will result in testicular differentiation of the multipotent gonad. The following mechanism can explain the proposed mechanism of diploidy/triploidy: 1) incorporation of the second polar body into one blastomere after the formation of diploid zygote; 2) chimerism (defined as the presence of two or more genetically different cell lines each of which was derived from different zygotes) as a result of the fusion of a diploid embryo and a triploid embryo; and 3) delayed incorporation of a second sperm pronucleus into one blastomere after diploid zygote has been formed (2, 9, 10). Besides a normal diploid cell line, a second triploid cell line is present in varying degrees and tissue distribution. Blood karyotype is normal in 75% of the patients, and diagnosis can be made after analysis of other cell types such as fibroblasts (3). The presence of diploid/triploid mosaicism affects patients survival, which can range from hours (16) to 21 yr (17).
 |
Patients and Methods
|
|---|
Patient
The proband was born to a 35-yr-old mother at 38 wk gestation by vaginal delivery after being induced for idiopathic oligohydroamnios. The pregnancy had been achieved via intracytoplasmic sperm injection (ICSI). Consanguinity was denied. Her birth weight was 2300 g, and her length was 43 cm. Although the neonatal course was unremarkable, her later development was delayed. She could not sit without support until 1 yr of age and was unable to walk until 18 months of age, and language development began at approximately 2 yr. She was initially evaluated at age 3 as a result of growth and developmental delay and abnormal pigmentation, and high-resolution chromosome analysis on the blood turned normal. Skin biopsy was suggested, but the parents elected not to proceed with it. Later, the proband was reevaluated, and skin biopsy was performed as a result of persistence of her developmental delay, which showed 46,XX/69,XXY in skin fibroblasts.
She had no facial dysmorphic features but had cutaneus syndactyly of her second and third toes bilaterally, fifth finger clinodactyly, growth retardation, and abnormal pigmentation on the dorsum following Blaschko lines. The proband is currently experiencing mild learning disabilities and attention deficit disorder but has no mental retardation as is typically described in this syndrome. At the age of 8, the patient underwent bilateral laparoscopic oophorectomy because of the increased risk of gonadoblastoma resulting from the presence of the Y chromosome. Her ovarian tissue was cryopreserved per her parents request for potential fertility preservation (18) after obtaining institutional review board-approved research consent.
Methods
The peripheral blood and fibroblast cultures were used for cytogenetic analysis using standard techniques. Representative sections of the gonads were paraffin-embedded, serially sectioned, and stained with hematoxylin for histomorphological evaluation. Fluorescence in situ hybridization (FISH) was performed to identify X and Y chromosomes in the tissue. Once the presence of sex-determining region of Y chromosome (SRY) locus and Y chromosome was established by FISH, further molecular methods were used to verify the presence of intact Y chromosome, to verify expression of SRY mRNA, and to analyze X chromosome inactivation using X inactivation-specific transcript (XIST) primers and methylation-specific PCR (MS-PCR). In addition, expression of DAX1 and SOX9 was assessed. DNA and total RNA were extracted from the ovarian tissue. DNA was deaminated for MS-PCR. The entire Y chromosome was divided into smaller fragments, and using a set of multiple primers spanning most euchromatin of long and short arms of Y chromosome, the chromosome was screened to exclude microdeletions, duplications, inversions, and translocations. We amplified and screened the entire SRY region from proband plus upstream promoter sequence to exclude missense mutations in SRY as a cause of ovarian development of undifferentiated gonad. Subsequently, expression of SRY, DAX1, and SOX9 mRNA was verified using RT-PCR. The presence of one copy of active X chromosome and one copy of inactive X chromosome was verified using MS-PCR. For a more detailed explanation of the methods, see supplemental data published on The Endocrine Societys Journals Online web site at http://jcem.endojournals.org.
 |
Results
|
|---|
The patients karyotype analysis from peripheral blood was normal; skin biopsy revealed a mosaic chromosome complement of 46,XX/69,XXY or 46,XX/69,XX+mar (Fig. 1A
). However, subsequent FISH analysis with X centromere and SRY (Yp11.3) showed that the marker chromosome was indeed the Y chromosome and verified the presence of SRY.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 1. Normal ovarian development despite the 46,XX/69,XXY mosaicism and expression of SRY in ovarian tissue. A, Chromosome analysis of skin fibroblasts showing triploid cell line 69,XXY. First cytogenetic analysis of skin fibroblasts showed 46,XX/69,XX+"mar" (marker) in addition to the 46,XX/69,XXY karyotype. Further analysis of skin fibroblasts using FISH analysis with SRY (Yp11.3) confirmed that the marker chromosome was indeed the Y chromosome. B, Normal-appearing infantile uterus, fallopian tubes, and ovaries at laparoscopy. C, Paraffin section of the patients ovary showing primordial follicles in abundance after staining with hematoxylin. Scale bar, 100 µm. D, Ovarian section from a patient with similar age and normal karyotype showing normal ovarian architecture and primordial follicles. Scale bar, 100 µm. E, A normal-appearing early antral follicle with neighboring primordial follicles in the patients ovary. The dotted area in the inset shows the same follicle at lower magnification with its relationship to the cortical surface and neighboring primordial follicles. GC, Granulosa cells; O, oocyte; AS, antral space; BL, basal lamina; TI, theca interna; PF, primordial follicle. Scale bars, 100 µm. F, FISH analysis shows primordial follicles with pregranulosa cells positive for CEP Y (red signal), CEP X (blue signal), and chromosome 18 (control, green signal). PF, Primordial follicle. Scale bar, 25 µm. G, FISH analysis shows Sry (red signal), CEP Y (blue), and CEP X (green) presence in stromal cells. Scale bar, 10 µm.
|
|
Uterus, fallopian tubes, and both ovaries appeared to be normal during the surgery (Fig. 1B
). Strikingly, the gonads had normal ovarian histomorphology despite the presence of SRY. The ovarian cortex harbored many morphologically normal primordial follicles with follicle density of 24.6 ± 6.8 (mean ± SE primordial follicles/mm2), which was comparable to the primordial follicle density (23.2 ± 5.4/mm2) of a 10-yr-old girl with normal karyotype whose one ovary was removed before receiving chemotherapy for leukemia (Fig. 1
, C and D). Morphologically normal follicle development was observed up to early antral stages (Fig. 1E
). Interestingly, FISH analysis on paraffin sections showed that the pericentromeric Y is abundantly present in both granulosa cells of primordial follicles (Fig. 1F
) and in the stromal cells, whereas SRY could only be demonstrated in stroma (Fig. 1G
).
Molecular analysis using multiplex PCR showed intact Y chromosome without any microdeletions, translocations, or duplications. Designed probes spanned the entire euchromatin region of Y chromosome and extended beyond the pericentromeric area, which is a target for Y chromosome FISH probe (see supplemental Table 1). The amplification of each Y chromosome marker in proband and in male controls was identical, although bands for SY1264 and SY1257 STSs were less intense (Fig. 2
). The significance of weaker expression is doubtful because we see a similar pattern in normal men, and single PCR verified the presence of both SY1264 and SY1257.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 2. Y chromosome analysis using multiplex PCR shows presence of normal Y chromosome. Numbers to the side of the gel correspond to STSs analyzed. H20, Water-negative control; 46,XYq (), negative control DNA from a patient with deletion of the entire long arm; PROBE, DNA extracted from patient; MALE1 and MALE2, positive controls from two healthy fertile males.
|
|
To exclude missense mutations in the SRY gene and promoter, the upstream region of the SRY sequence and the flanking genomic regions were screened for single nucleotide polymorphism using the HPLC WAVE system. This method has been commonly used to identify single nucleotide polymorphism and is less prone to nucleotide misincorporation than sequencing. The HPLC analysis showed that the coding sequence of SRY is exactly the same as the coding sequence of fertile male controls, thus excluding mutations in SRY as a cause of ovarian development (Fig. 3
). In addition, the entire SRY coding sequence plus the region spanning from 1191 bp from ATG initiation site to +94 bp was sequenced. There were no nucleotide changes detected.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3. Analysis of the coding sequence of Sry by the HPLC-WAVE system showing that the Sry has identical coding sequence as that of fertile male control, thus excluding mutations in Sry. Two sets of overlapping primers were designed to screen for single nucleotide polymorphism in the Sry gene and flanking regions. The graphs represent chromatograms from actual analysis. Single peak after hybridization of proband DNA with wild-type DNA means there are no nucleotide changes. WT, Wild-type DNA; WT+PRO, wild-type hybridized with proband DNA using HPLC-WAVE system.
|
|
To verify that the promoter of the SRY was active and SRY-transcribed, the RT-PCR using total RNA extracted from the ovary was performed, and results were compared with total RNA from human testis. SY14 primers were used to verify the presence of SRY mRNA, and two additional primers were designed for genomic contamination control (SRY-1 and SRY-2). Each SRY-1 and SRY-2 primer set had a primer within the transcribed sequence and other primers at 5' or 3' nontranslated, genomic sequence (Fig. 4
). In case of genomic contamination of RNA, all three primer sets should produce amplicons. If RNA is pure, then only SY14 product is expected. Genomic DNA was used for positive control of reaction efficacy. RT-PCR showed normal-sized SRY mRNA expressed in the probands ovary and no expression using SRY-1 and SRY-2 control primers. The amount of SRY mRNA was 25% of that of control human testis, and it represents the fact that only approximately 20% of cell in the ovary had the Y chromosome based on quantitative PCR (Fig. 5
). In addition, the expression specificity was checked using control commercial total RNA obtained from the kidney, whole brain lysate, and normal ovary. The SRY was only expressed in the testis and the probands ovary and normal testis.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4. RT-PCR analysis of patients SRY mRNA. Three sets of primers were used for RT-PCR. A, Genomic DNA. B, mRNA lacks noncoding sequence (gray-red color), and only one product will be present. C, Results of RT-PCR. NTEMP, No template; NO RT, no reverse transcriptase; P-SRY, proband RNA with SRY primers; H-TESTIS, positive control, RNA from human testis; P-SRY1, proband RNA with primer extending into genomic sequence; P-SRY2, proband RNA with primer extending into genomic sequence; MARKER, molecular weight marker; M-SRY, positive control with genomic DNA and SRY primer, M-SRY-1, 2 positive control with genomic DNA and SRY1 and SRY2 primers. D, Results of RT-PCR with primers for DAX1. DAX1 is expressed in the ovary of the proband, and its expression confers to a known expression profile. This figure contains results from two experiments. Normal male testis RNA (DAX1-M) was used in two experiments, and its expression was similar in each experiment. The RT-PCR results are based on qualitative data only, and although the expression of DAX1 seems higher in proband than in control human ovary, those results need to be further evaluated with real-time PCR. DAX1-M, Expression of DAX1 in human testis; DAX1-PR, expression of DAX1 in proband; DAX1-OV, expression in normal ovary; DAX1-BR, expression in brain; MW, molecular weight marker. E, Results of RT-PCR with primers for SOX9 and AR. SOX9-M, AR-M, expression in total RNA from testis of normal control; SOX9-PR, AR-PR, expression in proband ovary; MW, molecular weight marker.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5. Analysis of the ratio of Y chromosomes to X chromosomes and to autosomes by nondenaturizing mode of HPLC. Shown above are typical chromatograms used in the analysis. 46,XX, Healthy female; 46,XY, male; 46,XX,69XXY, proband. The first peak corresponds to SRY product and marks Y chromosome (Y ch. SRY); X ch. 26, product for X chromosome marker, USP26.
|
|
To exclude deletion of the DAX1 gene, the cDNA was created using the probands total RNA, and the DAX1 was detected using two-step RT-PCR (left primer, TCCAAATGCTGGAGTCTGAA; right primer, TGAATCTCAGCAGGAAAAGG; product size, 220 bp). DAX1 was expressed in normal testis and in the probands ovary (Fig. 4D
). In addition, we checked expression of SOX9 (left primer, GGTGCTCAAAGGCTACGACT; right primer, GTAATCCGGGTGGTCCTTCT; product size, 280 bp) and androgen receptor to control (left primer, ATGTCCTGGAAGCCATTGAG; right primer, TGAATGACAGCCATCTGGTC; product size, 190 bp). Random hexamers were used to generate cDNA library in this two-step RT-PCR. Both SOX9 and androgen receptor (AR) were expressed in the probands ovary and testis (Fig. 4E
).
In normal females, XIST, which is a small, nontranslated RNA, is involved in inactivation of X chromosome and gene dose compensation mechanisms. The MS-PCR using specific primers detecting the methylated and unmethylated genomic XIST region was used to verify the presence of active (methylated-XIST) and inactive (unmethylated-XIST) X chromosome (see supplemental Table 2). The X chromosome inactivation pattern in the patient was the same as in control females and patients with Klinefelter syndrome with both unmethylated-XIST and methylated-XIST present (Fig. 6
).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 6. Methylation-specific PCR to detect XIST methylation and to exclude lack of inactivation of additional X chromosome. The results show that the patient has both active and inactive X chromosome. Analysis of OD of each product showed that the ratio of methylated and unmethylated XIST was identical in the female control and the patient and similar to a patient with Klinefelter syndrome. Male control had no unmethylated XIST as expected.
|
|
 |
Discussion
|
|---|
Male gonad development is initiated when SRY is expressed in somatic cells of the XY gonad. SRY protein is a transcription factor that acts as the genetic switch for male gonad development. SRY is both required for testis formation in XY embryos and sufficient to induce testis differentiation in XX embryos (19, 20). Although molecular targets for SRY are still unknown, many of the early cellular and morphologic events that occur downstream of SRY activation have been characterized such as increased cell proliferation, Sertoli cell differentiation, testis cord formation, development of a testis-specific vasculature, and differentiation of interstitial lineages (21).
What is the mechanism of normal ovarian development despite the presence of Y chromosome in ovarian follicles and the expression of SRY in ovarian stroma? The first possible mechanism is a mutation in the SRY gene resulting in signaling defects, which renders it nonfunctional. Several different mutations of the SRY region have been described in XY female cases with gonadal dysgenesis and those with Turner syndrome having Y chromosome mosaicism, mostly within the HMG box of the gene (22, 23). However, less than 20% of XY sex reversal cases can be attributed to the mutations or deletions of SRY or its flanking regions (24). Our analyses showed no mutation in the SRY gene or the upstream sequence. Presence of SRY mRNA further supports the data that the SRY promoter functions normally in our patient.
The second possibility is the loss of function of autosomal or X-linked genes acting downstream SRY in the testicular differentiation pathways and misregulation in the timing of SRY expression, which also could be possible explanations in the remaining portion of XY sex-reversed patients. The fact that our patient has normally expressed SRY and shows no evidence of testicular development may indicate a mutation in DNA targets for SRY-binding domain. SRY works in a complex pathway of corepressor and coactivators, which modulate its action. The proper balance and timing between the proteins in the complex may be responsible for normal testicular differentiation. For instance, injection of a 14-kb SRY-containing fragment of Y chromosome into XX embryos resulted in the development of XX phenotypic males with complete male mating behavior (20). However, only 30% of XX animals were sex reversed by the injection of the SRY fragment. This phenomenon appeared to be independent of the transgene homozygosity or copy number and was explained by an incompatibility between the timing and/or level of SRY expression and that of other genes on the X chromosome or autosomes involved in either of the testicular differentiation pathways. A similar scenario occurred in B6.YDom mouse, in which Y chromosome from Mus poschavianus (YPos) was placed onto an inbred Mus musculus musculus background (C57B1/6). YPos animals developed either as females with ovarian tissue or as true hermaphrodites in which the gonads contained both ovarian and testicular tissue (25). The variation in the degree of sex reversal in these animals appeared to be caused by a deregulation in the timing of SRY expression (26) and a functional incompatibility of SRYPos with autosomal alleles (27). A third possibility is that the presence of two copies of DAX1 (dosage-sensitive sex reversal) on the Xp21 region might have caused sex reversal by overriding the function of SRY as previously shown in the individuals with 69,XXY karyotype who commonly show ambiguous genitalia or sex reversal along with other anomalies in cardiac, gastrointestinal, renal, and genital systems such as ventricular septal defects, gastroschisis, biliary atresia, cystic renal dysplasia, and hypo-/dysplastic gonads (28, 29). It is known from studies in breast cancer and our own data on Klinefelter syndrome that skewed inactivation of X chromosome, a critical factor in genetic dose compensation, affects phenotype. In the normal female, the one X chromosome and thus one copy of DAX1 is inactive. In the normal male, there is a one-to-one ratio of DAX1 and SRY genes and most likely proteins. SRY is believed to interfere with testicular differentiation repressor function of DAX1 and allows for testicular development. In our patient, there are only 2030% of cells with SRY, and it is possible that the abundance of DAX1 and possible under inactivation of X chromosome overrides the function of SRY as a repressor of DAX1 and prevents testicular development. Thus, the skewed inactivation pattern of genes involved in gonadal development may be responsible for the phenotype in our patient. This hypothesis needs to be further confirmed with additional quantitative experiments.
Another interesting feature of this case is the occurrence of this abnormality after an in vitro fertilizationICSI procedure. Indeed, the most common causes of abnormal fertilization in ICSI procedures are multiple sperm injection or fertilization by a diploid sperm (30).
In conclusion, although the testis development or hermaphroditism in previously reported 46,XX/69,XXY diploid/triploid cases suggests that SRY or other genes acting downstream of SRY had contributed to male phenotype, complete female phenotype and ovarian development in the presence of SRY in our case could be best explained by the loss of function downstream of SRY or aberrant timing of SRY expression. Whether and how ICSI could have contributed to the development of this syndrome deserves further investigation.
 |
Acknowledgments
|
|---|
We thank Mesruh Turkekul for preparation of the slides for FISH analysis.
 |
Footnotes
|
|---|
D.A.P. is partially funded by the generous support of Mr. and Mrs. Howard Laks and Irena Laks-McLean.
Disclosure Statement: The authors have nothing to declare.
First Published Online December 12, 2006
1 O.O. and D.A.P. contributed equally to this work. 
Abbreviations: AR, Androgen receptor; FISH, fluorescence in situ hybridization; ICSI, intracytoplasmic sperm injection; MS-PCR, methylation-specific PCR; SRY, sex-determining region of Y chromosome; XIST, X inactivation-specific transcript.
Received September 6, 2006.
Accepted December 4, 2006.
 |
References
|
|---|
- Böök JA, Santesson B 1960 Malformation syndrome in man associated with triploidy (69 chromosomes). Lancet I:858859
- Muller U, Weber J, Berry P, Kupke KG 1993 Second polar body incorporation into a blastomere results in 46,XX/69,XXX mixoploidy. J Med Genet 30:597600[Abstract/Free Full Text]
- Van de Laar I, Rabelink G, Hochstenbach R, Tuerlings J, Hoogeboom J, Giltay J 2002 Diploid/triploid mosaicism in dimorphic patients. Clin Genet 62:376382[CrossRef][Medline]
- Wulfsberg EA, Wassel WC, Polo CA 1991 Monozygotic twin girls with diploid/triploid chromosome mosaicism and cutaneous pigmentary dysplasia. Clin Genet 39:370375[Medline]
- Carakushansky G, Teich E, Ribeiro MG, Horowitz DD, Pellegrini S 1994 Diploid/triploid mosaicism: further delineation of the phenotype. Am J Med Genet 52:399401[CrossRef][Medline]
- Jarvela IE, Salo MK, Santavuori P, Salonen RK 1993 46,XX/69,XXX diploidtriploid mixoploidy with hypothyroidism and precocious puberty. J Med Genet 30:966967[Abstract/Free Full Text]
- Ellis JR, Marshall R, Normaln ICS, Penrose LS 1963 A girl with triploid cells. Nature 198:411
- Flori E, Doray B, Rudolf G, Favre R, Girard-Lemaire F, Schluth C, Zix-Kieffer I, Flori J, Loriot M, Schhmitt E, Rumpler Y, Flori E 2003 Failure of prenatal diagnosis of diploidtriploid mosaicism after amniocentesis. Clin Genet 63:328331[CrossRef][Medline]
- Daniel A, Wu Z, Darmanian A, Collins F, Jackson J 2003 Three different origins for apparent triploid/diploid mosaicism. Prenat Diagn 23:529534[CrossRef][Medline]
- Dewald G, Alvarez MN, Clouthier MD, Kelalis PP, Gordon H 1975 A diploidtriploid human mosaic with cytogenetic evidence of double fertilization. Clin Genet 8:149160[Medline]
- Lejune J, Salmon C, Berger R, Rethore MO, Rossier A, Job JC 1967 Chimçre 46 XX/69XXY. Ann Genet 10:188192[Medline]
- Vatish M, Sebire NJ, Allgood C, McKeown C, Rees HC, Keay SD 2004 Triploid/diploid mosaicism (69XXY/46XX) presenting as severe early onset preeclampsia with a live birth: placental and cytogenetic features. Eur J Obstet Gynecol Reprod Biol 112:233235[CrossRef][Medline]
- Tantravahi U, Bianchi DW, Haley C, Destrempes MM, Ricker AT, Korf BR, Latt SA 1986 Use of Y chromosome specific probes to detect low level sex chromosome mosaicism. Clin Genet 29:445448[Medline]
- Wright NP, Wales JK 2004 An unusual case of hermaphroditisma 46,XX/69,XXY chimera. J Pediatr Endocrinol Metab 17:905908[Medline]
- David M, Chambon A, Laurent C, Plauchu H, Lindner D, Rouchon A, de Peretti E, Genoud J, Jeune M1975 [Triploidy in the child. I. Study of phenotype. An observation of triploidy with mosaicism 46, XX/69, XXY.] Pediatrie 30:281298
- Van den Berge H, Verresen H 1970 Triploiddiploid in the lymphocytes of a liveborn child with multiple malformations. Hum Genet II:1821
- Fryns JP, Vinken L, Geutjens J, Marien J, Deroover J, VanDen Berghe H 1980 Triploiddiploid mosaicism in a deeply mentally retarded adult. Ann Genet 23:232234[Medline]
- Oktay K, Karlikaya G 2000 Ovarian function after transplantation of frozen, banked autologous ovarian tissue. N Engl J Med 342:1919
- Lovell-Badge R, Robertson E 1990 XY female mice resulting from a heritable mutation in the murine primary testis determining gene. Development 109:635646[Abstract]
- Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R 1991 Male development of chromosomally female transgenic mice for Sry. Nature 351:117121[CrossRef][Medline]
- Ross AJ, Capel B 2005 Signaling at the crossroads of gonad development. Trends Endocrinol Metab 16:1925[CrossRef][Medline]
- Assumpcao JG, Benedetti CE, Maciel-Guerra AT, Guerra Jr G, Baptista MT, Scolfaro MR, de Mello MP 2002 Novel mutations affecting SRY DNA-binding activity: the HMG box N65H associated with 46,XY pure gonadal dysgenesis and the familial non-HMG box R30I associated with variable phenotypes. J Mol Med 80:782790[CrossRef][Medline]
- Shahid M, Dhillon VS, Aslam M, Husain SA 2005 Three new novel point mutations localized within and downstream of high-mobility group-box region in SRY gene in three Indian females with Turner syndrome. J Clin Endocrinol Metab 90:24292435[Abstract/Free Full Text]
- Cameron FJ, Sinclair AH 1997 Mutations in SRY and SOX9: testis-determining gene. Hum Mutat 9:388395[CrossRef][Medline]
- Eicher EM, Washburn LL, Whitney JB, Morrow 3rd KE 1982 Mus poschiavinus Y chromosome in the C57BL/6J murine genome causes sex reversal. Science 217:535537[Abstract/Free Full Text]
- Albrecht KA, Eicher EM 1997 DNA sequence analysis of Sry alleles (subgenus Mus) implicates misregulation as the cause of C57BL/6J-Y(POS) sex reversal and defines the SRY functional unit. Genetics 147:12671277[Abstract]
- Eicher EM, Washburn LL, Schork NJ, Lee BK, Shown EP, Xu X, Gredge RD, Pringle MJ, Page DC 1996 Sex-determining genes on mouse autosomes identified by linkage analysis of C57BL/6J-YPOS sex reversal. Nat Genet 14:206209[CrossRef][Medline]
- Lalli E, Sassone-Corsi P 2003 DAX-1, an unusual orphan receptor at the crossroad of steroidogenic function and sexual differentiation. Mol Endocrinol 8:14451453
- Petit P, Moerman P, Fryns JP 1992 Full 69,XXY triploidy and sex-reversal: a further example of true hermaphrodism associated with multiple malformations. Clin Genet 41:175177[Medline]
- Feng H, Herhlag A 2003 Fertilization abnormalities following human in vitro fertilization and intracytoplasmic sperm injection. Microsc Res Tech 61:358361[CrossRef][Medline]