| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Biochemistry, Endocrinology, and Metabolism Unit (D.E.G.M., J.P.T., D.K., K.S.W., M.T.D.), Institute of Child Health, London WC1N 1EH, United Kingdom; Université Paris-Descartes, Assistance Publique Hopitaux de Paris, Hôpital Bicêtre (R.B.), 94275 Le Kremlin Bicêtre, France; Third Department of Pediatrics (A.P.), University of Athens School of Medicine, Athens, Greece; Hospital for Children and Adolescents (E.K., A.K.), University of Leipzig, Leipzig, Germany; Charite (N.H., H.K.), Institute of Experimental Pediatric Endocrinology, Augustenburgerplatz 1, D-13353 Berlin, Germany; and Department of Endocrinology (S.M.S.), Christie Hospital National Health Service Trust, Manchester, United Kingdom
Address all correspondence and requests for reprints to: Mehul T. Dattani, Biochemistry, Endocrinology, and Metabolism Unit, Institute of Child Health, London WC1N 1EH, United Kingdom. E-mail: m.dattani{at}ich.ucl.ac.uk.
| Abstract |
|---|
|
|
|---|
Objective: Given that previous screening was carried out by SSCP detection alone and limited to coding regions, we performed an in-depth genetic analysis of HESX1 to establish the true contribution of HESX1 genetic defects to the etiology of hypopituitarism.
Design: Nonfamilial patients (724) with either SOD (n = 314) or isolated pituitary dysfunction, optic nerve hypoplasia, or midline neurological abnormalities (n = 410) originally screened by SSCP were rescreened by heteroduplex detection for mutations in the coding and regulatory regions of HESX1. In addition, direct sequencing of HESX1 was performed in 126 patients with familial hypopituitarism from 66 unrelated families and in 11 patients born to consanguineous parents.
Patients: All patients studied had at least one of the three classical features associated with SOD (optic nerve hypoplasia, hypopituitarism, midline forebrain defects).
Results: Novel sequence changes identified included a functionally significant heterozygous mutation at a highly conserved residue (E149K) in a patient with isolated GH deficiency and digital abnormalities. The overall incidence of coding region mutations within the cohort was less than 1%.
Conclusions: Mutations within HESX1 are a rare cause of SOD and hypopituitarism. However, the large number of familial patients with SOD in whom no mutations were identified is suggestive of an etiological role for other genetic factors. Furthermore, we have found that within our cohort SOD is associated with a reduced maternal age compared with isolated defects of the hypothalamopituitary axis.
| Introduction |
|---|
|
|
|---|
Previously, we screened the coding region of HESX1 within a cohort of 398 patients with sporadic and familial SOD, isolated GH deficiency (IGHD), and combined pituitary hormone deficiency (CPHD) using single strand conformational polymorphism (SSCP) detection. This led to the identification of a familial form of SOD in association with a homozygous R160C mutation within the gene encoding HESX1, a transcriptional repressor (9). Four further homozygous mutations (I26T, Alu insertion in exon 3, c.449_450delAC, c.357 + 2T>C) have been described in association with pituitary hypoplasia and aplasia respectively (10, 11, 12). Additionally, milder forms of SOD/CPHD/IGHD have been associated with heterozygous HESX1 mutations (Q6H, S170L, T181A, 1684delG, 306/307ins AG) (13, 14, 15, 16).
Given that SSCP detection alone is an insensitive method for mutation detection (73% sensitivity) (17), we rescreened the original cohort as well as newly recruited patients with sporadic SOD and hypopituitarism (n = 724) for HESX1 mutations. In addition to this, direct sequencing was performed in 11 patients with apparent sporadic disease originating from consanguineous unions and in the proband of 66 kindred with SOD/hypopituitarism. Furthermore, we have increased the scope of our screening to include known HESX1 regulatory regions (18, 19, 20). This approach has identified a number of likely polymorphisms as well as a previously undetected heterozygous E149K mutation in a patient with IGHD and associated digital abnormalities. The latter mutation had no effect on DNA binding but led to impaired repression of PROP1 activation. Although these results confirm that mutations in HESX1 are not a major cause of SOD and hypopituitarism, the evidence of a contribution from genetic loci other than HESX1 to the etiology of SOD is compelling. Additionally, our results suggest that in comparison with patients with only endocrine defects, SOD is indeed associated with younger maternal age, although no reduction in birth weight was observed as would be expected with a predominantly environmental etiology.
| Patients and Methods |
|---|
|
|
|---|
Patients with congenital hypothalamopituitary disorders were recruited into the study from both national and international Pediatric and Adult Endocrinology centers between 1998 and 2005. 261 patients were referred to the London Centre for Pediatric Endocrinology based at Great Ormond Street Hospital for Children and the University College London Hospitals. Ethical committee approval was obtained from the Institute of Child Health/Great Ormond Street Hospital for Children Joint Research Ethics Committee. The remainder of the cohort (n = 600) were recruited from 45 national and 59 international endocrine and genetic centers. Full informed consent was obtained from the families where possible.
Clinical evaluation
Retrospective clinical details obtained from patients recruited within the London Centre for Pediatric Endocrinology (n = 178) included birth size, perinatal complications, history of consanguinity, family history, and parental heights. Magnetic resonance imaging (1.5-tesla Siemens Magnetom Symphony, Siemens Corporation, Bracknell, UK) was performed where possible. T1- and T2-weighted high-resolution pituitary images through the hypothalamopituitary axis (T1 sagittal 3-mm slices, T1 and T2 coronal 3-mm slices) were obtained. Details noted included the size of the anterior pituitary, position of the posterior pituitary signal, and presence and morphology of the optic nerves, optic chiasm, pituitary stalk, septum pellucidum, and corpus callosum. For those patients recruited from other centers where hormonal assays were performed using different commercial RIA kits, normal values for each center were taken into account for the diagnosis of hormone deficiencies. In all cases, the phenotypic evaluation was made by an experienced endocrinologist. Referring clinicians were asked to answer a standard patient medical history questionnaire and to forward any relevant clinical or familial information. Patients were classified as SOD when either two of the three classical triad features were noted in the supplied clinical information, or, in the absence of such detail, the referring clinicians diagnosis of SOD was accepted. In the cases where detailed clinical information was not supplied, the combination of the three classical triad features present is unclear.
Mutation screening
Those samples from nonconsanguineous sporadic patients that had previously been screened by SSCP were rescreened by heteroduplex detection using the WAVE Nucleic Acid Fragment Analysis System (Transgenomic, Inc., Omaha, NE) (n = 435), whereas newly recruited nonconsanguineous sporadic samples were screened by heteroduplex detection using the MegaBace DNA Analysis System (GE Healthcare, Little Chalfont, Buckinghamshire, UK) (n = 289). The entire HESX1 coding region was sequenced in samples indicative of heteroduplex, in addition to DNA extracted from patients with a history of either familial disease (n = 126 from 66 kindred) or consanguinity (n = 11). Both PCR and DNA sequencing were performed as previously described (14). Primers used to screen novel regions were: 5'-untranslated region (UTR), forward, 5'gcc-aca-ttt-gtg-cat-cag-tt, reverse, 5'ctc-tgc-ccc-acg-tgt-ata; and 3' enhancer, forward, 5'att-cag-ggg-gaa-aat-tgg-ac, reverse, 5'gca-cac-aca-gcc-att-gtt-tcc-a.
Haplotype analysis
Haplotype analysis using the markers D3S1606, D3S3616, D3S1295, and D3S1300 was performed as previously described (13).
Statistics
Two-way Students t tests were used to determine significance between groups for continuous variables, whereas
2 tests were used in the case of categorized data. The results are presented as the variable ± 95% confidence interval.
EMSA
HESX1 cDNA was cloned downstream of the T7 promoter in the expression vector pET30a (Novagen, Madison, WI). To generate mutant protein containing the E149K mutation, the nucleotide change c.779G>A was introduced into the wild-type (WT) cDNA sequence by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) following the manufacturers instructions. WT and E149K HESX1 proteins were generated using the TNT Quick coupled Transcription/Translation system (Promega, Madison, WI). EMSAs were performed as described previously (14) using a radiolabeled consensus paired binding sequence (P3; 5'AGCTTGAGTCTAATTGAATTACTGTAC) as a probe.
Cell culture and transient transfection assays
Chinese hamster ovary cells were maintained in DMEM supplemented with 10% FBS and 2 mM L-glutamine. Transient transfection assays were performed using Lipofectamine reagent (Invitrogen, Paisley, UK) according to the manufacturers instructions. Briefly, 1 x 105 cells were seeded into each well of a 12-well plate 24 h before transfection. Cells were cotransfected with 100 ng of a firefly luciferase reporter construct containing six repeats of the P3 sequence upstream of the SV40 promoter as previously described (10, 14) with 200 ng PROP1 cDNA cloned into the expression vector pCDNA3.1(+) (Invitrogen) and varying amounts of WT or E149K HESX1 expression construct. Cells were cotransfected with 75 ng pRL-SV40 Renilla Luciferase (Promega) to control for transfection efficiency, and the total amount of DNA transfected per well was normalized to 1.2 µg by the addition of empty expression vector. After transfection, cells were harvested and assayed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega).
| Results |
|---|
|
|
|---|
Patients (724 nonfamilial, 126 familial, and 11 consanguineous) were grouped into four categories: SOD (group I), endocrine abnormalities only (group II), midline abnormalities only (group III), and ONH only (group IV). Given the large number of patients in groups I (n = 357) and II (n = 472), only these groups were analyzed in detail. The mean maternal age in group I patients (25.1 ± 1.6 yr, n = 113) was significantly lower than that of group II patients (29 ± 1.9 yr, n = 117) (Table 1
, P = 0.0002). However, no difference was observed between groups I and II in terms of the mean gestation (Table 1
, P = 0.7), mean birth weight (Table 1
, P = 0.5), or the distribution of low (<2500 g), moderate (
2500 to
3500 g), or high (>3500 g) birth weight babies (P = 0.12). Maternal alcohol consumption was reported in seven patients in group I but was not noted in any patients in group II.
|
A number of other clinical features were identified in association with SOD/CPHD/IGHD. These included syndactyly, polydactyly, or polysyndactyly identified in seven sporadic and three familial cases, including the patients found to harbor the E149K (this study) and S170L (13, 14) mutations in HESX1.
Genetic screening
In total, DNA samples from 314 nonconsanguineous patients from group I were screened for coding region mutations in HESX1 alongside 410 nonconsanguineous patients from groups IIIV. Rescreening of the coding regions of HESX1 in the original SOD patient cohort identified heterozygous sequence changes in seven patients that had not previously been detected by SSCP, whereas sequencing of familial samples identified a further false negative (Table 2
). These variants included three silent changes: c.183T>C (H61H, n = 3; two sporadic, one familial), c.219C>T (S73S, n = 2, familial), c.525G>A (A175A, n = 2; sporadic), as well as a single coding region variant, E149K (n = 1; sporadic). Four patients were found to harbor the N125S polymorphism in both the heterozygous (n = 2) and homozygous (n = 2) state (14). In total, the N125S substitution has been identified in the homozygous state in two individuals and in the heterozygous state in 10 samples (9, 13, 14).
|
|
Clinical phenotype of patient harboring the E149K mutation in HESX1
A heterozygous nonconservative missense mutation, HESX1 (E149K), was identified in a single male patient (Fig. 2
, II.2). II.2 was born at full term by normal vaginal delivery, with a birth weight of 2.8 kg. The neonatal period was complicated by jaundice, hypoglycemia, and umbilical cord infection. Shortly after birth, small supernumerary digits were excised from both hands. During infancy and early childhood, his growth was poor [height, 97 cm at age 6.3 yr; 3.7 SD score (SDS)], and a diagnosis of GH deficiency (GHD) was made at that stage (peak GH, 1.4 ng/ml on clonidine stimulation, confirmed on insulin tolerance test). The rest of his endocrinology was normal (basal prolactin, 5.7 ng/ml; peak cortisol to insulin-induced hypoglycemia, 28.9 µg/dl), with the exception of an intermittent elevation in TSH [T4, 5.3 µg/dl [normal range (NR), 3.911.6)]; basal TSH, 8.7 µU/ml; peak TSH to TRH, 25 µU/ml; repeat TSH, 1.3611.4 µU/ml; total T4, 4.76.9 µg/dl; free T4, 1.21.3 ng/dl (NR 0.81.8); most recent TSH, 2.76 µU/ml]. He received recombinant human GH replacement throughout childhood. At presentation, he was considered to have hypoplasia of the scrotum, and his phallus was noted to be small at 12.5 yr of age. GnRH provocation at this time revealed a basal FSH concentration of 2 IU/liter, which did not increase in response to GnRH. His basal LH concentration was 4 IU/liter, with a peak of 8 IU/liter to GnRH provocation. He was then commenced on testosterone replacement (Sustanon; a combination of testosterone propionate, testosterone phenylpropionate, and testosterone isocaproate), which was continued until the age of 17 yr, by which stage his own testicular volumes had increased to 1520 ml. His gonadotropin and testosterone concentrations after stopping Sustanon therapy for 6 months were within the normal range [testosterone, 13.6 nmol/liter (392 ng/dl; NR, 288865)]. Because of this evidence of a normal reproductive axis, testosterone therapy was not recommenced, and the patient was subsequently proven to be fertile with the birth of a male child (Fig. 2
, III.2), who to date appears to be an unaffected carrier of the E149K mutation. Retesting II.2 off GH treatment revealed a peak GH response to insulin-induced hypoglycemia of 0.8 and 0.6 ng/ml at 17 and 22 yr of age, respectively, whereas that to arginine was 0.4 ng/ml at the age of 22 yr. His recent IGF-1 concentration was 73 ng/ml (normal, 89350 ng/ml) off recombinant human GH treatment.
|
DNA was obtained from all available family members of II.2; the HESX1 genotype of each individual was determined, and allelic tracking studies were performed (Fig. 2
). His son (III.2), mother (I.2), and older brother (II.1) appear to be unaffected carriers of the E149K mutation; the height of his mother is 170 cm (+1.33 SDS), and that of his brother is 175 cm (+0.05 SDS). Although both the proband (II.2) and his older brother (II.1) inherited the E149K-containing haplotype from their mother (I.2), they inherited different paternal haplotypes. Thus, it is possible that the proband harbors a second cryptic HESX1 mutation inherited from his father, although this has not been identified in either the coding or the known regulatory regions of HESX1 to date (data not shown). Thus, the results of allelic tracking in this case cannot distinguish between a dominant mode of inheritance with reduced penetrance, as described with previous HESX1 mutations in mouse and human (9, 13), and recessive compound heterozygosity for E149K with a further unidentified mutation within HESX1.
Investigation of the functional impact of HESX1(E149K)
In an in vitro EMSA, recombinant HESX1(E149K) protein was found to have a similar DNA binding activity (using the consensus PIII sequence) as the WT HESX1 protein, demonstrating that HESX1(E149K) folds correctly in vitro and is able to bind DNA (Fig. 3B
). The HESX1(E149K)-DNA complex migrates at a similar rate to the WT protein, indicating that HESX1(E149K) is able to bind DNA as a dimer.
|
| Discussion |
|---|
|
|
|---|
The mutation E149K results in the nonconservative substitution of lysine (K) for glutamate (E) at position 42 of the HESX1 homeodomain, the first residue of the recognition helix, and has not been identified in 100 control chromosomes (13). E149 is conserved across the paired-like family as well as Anf class homeodomain proteins (21). As shown in the structure of the Drosophila paired homeodomain (Protein Database, 1FJL), E42 forms an electrostatic interaction with a conserved arginine residue at position 31 of the homeodomain, and indeed R31 is invariably coupled with E42 in paired-like homeodomains (21) (Fig. 3A
). This interaction forms a salt bridge between helix 2 and helix 3/4, and disruption of this interaction, by changing the electrical charge of the amino acid at position 42, would likely disrupt HESX1 folding (21). Recently, the structure of the HESX1 homeodomain bound to DNA as a monomer has been determined by NMR (22). This monomeric structure demonstrates the interaction between E42 and R31. Within the paired homeodomain, when bound as a dimer, E42 also forms an intermolecular salt-bridge with R3 (Fig. 3A
). These interactions appear critical to dimerization, forming a major interaction face between two paired homeodomains. Disruption of this interaction would likely give rise to a defect in dimerization (21). R3, R31, and E42 are also conserved in the paired-like homeodomain of PROP1.
To investigate the potential disruption of homeodomain folding by E149K, we assayed the ability of E149K to fold in vitro and to subsequently bind DNA. We found no defect in DNA binding, indicating that E149K, and the consequent disruption of the E42-R31 interaction, does not prevent homeodomain folding and subsequent DNA binding activity. Furthermore, the EMSA assay indicates that HESX1 is able to bind DNA as a dimer; thus, disruption of the E42-R3 interaction does not prevent dimerization. It has been proposed that PROP1 is a heterodimerization partner of HESX1 within the anterior pituitary (23). Therefore, we investigated the interaction between HESX1 and PROP1 and found that E149K disrupted this interaction. These data suggest that the E149K is a functionally significant mutation and that the phenotype is not due to haploinsufficiency of HESX1 resulting from misfolding of E149K but rather to an inability to repress PROP1.
Haplotype analysis of the E149K kindred fails to distinguish between two potential modes of inheritance: dominant with reduced penetrance [in line with other HESX1 mutations (13)] or recessive with compound heterozygosity for another as yet unidentified mutation. Previously, two dominant fully penetrant mutations at this residue (E42A and E42K within the homeodomain) in a second paired-like transcription factor (CRX) have been shown to be causative in dominant cone rod retinal dystrophy within a large kindred (24, 25). These analogous mutations suggest that E149K in HESX1 is a dominant mutation. The inability of E149K to repress PROP1 suggests that E149K is indeed a functionally significant mutation, presumably due to the disruption of the E42-R3 interaction.
E149K was identified in the heterozygous state in a single patient diagnosed with GHD, an undescended/EPP, and intermittent and mild disturbance of thyroid function tests possibly due to either primary thyroid disease or hypothalamic dysfunction. Hence, this case represents isolated pituitary dysfunction rather than SOD. This phenotype is consistent with other heterozygous HESX1 mutations that show milder phenotypes as opposed to the full spectrum of SOD (13, 14). Cooperative dimerization of HESX1 and subsequent repression of PROP1-mediated transcriptional activation is believed to be a central HESX1 function within the developing anterior pituitary and required for development of the somatotrope lineage (23). The inability of HESX1(E149K) to antagonize PROP1 is likely to be the direct cause of GHD in this patient.
Intriguingly, supernumerary digits were removed from both hands of the E149K patient shortly after birth. Digital abnormalities were also described in a patient harboring the S170L mutation (13). Such abnormalities are relatively uncommon, and their occurrence in two of the six patients within the cohort with heterozygous mutations in HESX1 is intriguing.
HESX1 and its role in SOD
To date, five recessive and five dominant mutations have been described in the gene encoding the transcriptional repressor HESX1 in patients with SOD/CPHD/IGHD (9, 10, 11, 12, 13, 14, 15, 16). The cohort described in this report represents the largest group of patients with SOD/CPHD/IGHD assembled for genetic analysis to our knowledge. Initially, this cohort had been screened by SSCP detection only, a technique that is known to have a significant false-negative rate [27% (17)]. Thus, we rescreened sporadic patients using heteroduplex detection, a combination of techniques with a lower false-negative rate [7% (17)]. In addition, HESX1 was directly sequenced in familial patients. Rescreening identified a further eight DNA variants that had not been previously detected by SSCP screening (H61H, n = 3; S73S, n = 2; A175A, n = 2; and E149K, n = 1). Of these, A175A is a noncoding polymorphism (identified in one of 15 controls). The H61H variant was found in a patient who harbors a deletion of the gene encoding human GH (GH-1), indicating that H61H is not the causative mutation in this individual (our unpublished data). The c.219C>T variant also appears to be benign because it does not lead to an amino acid substitution (S73S) and would not be predicted to affect RNA splicing. However, c.219C>T has not been observed in 100 control chromosomes (13) and was identified in a patient with microphthalmia, ONH, and hypopituitarism, who inherited this allele from his mother who also has microphthalmia but normal pituitary function (height, +0.9 SDS). Thus, we cannot rule out a potential functional effect of c.219C>T at this stage.
The two common variants in the 5' enhancer (277T>G) and the 3' enhancer (+3135_3139 del GACA) have both been identified in control samples, suggesting that they are likely to be polymorphic. Although +3135_3139 del GACA is conserved between human and mouse, it lies outside the previously characterized 3'-enhancer region (20) (Fig. 1
), suggesting this variant is unlikely to be a pathogenic mutation. On the other hand, 277T>G is conserved across the Anf class of homeobox genes and lies within the 5'-enhancer region (20) (Fig. 1
) altering a potential binding site for the GATA family of transcription factors. Therefore, 277T>G may be pathological, perhaps in combination with mutation at a second unidentified locus or with reduced penetrance.
In total, three deleterious mutations in six patients were identified within this cohort (R160C, n = 2; S170L, n = 3; E149K, n = 1), corresponding to less than 1% of the patient cohort. We have screened coding sequence and known regulatory regions of HESX1, and although mutations in other regions involved in the regulation of the gene cannot be excluded, they are unlikely to play a major role in the etiology of SOD. These data suggest that mutations in HESX1 are a rare cause of SOD and hypopituitarism. However, a significant proportion of our patients are familial cases, in whom no mutations of HESX1 have been identified to date. The recruitment rate of familial kindred compared with sporadic patients was identical between groups I and II (1:9), and we have subsequently found causative mutations in other genes in 13 of the 42 kindred in group II compared with only two of the 35 kindred in group I (Refs. 26, 27, 28, 29 ; our unpublished data). It is highly likely that other as yet unidentified genes may be implicated in the etiology of SOD. Indeed, we have recently described mutations in SOX3 (27) and SOX2 (29) in patients with variant SOD phenotypes.
Etiology of SOD
In accordance with recent findings (2), our data suggest an association between young maternal age and SOD; indeed, one third (34%) of the SOD patients were born as the result of a teenage pregnancy (mothers aged less than 20 yr, 9 months at birth, data not shown). These data could support an environmental origin of SOD with possible exposure to risk factors such as maternal smoking, alcohol consumption, and use of addictive drugs during early gestation. Indeed, a previous study into the etiology of ONH reported a similar association with young maternal age in addition to an association with maternal smoking and drug use (30). As predicted, both the birth weight and gestation of ONH patients in that study was found to be low, indicating an adverse developmental environment. However, young maternal age in SOD was not associated with low birth weight or low gestation in a recent smaller study (2) or in this study. Prospective controlled cohort studies will be required to confirm this lack of association between young maternal age and an adverse developmental environment as indicated by birth weight and gestation.
We conclude that although mutations in HESX1 remain a rare cause of SOD/CPHD/IGHD, it is clear that other genes may be implicated in the etiology of this complex and variable condition. Alternatively, our data also suggest a possible role for other environmental etiological factors. Furthermore, the association between HESX1 mutations and digital abnormalities in two of our patients indicates that additional clinical features that cannot be explained by the murine expression pattern of Hesx1 should not necessarily preclude screening for HESX1 mutations in hypopituitarism.
| Acknowledgments |
|---|
| Footnotes |
|---|
The authors have nothing to disclose.
First Published Online December 5, 2006
Abbreviations: CPHD, Combined pituitary hormone deficiency; EPP, ectopic posterior pituitary; GHD, GH deficiency; IGHD, isolated GHD; NR, normal range; ONH, optic nerve hypoplasia; SDS, SD score; SOD, septooptic dysplasia; SSCP, single strand conformational polymorphism; UTR, untranslated region; WT, wild type.
Received July 25, 2006.
Accepted November 21, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E. Sajedi, C. Gaston-Massuet, M. Signore, C. L. Andoniadou, D. Kelberman, S. Castro, H. C. Etchevers, D. Gerrelli, M. T. Dattani, and J. P. Martinez-Barbera Analysis of mouse models carrying the I26T and R160C substitutions in the transcriptional repressor HESX1 as models for septo-optic dysplasia and hypopituitarism Dis. Model. Mech., November 1, 2008; 1(4-5): 241 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dateki, M. Fukami, N. Sato, K. Muroya, M. Adachi, and T. Ogata OTX2 Mutation in a Patient with Anophthalmia, Short Stature, and Partial Growth Hormone Deficiency: Functional Studies Using the IRBP, HESX1, and POU1F1 Promoters J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3697 - 3702. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kelberman and M. T. Dattani Hypothalamic and pituitary development: novel insights into the aetiology Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S3 - S14. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |