Journal of Clinical Endocrinology & Metabolism
, doi:10.1210/jc.2007-1592
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 11 4366-4372
Copyright © 2007 by The Endocrine Society
Angiotensin II Regulates Adipocyte Apolipoprotein E Expression
Poornima Rao,
Zhi Hua Huang and
Theodore Mazzone
Departments of Medicine (P.R., Z.H.H., T.M.) and Pharmacology (T.M.), University of Illinois at Chicago, Chicago, Illinois 60612
Address all correspondence and requests for reprints to: Theodore Mazzone, M.D., Section of Endocrinology, Diabetes and Metabolism, University of Illinois at Chicago, 1819 West Polk Street (MC 797), Chicago, Illinois 60612. E-mail: tmazzone{at}uic.edu.
 |
Abstract
|
|---|
Context: Obesity is increasing in prevalence and it is important to understand factors that regulate adipose tissue lipid metabolism. Recently, endogenous expression of apolipoprotein E (apoE) in adipose tissue has been shown to have important effects on adipocyte lipid flux and gene expression. Adipose tissue is also a physiological target of angiotensin II (AII).
Objective: The aim of the current study was to evaluate a potential regulatory effect for AII on adipose tissue apoE expression.
Results: Infusion of AII into mice for 3 d significantly reduced apoE expression in adipocytes from freshly isolated adipose tissue. ApoE expression was unchanged by the AII infusion in the stromovascular fraction. In isolated human adipocytes, treatment with AII significantly reduced cellular and secreted apoprotein E (by 20–60%). Suppression of apoE expression was observed in sc adipocytes obtained from nonobese (body mass index < 30 kg/m2) donors, and in sc and omental adipocytes obtained from obese (body mass index > 30 kg/m2) donors. Evaluation of the effect of AII in matched sets of sc and omental adipocytes from three separate donors showed lower overall apoE expression in omental adipocytes in two of the donors, and a concordant down-regulation of apoE expression in sc and omental adipocytes from all three subjects. The specific AT1 receptor blocker, valsartan, eliminated the effect of AII on adipocyte apoE expression.
Conclusion: Both apoE and components of the renin-angiotensin system are expressed in adipose tissue, and each has important effects on adipocyte lipid metabolism and gene expression. The regulatory interaction we have identified between these two pathways has important implications for a complete understanding of adipose tissue lipid homeostasis.
 |
Introduction
|
|---|
OBESITY IS INCREASING in prevalence in adults and in children (1, 2, 3). This presents a significant public health and clinical challenge because obesity is associated with increased morbidity and mortality, especially from cardiovascular diseases (1, 2, 3, 4). Because of this, the impact of adipose tissue, especially excess adipose tissue, on the vascular wall has recently been the subject of heightened interest. Over recent years, it has become clear that the adipose tissue is a dynamic endocrine organ that modulates systemic substrate flux and metabolism by controlling the level of circulating substrates, and by secretion of factors that can modulate substrate metabolism in distant tissues (4, 5, 6). In addition, adipose tissue has been shown to secrete a number of factors that can directly impact the vessel wall and vessel wall cells. One of the factors highly expressed in the adipose organ is apolipoprotein E (apoE) (7, 8, 9)
ApoE mRNA and protein can be found in human and rodent adipose tissue, where it is expressed by both mature adipocytes and adipose tissue macrophages (7, 8, 9). In rodents, up to 80% of all apoE mRNA in adipose tissue can be ascribed to mature adipocytes (9). Recently, an important role has been demonstrated for endogenous adipocyte apoE expression, in vivo and in vitro, for modulating adipocyte lipid metabolism and adipocyte gene expression (9). Although most circulating apoE comes from the liver, the size of the adipose organ suggests that it could be a significant source of extrahepatic apoE, especially in certain pathophysiological states (8). In animal models, extrahepatic apoE has been shown to have important effects on lipoprotein composition, systemic lipoprotein metabolism, and on the vessel wall directly (4, 10, 11). In view of the aforementioned observations, it is important to understand factors that regulate adipose tissue apoE expression. We have previously shown that adipose apoE expression responds to peroxisome proliferator-activated receptor
agonists and TNF
(8). We have also recently demonstrated significant control of adipose tissue apoE expression by organismal nutritional balance (12). Adipose tissue expresses components of the renin-angiotensin system and expresses angiotensin II (AII) (13, 14) receptors. Furthermore, adipose tissue is an important physiological target of AII; AII has been shown to modulate adipocyte lipid metabolism, increase inflammatory gene expression, and decrease adiponectin expression (15, 16, 17, 18). Given the emerging evidence regarding the potential significance of adipocyte apoE expression, the current studies were performed to evaluate the effect of AII on adipocyte apoE expression.
 |
Materials and Methods
|
|---|
AII infusion
Eight-week-old C57BL/6 mice were purchased from the Jackson Laboratories (Bar Harbor, ME). All animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Illinois, Chicago. Experimental mice received human AII infusion for 3 d via sc osmotic pump (Durect Corporation, Cupertino, CA) at 1 mg/kg·d rate. Control mice received a sc infusion of sterile PBS for the same period. After the infusion, intraabdominal fat pads were collected for experiments. Adipocytes were isolated in a floating fraction after digesting freshly obtained adipose tissue with 0.5 mg/ml collagenase in DMEM for 1 h at 37 C in a shaking water bath as previously described (9). Stromovascular cells were pelleted and washed twice with DMEM. After centrifugation, floating cells (freshly isolated adipocytes) and the cell pellet (stromovascular cells) were used for RNA isolation. Peritoneal macrophages were harvested by peritoneal lavage with sterile PBS, resuspended in DMEM with 10% FBS, and maintained in six-well plates for 2 h at 37 C, after which they were used for RNA isolation.
Cell culture
Human sc and omental preadipocytes were obtained from Zen-Bio (Research Triangle Park, NC). Cells were maintained in preadipocyte media (PM-1 for sc cells, PM-OM for omental cells; Zen-Bio) until confluent. Cells were differentiated using differentiation media (DM-2 for sc cells; DMOM, differentiation media for omental cells; Zen-Bio) for 7 d. On d 7, cells were incubated overnight in SFAM, serum free adipocyte media for sc cells, and OMAM, omental adipocyte media (Zen-Bio) with 0.2% BSA alone or with following additions: AII 10–5 M (Sigma, St. Louis, MO) alone or 1 h after pretreatment with valsartan 10–4 M (obtained from Novartis, East Hanover, NJ). After treatment, media and/or cell lysates (as noted in the figures) were used for Western Blot or quantitative RT-PCR.
Western blot analysis
Human adipocytes were lysed in 4% SDS containing radioimmunoprecipitation assay buffer. Media and cell lysates were resolved by 10% SDS-PAGE and electrotransferred to a nitrocellulose membrane. Goat antihuman apoE antibody (International Immunology Corporation, Murrieta, CA) was used to assess apoE expression (1:200). The apoE signal was developed using an antigoat horseradish peroxidase secondary antibody (1:1000; Pierce, Rockford, IL). A chemiluminescent detection system ECL (Amersham Pharmacia Biotech, Little Chalfont, UK) was used for visualization of bands, and intensity was quantitated using densitometry software (ImageQuant v2005; Amersham Biosciences, Piscataway, NJ). Flotillin expression was used for normalization of the apoE signal.
Quantitative RT-PCR
Total RNA was extracted using Qiagen kits (Valencia, CA). First strand cDNA was synthesized from 1 µg total RNA using random hexamer primers according to the manufacturers instructions (Fermentas, Hanover, MD). Real-time PCR was performed on each mouse isolate in duplicate using the Mx3000p Quantitative PCR system (Stratagene, La Jolla, CA). Reactions were carried out in a total volume of 25 µl using Brilliant SYBR Green QRT-PCR Master Mix (Stratagene). Relative quantification for each gene (expressed as fold increase over control) was calculated after normalization to ß-actin RNA. Primer pairs (forward, reverse) used for each gene were: human ß-actin, tcaccctgaagtaccccatcg, agaagcatttgcggtggacg; human apoE, cacaggcaggaagatgaaggt, agcgcaggtaatcccaaaag; human adiponectin, ggcatgaccaggaaaccac, ttcaccgatgtctcccttagg; mouse ß-actin, ctgggacgacatggagaaga, agaggcatacagggacagca; mouse apoE, agtggcaaagcaaccaacc, cttccgtcatagtgtcctcca; mouse adiponectin, ggagatgcaggtcttcttggt, tctccaggctctcctttcct; mouse CD36, cagaggctgacaacttcacag, agggtacggaaccaaactcaa; mouse CD68, acttcgggccatgtttctct, ggctggtaggttgattgtcgt.
Statistical analysis
Each experiment shown is representative of three to four experiments (each done in triplicate) with similar results. Statistical significance of observed differences was analyzed using Students t test or ANOVA using SPSS (Chicago, IL).
 |
Results
|
|---|
The effect of AII in vivo on adipocyte apoE expression was examined in 8-wk-old C57BL/6 mice. Animals received a continuous sc infusion of AII (1 mg/kg·d) or PBS for 3 d. After the infusion, intraabdominal fat pads were harvested and adipocytes were separated from the stromovascular fraction as described in Materials and Methods. The AII infusion did not produce a significant change in total body weight compared with the PBS control, nor did it alter total cholesterol or triglyceride levels (data not shown). The effect on the AII infusion on adipocyte mRNA levels of apoE, CD36, and adiponectin are shown in Fig. 1A
. AII infusion significantly decreased apoE mRNA level, and the magnitude of change was similar to that produced in adiponectin mRNA level. There was no effect of AII on CD36 levels in freshly isolated adipocytes. Adipose tissue macrophages, found in the stromovascular fraction, also express apoE. Therefore, we evaluated the effect of the AII infusion on macrophage content and apoE expression in the adipose tissue stromovascular fraction. The AII infusion over 3 d did not produce an influx of macrophages into the adipose tissue stromovascular fraction as demonstrated by the absence of a significant increase in CD68 mRNA level; a marker for adipose tissue macrophage content (12). AII had no effect on apoE expression in the adipose tissue stromovascular fraction. Macrophages isolated from different tissues can be functionally heterogeneous, and, therefore, we evaluated the effect of the AII infusion on freshly isolated peritoneal macrophages. Different from both adipose tissue macrophages and mature adipocytes, the AII infusion increased apoE expression in mouse peritoneal macrophages.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1. Effect of AII infusion on adipose tissue apoE expression in vivo. Eight-week-old C57BL/6 mice were infused sc with either sterile PBS (untreated) or AII (1 mg/kg·d) for 3 d. A, Mature adipocytes were isolated from intraabdominal fat pads as described in Materials and Methods, and mRNA levels were measured by real-time PCR. Values shown are mean ± SD from six mice. B, Stromovascular cells were isolated from the intraabdominal fat pad, and peritoneal macrophages were obtained by peritoneal lavage as described in Materials and Methods. *, P < 0.05 for difference in mRNA level comparing untreated to AII treated. Values shown are mean ± SD from six mice. Open bars, Untreated; hatched bars, AII treated.
|
|
AII can have pleiotrophic effects in vivo, and, therefore, we next used an in vitro system to evaluate whether the effect of AII on apoE expression was mediated by a direct effect of AII on adipocytes. Human preadipocyte pools obtained from sc or omental adipose tissue depots were differentiated in vitro and treated with AII. Figure 2
, A–C, shows the effect of the AII treatment on cellular and secreted apoE as measured by Western blot. Subcutaneous adipocytes obtained from pooled donors with body mass index (BMI) less than 30 kg/m2, and sc and omental adipocytes obtained from pooled donors with BMI more than 30 kg/m2 each demonstrated a significant reduction in both cellular and secreted apoE in response to the AII treatment. Figure 2D
shows the results of AII treatment on mRNA levels for apoE and adiponectin in pooled sc adipocytes from donors with BMI less than 30 kg/m2. Consistent with the results from the in vivo infusion, AII treatment significantly reduced both apoE and adiponectin mRNA levels.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2. AII decreases apoE expression in human sc and omental adipocytes. Cells from a pool of six donors with similar BMI were incubated overnight in serum-free media with 0.2% BSA with or without the addition of AII 10–5 M. Media and cell lysates were collected, and apoE protein expression was measured by Western blot as described in Materials and Methods. A, Subcutaneous adipocytes from donors with BMI less than 30 kg/m2. B, Subcutaneous adipocytes from donors with BMI more than 30 kg/m2. C, Omental adipocytes from donors with BMI more than 30 kg/m2. D, ApoE and adiponectin mRNA levels were measured in sc adipocytes from donors with BMI less than 30 kg/m2 after incubation with or without AII as described above. Values shown are mean ± SD from triplicates of wells of cells. Open columns, Untreated; hatched columns, AII. *, P < 0.05 for the difference between untreated and AII-treated cells.
|
|
Figure 3
presents the results of experiments in which we evaluated the effect of AII treatment on matched sets of sc and omental adipocytes from three individual subjects with BMI more than 30 kg/m2. In two of the three subjects, apoE expression was significantly lower in untreated omental compared with untreated sc adipocytes, with a trend toward lower expression in the third subject. In all three subjects, AII treatment produced significant reduction of cellular apoE in both sc and omental adipocytes of approximately the same magnitude. Medium apoE responded similarly to treatment with AII (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3. Effect of AII on apoE expression in a matched set of sc and omental adipocytes from single donors. Subcutaneous and omental adipocytes from three subjects (BMI > 30 kg/m2) were incubated overnight in serum-free media with 0.2% BSA with or without addition of AII 10–5 M. Cell lysates were collected and apoE protein expression was measured by Western blot as described in Materials and Methods. *, P < 0.05 for the difference between untreated and AII-treated cells. #, P < 0.05 for the difference between untreated omental and sc adipocytes. Values shown are mean ± SD from triplicate wells of cells. Where error lines are not visible, they are contained within the bar. Open bars, Untreated; hatched bars, AII treated.
|
|
AII is known to exert most effects via AT1 and AT2 receptors. The AT1 receptor has been studied extensively and is highly expressed in adipose tissue. To evaluate whether AT1 receptors are involved in the negative effect of AII on apoE expression in adipocytes, we treated human adipocytes with AII with or without the AT1 blocker, valsartan (Fig. 4
). Treatment with AII alone reduced cellular apoE levels significantly. Treatment with valsartan alone had no effect on apoE levels; however, pretreatment with valsartan completely blocked the effect of AII on apoE expression. The results in Fig. 4
are from sc adipocytes obtained from pooled donors with BMI less than 30 kg/m2; however, similar results were obtained from sc and omental adipocytes obtained from donors with BMI more than 30 kg/m2 (results not shown).
 |
Discussion
|
|---|
Our results demonstrate a significant effect of AII on adipose tissue apoE expression in vivo. Infusion of AII for 3 d reduced apoE expression exclusively in the mature adipocyte fraction of adipose tissue. ApoE expression in the stromovascular fraction of adipose tissue, which is primarily accounted for by macrophages, did not respond to AII infusion. The selective decrease in adipocyte apoE expression in response to the AII infusion in vivo is further demonstrated by the observation that apoE expression increased in freshly isolated peritoneal macrophages after 3 d of AII treatment. Because AII may affect multiple in vivo pathways with impact on adipose tissue, we used an in vitro model of human adipocytes to confirm a direct effect of AII on apoE expression in adipocytes. Subcutaneous adipocytes from nonobese humans and sc and omental adipocytes from obese humans responded to AII with reduction of apoE expression. Adipose tissue has been shown to abundantly express AT1 receptors, and expression levels for this receptor are influenced by pathophysiological states such as hypertension and obesity (14, 19). Using the specific AT1 receptor blocker, valsartan, we also showed that the effect of AII on adipocyte apoE expression was mediated by the AT1 receptor.
Several components of the renin-angiotensin system have been identified in freshly isolated adipose tissue from both rodents and humans. Adipose angiotensinogen expression is decreased by fasting and increased by refeeding (13, 14, 20). The expression of adipose tissue renin-angiotensin system components in vivo has also been shown to increase in obese states, and genetic variants of the renin-angiotensin system have been associated with obesity (21). AII has also been shown to directly regulate important aspects of adipocyte function. AII treatment of adipose tissue stimulates IL-6 and IL-8 production from human adipocytes by a nuclear factor
B-dependent pathway and decreases adipose tissue adiponectin mRNA and circulating adiponectin levels in rodents (18, 22). Recent evidence suggests that AII may be involved in regulation of adipogenesis and fat pad mass; AII treatment of adipocytes stimulates lipogenesis and suppresses hydrolysis (22, 23).
The endogenous expression of apoE by adipose tissue from humans and rodents has been demonstrated, and an important effect of endogenous apoE on adipocyte size, triglyceride synthesis, and triglyceride hydrolysis has been very recently demonstrated (7, 8, 9). Endogenous expression of apoE in adipocytes also impacts the expression of a number of adipocyte genes including those coding for enzymes in the fatty acid oxidation pathway (9). Physiologically relevant regulation of apoE has also been recently confirmed. ApoE expression in human adipose tissue and in 3T3-L1 cells is increased by treatment with peroxisome proliferator-activated receptor
agonists, and in 3T3-L1 cells is decreased by treatment with TNF
(8). We have also recently shown that adipocyte apoE expression is modulated by organismal energy balance (12). Obesity induced by feeding high-fat diet, or by the hyperphagia attending leptin deficiency, reduces adipocyte apoE expression. Conversely, acute fasting or chronic hypocaloric intake increases adipocyte apoE expression. In isolated adipocytes, we have noted that absence of apoE expression suppresses triglyceride synthesis and increases hydrolysis, and these defects can be reversed by adenoviral-mediated expression of apoE (8). Therefore, we have interpreted the suppression of apoE expression in response to obesity as a homeostatic response to limit the further accumulation of triglycerides by adipocytes (12). AII treatment of adipocytes has been shown to stimulate triglyceride synthesis and suppress hydrolysis. Therefore, the suppression of apoE expression by AII could also be a homeostatic response to limit further triglyceride accumulation in adipocytes. Adipocytes are also direct targets of glucose and insulin, and these also may play a role in modulating adipose tissue apoE expression in response to nutritional manipulation (24, 25). Recently reported observations suggest that insulin and AII can work cooperatively to modulate aspects of adipocyte lipid metabolism including scavenger receptor B1 function (26).
AII has been shown to have negative effects on the vasculature and systemic oxidant stress (27), and its systemic proinflammatory effects can be blocked by treatment with AT1 receptor blockers (28). Our current results establish a new regulatory target of AII, adipocyte apoE expression. The relationship between apoE, AII, and overall adipose tissue physiology is likely to be complex, and additional data will be needed before a comprehensive and integrated model of their roles in adipose tissue can be proposed. Both apoE and components of the renin-angiotensin system are expressed in adipose tissue, and each has important autocrine effects on adipose tissue lipid metabolism and gene expression. Further evaluation of how expression of these two pathways are coordinately regulated in adipose tissue, and the impact that this new regulatory interaction we have demonstrated has on adipose tissue lipid metabolism, will be important for a more complete understanding of adipose tissue lipid flux and the pathophysiology of obesity.
 |
Acknowledgments
|
|---|
We thank Stephanie Thompson for assistance with manuscript preparation and Novartis for supplying the valsartan.
 |
Footnotes
|
|---|
This work was supported by Grant DK 71711 from the National Institutes of Health and an unrestricted grant from Novartis (to T.M.).
Disclosure Statement: P.R. and Z.H.H. have nothing to declare. T.M. has received consulting/speaking honoraria from Amylin, GlaxoSmithKline, Merck, Novartis, Pfizer, and Takeda, and has received research support from Novartis and Takeda.
First Published Online September 4, 2007
Abbreviations: AII, Angiotensin II; apoE, apolipoprotein E; BMI, body mass index.
Received July 17, 2007.
Accepted August 29, 2007.
 |
References
|
|---|
- Ogden CL, Carroll MD, Curtin LR, McDowell MA 2006 Prevalence of overweight and obesity in the United States, 1999–2004. JAMA 295:1549–1555[Abstract/Free Full Text]
- National Task Force on the Prevention and Treatment of Obesity 2000 Overweight, obesity, and health risk. Arch Intern Med 160:898–904[Abstract/Free Full Text]
- Flegal KM, Carroll MD, Ogden CL, Johnson CL 2002 Prevalence and trends in obesity among US adults. JAMA 288:1723–1727[Abstract/Free Full Text]
- Fantuzzi G, Mazzone T 2007 Adipose tissue and atherosclerosis—exploring the connection. Arterioscler Thromb Vasc Biol 27:996–1003[Abstract/Free Full Text]
- Mazzone T, Meyer PM, Kondos GT, Davidson MH, Feinstein SB, DAgostino Sr RB, Perez A, Haffner SM 2007 Relationship of traditional and non-traditional cardiovascular risk factors to coronary artery calcium in type 2 diabetes. Diabetes 56:849–855[Abstract/Free Full Text]
- Scherer PE 2006 Adipose tissue: from lipid storage compartment to endocrine organ. Diabetes 55:1537–1545[Abstract/Free Full Text]
- Zechner R, Moser R, Newman TC, Fried SK, Breslow JL 1991 Apolipoprotein E gene expression in mouse 3T3–L1 adipocytes and human adipose tissue and its regulation by differentiation and lipid content. J Biol Chem 266:10583–10588[Abstract/Free Full Text]
- Yue L, Rassouli N, Ranganathan G, Kern PA, Mazzone T 2004 Divergent effects of PPAR agonists and TNF on adipocyte apoE expression. J Biol Chem 279:47626–47632[Abstract/Free Full Text]
- Huang ZH, Reardon CA, Mazzone T 2006 Endogenous apoE expression modulates adipocyte triglyceride content and turnover. Diabetes 55:3394–3402[Abstract/Free Full Text]
- Hasty AH, Linton MF, Swift LL, Fazio S 1999 Determination of the lower threshold of apolipoprotein E resulting in remnant lipoprotein clearance. J Lipid Res 40:1529–1538[Abstract/Free Full Text]
- Thorngate FE, Rudel LL, Walzem RL, Williams DL 2000 Low levels of extrahepatic nonmacrophage ApoE inhibit atherosclerosis without correcting hypercholesterolemia in ApoE-deficient mice. Arterioscler Thromb Vasc Biol 20:1939–1945[Abstract/Free Full Text]
- Huang ZH, Luque RM, Kineman RD, Mazzone T 2007 Nutritional regulation of adipose tissue apolipoprotein E expression. Am J Physiol Endocrinol Metab 293:E203–E209
- Berg AH, Scherer PE 2005 Adipose tissue, inflammation, and cardiovascular disease. Circ Res 96:939–949[Abstract/Free Full Text]
- Lu H, Boustany-Kari CM, Daugherty A, Cassis LA 2007 Angiotensin II increases adipose angiotensinogen expression. Am J Physiol Endocrinol Metab 292:E1280–E1287
- Tsuchiya K, Yoshimoto T, Hirono Y, Tateno T, Sugiyama T, Hirata Y 2006 Angiotensin II induces monocyte chemoattractant protein-1 expression via a nuclear factor-
B-dependent pathway in rat preadipocytes. Am J Physiol Endocrinol Metab 291:E771–E778 - Mori Y, Itoh Y, Tajima N 2007 Angiotensin II receptor blockers downsize adipotcytes in spontaneously type 2 diabetic rats with visceral fat obesity. Am J Hypertens 20:431–436[CrossRef][Medline]
- Goossens GH, Blaak EE, Arner P, Saris WH, van Baak MA 2007 Angiotensin II: a hormone that affects lipid metabolism in adipose tissue. Int J Obesity 31:382–384[CrossRef][Medline]
- Hattori Y, Akimoto K, Gross SS, Hattori S, Kasai K 2005 Angiotensin II induced oxidative stress elicits hypoadiponectinemia in rats. Diabetologia 48:1066–1074[CrossRef][Medline]
- Gorzelniak K, Engeli S, Janke J, Luft FC, Sharma AM 2002 Hormonal regulation of the human adipose-tissue renin-angiotensin system: relationship to obesity and hypertension. J Hypertens 20:965–973[CrossRef][Medline]
- Goossens GH, Blaak EE, van Baak MA 2003 Possible involvement of the adipose tissue renin-angiotensin system in the pathophysiology of obesity and obesity-related disorders. Obes Rev 4:43–55[CrossRef][Medline]
- Kershaw EE, Flier JS 2004 Adipose tissue as an endocrine organ. J Clin Endocrinol Metab 89:2548–2556[Abstract/Free Full Text]
- Sturk T, van Harmelen V, Hauner H 2004 Angiotensin II stimulates the release of interleukin-6 and interleukin-8 from cultured human adipocytes by activation of NF-
B. Arterioscler Thromb Vasc Biol 24:1199–1203[Abstract/Free Full Text] - Goossens GH, Blaak EE, Saris WH, van Baak MA 2004 Angiotensin II-induced effects on adipose and skeletal muscle tissue blood flow and lipolysis in normal weight and obese subjects. J Clin Endocrinol Metab 89:2690–2696[Abstract/Free Full Text]
- Bluher M, Wilson-Fritch L, Lezyki J, Lausten PG, Corvera S, Kahn R 2004 Role of insulin action and cell size on protein expression patterns in adipocytes. J Biol Chem 279:31902–31909[Abstract/Free Full Text]
- Lin Y, Berg AH, Iyangar P, Lam TK, Giacca A, Combs TP, Rajala MW, Du X, Rollman B, Li W, Hawkins M, Barzilai N, Rhodes CJ, Fantus IG, Brownlee M, Scherer PE 2005 The hyperglycemia-induced inflammatory response in adipocytes: the role of reactive oxygen species. J Biol Chem 280:4617–4626[Abstract/Free Full Text]
- Yvan-Charvet L, Bobard A, Bossard P, Massiera F, Rousset X, Ailhaud G, Teboul M, Ferre P, Dagher G, Quignard-Boulange A 2007 In vivo evidence for a role of adipose tissue SR-BI in the nutritional and hormonal regulation of adiposity and cholesterol homeostasis. Arterioscler Thromb Vasc Biol 27:1340–1345[Abstract/Free Full Text]
- Ayabe N, Babaev VR, Tang Y, Tanizawa T, Fogo AB, Linton MF, Ichikawa I, Fazio S, Kon V 2006 Transiently heightened angiotensin II has distinct effects on atherosclerosis and aneurysm formation in hyperlipidemic mice. Atherosclerosis 184:312–321[CrossRef][Medline]
- Dandona P, Kumar V, Aljada A, Ghanim H, Syed T, Hofmayer D, Mohanty P, Tripathy D, Garg R 2003 Angiotensin II receptor blocker valsartan suppresses reactive oxygen species generationin leukocytes, nuclear factor-
B, in mononuclear cells of normal subjects: evidence of an antiinflammatory action. J Clin Endocrinol Metab 88:4496–4501[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Z. H. Huang, R. D. Minshall, and T. Mazzone
Mechanism for Endogenously Expressed ApoE Modulation of Adipocyte Very Low Density Lipoprotein Metabolism: ROLE IN ENDOCYTIC AND LIPASE-MEDIATED METABOLIC PATHWAYS
J. Biol. Chem.,
November 13, 2009;
284(46):
31512 - 31522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yue and T. Mazzone
Peroxisome Proliferator-activated Receptor {gamma} Stimulation of Adipocyte ApoE Gene Transcription Mediated by the Liver Receptor X Pathway
J. Biol. Chem.,
April 17, 2009;
284(16):
10453 - 10461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Espiritu and T. Mazzone
Oxidative Stress Regulates Adipocyte Apolipoprotein E and Suppresses Its Expression in Obesity
Diabetes,
November 1, 2008;
57(11):
2992 - 2998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yue, J. W. Christman, and T. Mazzone
Tumor Necrosis Factor-{alpha}-Mediated Suppression of Adipocyte Apolipoprotein E Gene Transcription: Primary Role for the Nuclear Factor (NF)-{kappa}B Pathway and NF{kappa}B p50
Endocrinology,
August 1, 2008;
149(8):
4051 - 4058.
[Abstract]
[Full Text]
[PDF]
|
 |
|