help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-2163
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Araújo, R. S.
Right arrow Articles by Bachega, T. A. S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Araújo, R. S.
Right arrow Articles by Bachega, T. A. S. S.
Related Collections
Right arrow Adrenal and Hypertension
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 10 4028-4034
Copyright © 2007 by The Endocrine Society

Microconversion between CYP21A2 and CYP21A1P Promoter Regions Causes the Nonclassical Form of 21-Hydroxylase Deficiency

Rogério S. Araújo, Berenice B. Mendonca, Ângela S. Barbosa, Chin J. Lin, José A. M. Marcondes, Ana Elisa C. Billerbeck and Tânia A. S. S. Bachega

Unidade de Endocrinologia do Desenvolvimento e Laboratorio de Hormonios e Genetica Molecular (R.S.A., B.B.M., C.J.L., J.A.M.M., A.E.C.B., T.A.S.S.B.), LIM/42, Disciplina de Endocrinologia, Hospital das Clinicas da Faculdade de Medicina da Universidade de Sao Paulo, SP 05403-900, Brazil; and Centro de Biotecnologia (A.S.B.), Instituto Butantan, 05504-900 Sao Paulo, SP, Brazil

Address all correspondence and requests for reprints to: T. A. S. S. Bachega, M.D., Hospital das Clínicas, Faculdade de Medicina da Universidade de Sao Paulo, Disciplina de Endocrinologia, Av Dr Enéas de Carvalho 155, 2 andar, Bloco 6, São Paulo, SP, CEP 05403-900, Brasil. E-mail: tbachega{at}usp.br.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Most mutations causing 21-hydroxylase deficiency originate from microconversions between CYP21 pseudogenes and active genes. However, around 20% of the alleles in the nonclassical form (NC-21OHD) remain without identified mutations, suggesting the involvement of regulatory regions. The pseudogene promoter is 80% less active than the CYP21A2 due to the presence of –126C>T, –113G>A, –110T>C, and –103A>G mutations. Additionally, mutations in the steroidogenic factor-1 binding sites of the CYP21 distal regulatory region, located at 4676 bases upstream from the cap site of the CYP21A2 gene, decrease its transcription to 35%.

Objective: The objective of the study was to investigate the CYP21A2 promoter/regulatory regions in NC-21OHD patients with undetermined genotype.

Subjects: The study included 17 NC-21OHD patients and 50 controls.

Methods: Promoter/regulatory regions were sequenced from peripheral leukocytes’ genomic DNA. The identified substitutions were evaluated through EMSA using –132/–97 wild-type and mutant probes and nuclear extracts from NCI-H295A cells. Transcriptional activity studies were performed with wild-type and mutant constructions transfected in NCI-H295A cells.

Results: No mutations were identified in the distal regulatory regions. The –126C>T, –113G>A, –110T>C promoter mutations were found in compound heterozygosity with the V281L mutation in one patient and the –126C>T mutation in compound heterozygosity with the I2 splice in another. The –126T mutation decreases the transcriptional activity to 52%, compatible with the patient’s nonclassical phenotype. EMSA demonstrated that the –132/–121 region is important for the DNA interaction with the specificity protein-1 transcription factor.

Conclusion: Microconversions between CYP21A2 and CYP21A1P promoters could be involved in the nonclassical phenotype. Therefore CYP21A2 promoter analysis should be included in genetic studies of 21OHD.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
THE 21-HYDROXYLASE ENZYME is essential for the adrenal steroidogenesis (1), and its deficiency results in one of the most frequent autosomal recessive disorders. The disease presents a spectrum of clinical manifestations including the classical form, in which females present with prenatal external genitalia virilization and both sexes present with postnatal virilization, with or without salt wasting crises. The nonclassical form is characterized by precocious pubarche at infancy or afterward by menstrual abnormalities, hirsutism, acne, and/or infertility. This latter form could even be asymptomatic and is generally diagnosed through familial studies (2). This wide phenotypic variability, from salt wasting to the nonclassical form, is due to different degrees of enzymatic activity caused by several mutations in the gene that codes for the enzyme (CYP21A2) (3, 4, 5, 6, 7, 8, 9).

The most common source of mutations, involving around 95% of the alleles, is the result of recombination events between the homologous pseudogene (CYP21A1P) and the active CYP21A2 gene (10, 11), whereas the remaining 5% represent new mutations. In population studies with a significant number of nonclassical patients, the percentage of alleles with identified mutations is variable, ranging from 80% up to 100% (7, 12, 13, 14, 15), suggesting the necessity to evaluate the CYP21A2 regulatory regions.

The 5' untranslated region of the CYP21 genes responsible for transcriptional activity is mainly located in the first 167 nucleotides upstream the ATG codon and contains binding-site sequences for specificity protein (Sp)-1 and adrenal-specific protein transcription factors (16, 17). In this fragment the pseudogene promoter differs from the CYP21A2 one in only four nucleotides, located at –126, –113, –110, and –103 positions. These differences cause a lower affinity of the pseudogene’s promoter to the transcription factors and consequently reduce its transcriptional activity to 20% when compared with the CYP21A2 gene (18, 19).

A region of 1 kb in length located 4.6–5.6 kb upstream from the CYP21A2 gene, inside the intron 35 of the C4B gene, acts as a CYP21 regulatory region (20). This region contains the ZB promoter gene (Fig. 1Go), which in turn contains two consensus binding sites for the steroidogenic factor-1 transcription factor (21). In vitro mutagenesis and expression experiments showed that mutations in steroidogenic factor-1 binding sites decrease the CYP21A2 transcription activity to 35%, suggesting that this region might act as an enhancer of the CYP21A2 transcription.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 1. Diagram of the human C4/CYP21 locus on short arm of chromosome 6p21.3. The centromere is to the right and the telomere to the left. Bottom, Scale diagram of the CYP21A2 5'-flanking DNA showing the locations of the CYP21A2 proximal promoter and intron 35 of the C4B gene (ZB promoter gene). Class III, Locus of HLA Class III genes.

 
Despite this evidence, the involvement of the regulatory/promoter regions was rarely evaluated in patients with 21-hydroxylase deficiency (22, 23, 24). We speculated that mutations in these regions could be responsible for the nonclassical phenotype in patients with an undetermined genotype.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Subjects

This work was approved by the Ethical Committee of the Hospital das Clinicas da Universidade de Sao Paulo, and written informed consent was obtained from the patients or their caretakers and from the controls.

In previous work, after CYP21A2 gene sequencing, 17 patients with nonclassical form of 21-hydroxylase deficiency remained with at least one allele with no identified mutation (25). The CYP21A2 promoter/regulatory regions from these patients and 50 normal individuals were analyzed in this paper.

Patients’ clinical, hormonal, and molecular data at diagnosis are shown in Table 1Go. Sixteen patients are females, 15 of these having hyperandrogenism (precocious pubarche, acne, hirsutism, infertility, and/or menstrual abnormalities) and one having adrenal incidentaloma. One patient, a boy (case 15), had precocious pubarche at 6 yr old, Tanner III stage, and an advanced bone age. All patients had ACTH-stimulated 17OH-progesterone (17OHP) levels greater than 10 ng/ml (30.3 nmol/liter).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Clinical, hormonal, and molecular data of patients with the nonclassical form of 21-hydroxylase deficiency

 
Methods

Hormone assays. Cortisol and testosterone serum levels were measured by immunofluorometric assays, and the intra- and intervariation coefficients were less than 8%. Androstenedione and 17OHP serum levels were measured by immunoradioassays, and the intra- and interassay variation coefficients were 12 and 18%, respectively.

Molecular study of the CYP21A2 promoter/regulatory regions. Genomic DNA samples were obtained from peripheral blood leukocytes by standard procedures.

The primers P1-P48 (26) were used to amplify the fragment containing the –370 bp CYP21A2 promoter, and the C4BIn34-C4Bin38T primers to amplify the intron 35 of the C4B gene. The primers P48 and C4BIn38T are specific for the CYP21A2 and C4B genes, respectively. The sequence of the C4BIn34 primer is GCAGGGCCTGTGACCAACT and the C4Bin38T primer is ACAGGTCATGCACGCAGCC. The C4B and CYP21A2 gene numbering followed the one published by Ulgiati et al. (27) and the one by Higashi et al. (28), respectively. The PCR program used to amplify the C4B intron 35 and CYP21A2 promoter was: one cycle at 96 C for 3 min; 30 cycles at 96 C for 1 min, 57/56 C for 30 sec, 72 C for 3 min; one cycle at 72 C for 5 min. The amplified fragments were sequenced with the Big Dye Terminator sequencing kit. (Applied Biosystem, Foster City, CA) and submitted to capillary electrophoresis on the ABI PRISM 3100 sequencer analyzer (Applied Biosystem). The primers used in the sequencing are described in Table 2Go.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Primers used in the sequencing of CYP21A2 promoter and intron 35 of C4 gene

 
EMSA. Gel shift assays were performed using nuclear extracts from human NCI-H295A cells (29), kindly provided by Professor Walter L. Miller (University of California, San Francisco, San Francisco, CA). Nuclear proteins, were purified from the cell lysates as described (30). Protein concentrations were determined by the Bradford method (Bio-Rad Protein assay reagent, Bio-Rad Laboratories, Inc., Hercules, CA), using BSA as a standard. Double-stranded probes were obtained by hybridizing 5' end-labeled oligonucleotides with their respective nonlabeled complementary oligonucleotides (30). The sequences of the wild-type and mutant probes are described in Figs. 2–4GoGoGo. Twenty micrograms of nuclear protein, 2.0 µg of poly dI-dC, and the labeled probe (1.0 x 106 cpm/µl) were mixed in 20 µl of binding buffer [20 mM HEPES (pH 7.9), 80 mM KCl, 5 mM MgCl2, 5% glycerol, 0.1 mM EDTA, and 0.2 mM dithiothreitol]. The reactions were incubated for 20 min on ice as described (31). For competition assays, 50- and 100-fold excess of unlabeled oligonucleotides were added to the reaction mixtures. The reactions were identical for the supershift assays, except for the addition of anti-Sp1 and anti-Sp3 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), which were preincubated for 15 min on ice with nuclear extracts. The DNA-protein complexes were resolved on 4% polyacrilamide/0.5x Tris-borate EDTA gels and analyzed by a PhosphorImager (STORM 860, software l.Q. 5.2, Storage Phosphor Screen GP; Molecular Dynamics, Sunnyvale, CA).


Figure 2
View larger version (64K):
[in this window]
[in a new window]

  		FIG. 2. EMSA interaction of the 21A2 and 21A1P probes with nuclear proteins from adrenocortical NCI-H295A cells. The competitor DNA and its molar excess amount (100 X) used in the reactions are indicated on top of lanes 3 and 4. Shifted DNA-protein complexes are indicated on the left side of the autoradiograph (C1, C2, and C3).

 

Figure 3
View larger version (65K):
[in this window]
[in a new window]

  		FIG. 3. The nucleotide sequences of the full-length CYP21A2 probe (21A2) and those originated by a shorter one, without nucleotides –132 to –121 (A2-C-WT and A2-C-Mut) are shown at the top of the figure. The A2-C-mut probe has a single nucleotide substitution (G to A) at position –113. Interaction of these probes with nuclear proteins from NCI-H295A cells competed with A2-C-Mut or A2-C-WT DNA. The competitor DNA and its molar excess amounts (50 X and 100 X) used in the reactions are indicated on the right. Shifted DNA-protein complexes are indicated on the left side of the autoradiograph (C2, C3, and C4).

 

Figure 4
View larger version (90K):
[in this window]
[in a new window]

  		FIG. 4. Interaction of full-length 21A2, A2-C-WT, and A2-C-Mut probes (top) with nuclear proteins from NCI-H295A cells. Interaction of probes with nuclear proteins and anti-Sp1 and anti-Sp3 antibodies are indicated in columns 4–9. Shifted DNA-protein complexes are indicated on the left side of the autoradiograph (C1, C2, and C3). Supershift is indicated in column 4.

 
Site-directed mutagenesis. The –370-bp fragment containing the wild-type sequence of the CYP21A2 promoter region cloned upstream from the firefly luciferase reporter gene in the pGL3-basic vector (Promega, Madison, WI) was kindly provided by Professor Walter Miller (21). The –126 C>T mutation was introduced by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s instructions. In brief, 200 ng of wild-type plasmid as template, 400 µM deoxynucleotide triphosphate, 1 U of Pfu polymerase, 250 ng of the sense (5' GCCACTCTGTGGGTGGGTCGGTGGGAG 3'), and 250 ng of the antisense (5' AGACCACCGACCCACCCACAGAGTGGC 3') mutant primers were submitted to PCR, and the amplified products were treated with 20 U of DpnI at 37 C for 90 min. One microliter of this product was used for transformation in the Escherichia coli DH5{alpha}, and afterward the DNA isolation (Wizard Plus Maxipreps; Promega) was performed. The constructions used for the transfection studies were pGL3 basic, wild-type (–0.3/pGL3-Luc WT) and mutant (–0.3/pGL3-Luc –126C>T). The fidelity of all constructions was verified by sequencing, and after that, they were purified using QIAGEN columns (QIAGEN, Valencia, CA).

Cell cultures, transfections, and dual luciferase reporter assays. An adherent subline of human adrenocortical carcinoma cells (NCI-H295A) (29) was maintained in RPMI 1640 medium supplemented with 2% fetal calf serum and antibiotics (100 U/ml penicillin, 0.25 µg/ml amphotericin, 100 µg/ml streptomycin), 5 ng/ml selenium, 5 µg/ml insulin, and 5 µg/ml transferrin. Cells were maintained at 37 C with 5% CO2. For transient transfections with the luciferase reporter constructions, cells were grown to 80% confluence in 10-cm petri dishes and split into 6-well plates 24 h before the transfection. Two hours before the transfection experiments, the RPMI 1640 medium was replaced by the DMEM-H16 medium (Life Technologies, Gaithersburg, MD), supplemented with the antibiotics listed above and 10% fetal calf serum. Equal molar amounts of basic, wild-type, and mutant constructions (2.5 µg/well) were transfected into NCI-H295A cells using the calcium phosphate-DNA coprecipitation methodology (Profection mammalian transfection system kit; Promega). Cotransfection of 125 ng/well of the Renilla luciferase reporter (Promega) was used as a control for transfection efficiency. After incubation for 15 h, the medium was replaced by RPMI 1640 fresh medium, and cells were incubated for an additional 24 h. Cells were harvested and the luciferase activity was measured in cellular extracts using the dual-luciferase reporter assay system (Promega). The firefly luciferase activity was normalized by the Renilla luciferase, and the result was expressed as relative luciferase activity. The reference value was obtained from the wild-type (–0.3/pGL3-Luc WT) construction and determined as 100%. The results of the basic and mutant constructions were compared with the reference value. All constructions were transfected in triplicate, and the results represent the mean of three independent experiments ± SE.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
Substitutions in the CYP21A2 promoter and intron 35 of the C4B genes

Mutations in the CYP21A2 promoter were found in two of 17 patients (11.7%). Patient 1 had –126C>T, –113G>A, and –110T>C promoter mutations in compound heterozygosity with the V281L mutation, which is associated with the nonclassical form (32). Patient 2 had the –126C>T promoter mutation in compound heterozygosity with the I2 splice mutation, which is associated with the classical form (33). All the mutations were inherited from one of the parents. None of the 100 control alleles had the –126C>T, – 113G>A, – 110T>C, and –103A>G promoter mutations.

The 15 remaining patients, without mutations in the CYP21A2 promoter, also did not present mutations in the distal regulatory region. Nevertheless, three allelic variants 14,530A>C, 14,629G>A, and 15,094T>G in the intron 35 of the C4B gene (C4B gene numbering) were identified in 3.5, 14.3, and 7%, respectively, of the patients’ alleles and also in 3, 5, and 9%, respectively, of the controls’ alleles.

Identification of protein/DNA complexes with the –132/–97 probes

The binding of the –132/–97 CYP21A1P and CYP21A2 probes with nuclear factors resulted in the formation of three specific complexes, which competed with 100-fold excess molar of these unlabeled probes. The complexes 1 and 2 were less intense with the CYP21A1P probe, indicating reduced affinity to nuclear proteins (Fig. 2Go).

The binding of a shorter CYP21A2 probe (A2-C-WT), lacking the nucleotides –132 to –121, demonstrated the persistence of complexes 2 and 3, whereas complex 1 was abolished (Fig. 3Go). The shorter mutant probe (A2-C-mut), bearing a single nucleotide substitution, –113 G>A, almost abolished the complex 2 formation and formed an additional complex, termed complex 4 (Fig. 3Go, column 2). A 50-fold excess amount of unlabeled A2-C-mut did not compete in the DNA/protein complexes formed by the A2-C-WT probe (Fig. 3Go, column 3), but partial competition was observed using a 100-fold excess (Fig. 3Go, column 4). On the other hand, the wild-type unlabeled short probe competed efficiently (Fig. 3Go, columns 5 and 6).

The addition of anti-Sp1 in the experiments, in which the three different probes (–132/–97 CYP21A2, A2-C-WT, and A2-C-mut) were used, demonstrated that only the full-length probe abolished complex 1 and produced a supershift (Fig. 4Go, column 4). However, the addition of anti-Sp3 produced no effects on the patterns exhibited by these three probes.

Effect of the –126 C>T mutation on transcription activity

The transcriptional activity of the –0.3/pGL3-Luc –126C>T mutant construction was about 52% of the wild-type construction (Fig. 5Go).


Figure 5
View larger version (7K):
[in this window]
[in a new window]

  		FIG. 5. Transcription activity of the –126C>T mutation. The construction containing 300 bp of CYP21A2 promoter, bearing the –126C>T mutation, decreased the transcription activity to 52% in relation to the wild-type construction. Wild-type (–0.3pGL3-WT), mutant (–0.3pGL3–126C>T), and a promoterless vector (pGL3-basic) were transiently transfected into human NCI-H295A cells.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
Except in Southern blot studies, the CYP21A2 promoter has been rarely investigated in patients with 21-hydroxylase deficiency. Even though mutations were not found in the CYP21A2 promoter region in a simple virilizing patient with undetermined genotype (22), we speculated that the promoter region might take part in the 21-hydroxylase deficiency phenotype. The CYP21A2 promoter of 17 nonclassical patients with undetermined genotype was studied, and mutations were found in only two patients. One patient presented the –126C>T, – 113G>A, – 110T>C mutations and the other one only the –126C>T, both characterizing a microconversion event between the pseudo- and active genes.

Our EMSA results indicated a lower binding capacity of the pseudogene sequence to nuclear factors when compared with the wild-type. Moreover, the disappearance of complex 1 with the CYP21A2 probe without the Sp1 binding sequence (GGGCGGG), the formation of a supershift with the use of an anti-Sp1 antibody and the full-length CYP21A2 probe demonstrated that the Sp1 factor binds to the –132/–121 region. Our data, using human NCI-H295A cells, are in accordance with previous reports that used mouse adrenal Y1 cells (17, 19, 31). It has been suggested that nuclear proteins interacting at or near the –113 position may affect the Sp1 binding site at the –126 nucleotide, or vice versa (31). Using the CYP21A2 probe mutated at the –113 nucleotide and lacking the Sp1 consensus binding site, we observed a decreased formation of complex 2 in comparison with the wild-type probes. These data demonstrated that a specific nuclear factor should bind to this position; however, this factor remains unknown.

The decrease of DNA/nuclear protein interactions caused by the pseudogene promoter mutations suggests an impairment in transcriptional activity. The –113G>A transcriptional activity is reduced to 20% in comparison with the activity of the wild-type promoter; similar to the activity of the pseudogene promoter bearing the four mutations (31). There are no data concerning the transcription impairment caused by the three other promoter mutations (–126, – 110, and –103) analyzed separately. We demonstrated that the single –126C>T mutation, present in our second patient, decreased the transcriptional activity to 52%.

The literature reported some cases bearing a microconversion of pseudogene promoter in cis with the P30L mutation in patients with the classical and nonclassical forms (7, 23). However, because these studies did not perform promoter sequencing, it is not known which mutations are present. Therefore, we can suppose that different promoter genotypes can give origin to the classical or nonclassical phenotypes. This large gene conversion was found in three simple virilizing patients, and the sequencing demonstrated the presence of the –103A>G, –110T>C, –113G>A, and P30L mutations (34). In these cases, it was hypothesized that a synergistic effect of the promoter and the P30L mutations on enzymatic activity could account for the classical form of 21-hydroxylase deficiency phenotype.

In the remaining 15 patients with undetermined genotypes, no mutations were identified in the distal regulatory region as well. Eleven of them had ACTH-stimulated 17OHP levels 17 ng/ml or greater (≥51 nmol/liter) and four had ACTH-stimulated 17OHP levels between 10 and 17 ng/ml (30.3–45 nmol/liter). We cannot rule out the possibility of heterozygosity in the latter four patients because the clinical symptoms of the nonclassical form overlap with those of other hyperandrogenic syndromes (35, 36). Furthermore, these four patients presented with ACTH-stimulated 17OHP levels similar to those found in some obligate heterozygotes (6, 37, 38). Although there is no consensus concerning the 17OHP level for the diagnosis of the nonclassical form of 21-hydroxylase deficiency, it should be emphasized that the current cutoff level of 10 ng/ml (30 nmol/liter) (39) can be associated with false-positive results.

In conclusion, we report for the first time a nonclassical patient bearing a promoter point mutation in compound heterozygosity with a splice site mutation. Because no other substitutions that could justify the phenotype were found, we suggest that this promoter mutation could contribute to the patient’s phenotype. Further studies analyzing the CYP21A2 promoter sequence in nonclassical patients will help to corroborate our findings.


   Footnotes
 
This work was partially supported by grants from Fundação de Amparo à Pesquisa dio Estado de São Paulo 98/00243-9, 99/06468-5. and was supported by Grants 301958/2003-3 (to T.A.S.S.B.) and 300828/2005-5 (to B.B.M.) from Conselho Nacional de Desenvolvimento Centifico e Technológico.

Disclosure Statement: The authors have nothing to declare.

First Published Online July 31, 2007

Abbreviations: 17OHP, 17OH-progesterone; Sp1, specificity protein-1.

Received October 3, 2006.

Accepted July 23, 2007.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. White PC, Speiser PW 2000 Congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Endocr Rev 21:245–291[Abstract/Free Full Text]
  2. Levine LS, Dupont B, Lorenzen F, Pang S, Pollack M, Oberfield S, Kohn B, Lerner A, Cacciari E, Mantero F, Cassio A, Scaroni C, Chiumelo G, Rondanini GF, Gargantini C, Giovannelli G, Virdis R, Bartolotta E, Migliori C, Pintor C, Tato L, Barboni F, New MI 1980 Cryptic 21-hydroxylase deficiency in families of patients with classical congenital adrenal hyperplasia. J Clin Endocrinol Metab 51:1316–1324[Abstract/Free Full Text]
  3. Speiser PW, Dupont J, Zhu D, Serrat J, Buegeleisen M, Tusie-Luna MT, Lesser M, New MI, White PC 1992 Disease expression and molecular genotype in congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J Clin Invest 90:584–595[Medline]
  4. Wedell A, Thilén A, Ritzén EM, Stengler B 1994 Mutational spectrum of the steroid 21-hydroxylase gene in Sweden: implications for genetic diagnosis and association with disease manifestation. J Clin Endocrinol Metab 78:1145–1152[Abstract]
  5. Wilson RC, Mercado AB, Cheng KC, New MI 1995 Steroid 21-hydroxylase deficiency: genotype may not predict phenotype. J Clin Endocrinol Metab 80:2322–2329[Abstract]
  6. Rumsby G, Avey CJ, Conway GS, Honour JW 1998 Genotype-phenotype analysis in late onset 21-hydroxylase deficiency in comparison to the classical forms. Clin Endocrinol (Oxf) 6:707–711
  7. Deneux C, Tardy V, Dib A, Mornet E, Billaud L, Charron D, Morel Y, Kuttenn F 2001 Phenotype-genotype correlation in 56 women with nonclassical congenital adrenal hyperplasia due to 21-hydroxylase deficiency. J Clin Endocrinol Metab 86:207–213[Abstract/Free Full Text]
  8. Pinto G, Tardy V, Trivin C, Thalassinos C, Lortat-Jacob S, Nihoul-Fékété C, Morel Y, Brauner R 2003 Follow-up of 68 children with congenital adrenal hyperplasia due to 21-hydroxylase deficiency: relevance of genotype for management. J Clin Endocrinol Metab 88:2624–2633[Abstract/Free Full Text]
  9. Bachega TASS, Billerbeck AEC, Parente EB, Lemos-Marini SHV, Baptista MT, Mello MP, Guerra GJr, Kuperman H, Setian N, Damiani D, Torres N, Castro M, Mendonça BB 2004 Multicentric study of Brazilian patients with 21-hydroxylase deficiency. A genotype-phenotype correlation. Arq Bras Endocrinol Metab 48:697–704[Medline]
  10. Higashi Y, Tanae A, Inoue H, Fujii-Kuryama Y 1988 Evidence for frequent gene conversion in the steroid 21-hydroxylase P-450(C21) gene: implications for steroid 21-hydroxylase deficiency. Am J Hum Genet 42:17–25[Medline]
  11. Donohoue PA, Jospe N, Migeon CJ, Van Dop C 1989 Two distinct areas of unequal crossing over within the steroid 21-hydroxylase genes produce absence of CYP21B. Genomics 5:397–406[CrossRef][Medline]
  12. Barbat B, Bogyo A, Raux-Demay MC, Kutten F, Boue J, Simon-Bouy B, Serre JL, Mornet E 1995 Screening of CYP21 gene mutations in 129 French patients affected by steroid 21-hydroxylase deficiency. Hum Mut 5:126–130[CrossRef][Medline]
  13. Carrera P, Bordone L, Azzani T, Brunelli V, Garancini MP, Chiumello G, Ferrari M 1996 Point mutations in Italian patients with classic, non-classic, and cryptic forms of steroid 21-hydroxylase deficiency. Hum Genet 98:662–665[CrossRef][Medline]
  14. Bachega TASS, Billerbeck AEC, Madureira G, Marcondes JA, Longui CA, Leite MV, Arnhold IJP, Mendonca BB 1998 Molecular genotyping in Brazilian patients with the classical and nonclassical forms of 21-hydroxylase deficiency. J Clin Endocrinol Metab 83:4416–4419[Abstract/Free Full Text]
  15. Weintrob N, Brautbar C, Pertzelan A, Josefsberg Z, Dickerman Z, Kauschansky A, Lilos P, Peled D, Phillip M, Israel S 2000 Genotype-phenotype associations in non-classical steroid 21-hydroxylase deficiency. Eur J Endocrinol 143:397–403[Abstract]
  16. Kagawa N, Waterman MR 1990 cAMP-dependent transcription of the human CYP21B (P-450C21) gene requires a cis-regulatory element distinct from the consensus cAMP-regulatory element. J Biol Chem 265:299–305
  17. Kagawa, N, Waterman MR 1991 Evidence that an adrenal specific nuclear protein regulates the cAMP responsiveness of the human CYP21B (P450C21) gene. J Biol Chem 266:11199–11204[Abstract/Free Full Text]
  18. Bristow J, Gitelman SE, Tee MK, Staels B, Miller WL 1993 Abundant adrenal-specific transcription of the human P450c21A "pseudogene." J Biol Chem 268:12919–12924[Abstract/Free Full Text]
  19. Chang SF, Chung BC 1995 Differences in transcriptional activity of two homologous CYP21A genes. Mol Endocrinol 9:1330–1336[Abstract/Free Full Text]
  20. Tee MK, Babalola GO, Aza-Blanc P, Speek M, Gitelman SE, Miller WL 1995 A promoter within intron 35 of the human C4A gene initiates abundant adrenal-specific transcription of a 1 kb RNA: location of a cryptic CYP21 promoter element? Hum Mol Genet 4:2109–2116[Abstract/Free Full Text]
  21. Wijesuriya SD, Zhang G Dardis A, Miller WL 1999 Transcriptional regulatory elements of the human gene for cytochrome P450c21 (steroid 21-hydroxylase) lie within intron 35 of the linked C4B gene. J Biol Chem 274:38097–38106[Abstract/Free Full Text]
  22. Ninkarm S, Cerame BI, Wei J-Q, Dumic M, Zunec R, Brkljacic L, Skrabic V, New MI, Wilson R 1999 Congenital adrenal hyperplasia (21-hydroxylase deficiency) without demonstrable genetic mutations. J Clin Endocrinol Metab 84:1378–1381[Abstract/Free Full Text]
  23. Bobba A, Marra E, Lattanzio P, Iolascon A, Giannattasio S 2000 Characterization of the CYP21 gene 5' flanking region in patients affected by 21-OH deficiency. Mutation in brief no. 321, online. Hum Mutat 15:481
  24. L’Allemand D, Tardy V, Gruters A, Schnabel D, Krude H, Morel Y 2000 How a patient homozygous for a 30-kb deletion of the C4-CYP21 genomic region can have non-classic form of 21-hydroxylase deficiency. J Clin Endocrinol Metab 85:4562–4567[Abstract/Free Full Text]
  25. Bachega TAAS, Billerbeck AEC, Marcondes JAM, Madureira G, Arnhold IJP, Mendonca BB 2000 Influence of different genotypes on 17-hydroxyprogesterone levels in patients with nonclassical congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Clin Endocrinol (Oxf) 52:601–607[CrossRef][Medline]
  26. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2:499–504[Abstract/Free Full Text]
  27. Ulgiati D, Townend DC, Christiansen FT, Dawkins RL, Abraham LJ 1996 Complete sequence of the complement C4 gene from the HLA-A1, B8, C4AQ0, C4B1, DR3 haplotype. Immunogenetics 43:250–252[Medline]
  28. Higashi Y, Yoshioka H, Yamane M, Gotoh O, Fujii-Kuriyama Y 1986 Complete nucleotide sequence of two steroid 21-hydroxylase genes tandemly arranged in human chromosome: a pseudogene and a genuine gene. Proc Natl Acad Sci USA 83:2841–2845[Abstract/Free Full Text]
  29. Rodriguez H, Hum DW, Staels B, Miller W 1997 Transcription of the human genes for cytochrome P450scc and P450c17 is regulated differently in human adrenal NCI-H295 cells than in mouse adrenal Y1 cells. J Clin Endocrinol Metab 82:365–370[Abstract/Free Full Text]
  30. Read ML 1996 Essential techniques. In: Dockert K, ed. Gene transcription: DNA binding proteins. Chichester, UK: John Wiley and Sons; 6–11
  31. Chin KK, Chang SF 1998 The 104G nucleotide of the human CYP21 gene is important for CYP21 transcription activity and protein interaction. Nucleic Acids Res 26:1959–1964[Abstract/Free Full Text]
  32. Speiser PW, New MI, White PC 1988 Molecular genetic analysis of non-classic steroid 21-hydroxylase deficiency associated with HLA-B14, DR1. N Engl J Med 319:19–23[Abstract]
  33. Higashi Y, Tanae A, Inoue H, Hiromasa T, Fujii-Kuriyama Y 1988 Aberrant splicing and missense mutations cause steroid 21-hydroxylase [P-450 (C21)] deficiency in humans: possible gene conversion products. Proc Natl Acad Sci USA 85:7486–7490[Abstract/Free Full Text]
  34. Araujo RS, Billerbeck AEC, Madureira G, Mendonca BB, Bachega TASS 2005 Substitutions in the CYP21A2 promoter explain the simple-virilizing form of 21-hydroxylase deficiency in patients harbouring a P30L mutation. Clin Endocrinol (Oxf) 62:132–136[CrossRef][Medline]
  35. Admoni O, Israel S, Lavi I, Gur M, Tenenbaum-Rakover Y 2006 Hyperandrogenism in carriers of CYP21 mutations: the role of genotype. Clin Endocrinol (Oxf) 64:645–651[CrossRef][Medline]
  36. New MI 2006 Extensive clinical experience. Nonclassical 21-hydroxylase deficiency. J Clin Endocrinol Metab 91:4205–4214[Abstract/Free Full Text]
  37. Azziz R, Dewailly D, Owerbach D 1994 Clinical review 56: nonclassic adrenal hyperplasia: current concepts. J Clin Endocrinol Metab 78:810–815[CrossRef][Medline]
  38. Bachega TASS, Brenlha EM, Billerbeck AEC, Marcondes JAM, Madureira G, Arnhold IJP, Mendonca BB 2002 Variable ACTH-stimulated 17-hydroxyprogesterone values in 21-hydroxylase deficiency carriers are not related to the different CYP21 gene mutations. J Clin Endocrinol Metab 87:786–790[Abstract/Free Full Text]
  39. New MI, Lorenzen F, Lerner AJ, Kohn B, Oberfield SE, Pollack MS, Dupont BO, Stoner E, Levy DJ, Pang S, Levine LS 1983 Genotyping steroid 21-hydroxylase deficiency: hormonal reference data. J Clin Endocrinol Metab 57:320–326[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
S.-U. Chen, C.-H. Chou, H. Lee, C.-H. Ho, C.-W. Lin, and Y.-S. Yang
Lysophosphatidic Acid Up-Regulates Expression of Interleukin-8 and -6 in Granulosa-Lutein Cells through Its Receptors and Nuclear Factor-{kappa}B Dependent Pathways: Implications for Angiogenesis of Corpus Luteum and Ovarian Hyperstimulation Syndrome
J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 935 - 943.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Araújo, R. S.
Right arrow Articles by Bachega, T. A. S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Araújo, R. S.
Right arrow Articles by Bachega, T. A. S. S.
Related Collections
Right arrow Adrenal and Hypertension

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals