| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Pediatric Endocrinology (M.A.-A., D.H.Z.), Department of Pediatrics, and Departments of Pathology (K.M.), and Human Genetics (Z.B.N., I.L.), Hadassah Hebrew University Medical Center, Jerusalem, Israel 91240; Division of Pediatric Endocrinology (A.J., S.E.O., I.F.), Columbia University, New York, New York 10027; Division of Molecular Genetics (W.K.C., G.S.), Columbia University College of Physicians and Surgeons, New York, New York 10032; Department of Pediatrics (H.J.H.), Shaare-Zedek Medical Center, Jerusalem, Israel 91031; and Pediatric Endocrinology Division (A.B., S.T.), Infant’s and Children’s Hospital of Brooklyn at Maimonides, Brooklyn, New York 11219
Address all correspondence and requests for reprints to: David Zangen, M.D., Division of Pediatric Endocrinology, Department of Pediatrics, Hadassah Hebrew University Medical Centre, P.O. Box 24035, Jerusalem, Israel 91240. E-mail: zangend{at}hadassah.org.il.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Objective: The objective of the study was to identify the mutation(s) in StAR, correlate genotype with phenotype, and determine whether the common mutation represents a founder mutation.
Patients and Setting: Clinical, histopathological, and molecular genetic characterization was performed in these eight patients.
Results: All affected individuals (three XY, five XX) presented neonatally with undetectable adrenocortical hormones and are responding to replacement therapy. Only two sisters had neurodevelopmental deficits. Histopathological findings of excised XY gonads included accumulation of fat in Leydig cells. Significantly, already at 1 yr of age, positive placental alkaline phosphatase and octamer binding transcription factor staining indicated neoplastic potential. Sequence analysis of StAR revealed homozygosity for c.201_202delCT mutation in all eight cases, causing premature termination of the StAR protein. This mutation was confirmed to be a founder mutation using both an intragenic microsatellite and several single nucleotide polymorphism markers. Screening of 100 normal Jerusalem Palestinians detected no carriers of this mutation.
Conclusion: CLAH is rare in the general Palestinian population. In most Palestinian cases, a founder c.201_202delCT mutation in StAR is the cause. The observed early neonatal presentation may reflect the major StAR protein truncation caused by this mutation. A crucial role for StAR in the central nervous system was not supported with normal neurological examinations in six of eight cases. Finally, we advocate early gonadectomy in XY CLAH cases, given the early onset of neoplastic changes observed histologically.
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Mutations in steroidogenic acute regulatory protein (StAR) have been identified in most CLAH patients (2, 3). The StAR protein in the adrenocortical and gonadal cells enables the rapid movement of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane, in which the cholesterol side-chain cleavage enzyme, P450scc, converts cholesterol to pregnenolone (5, 6, 7, 8).
StAR mutations have been repeatedly identified in specific ethnic groups, Q258X accounting for 70% of the mutations in the Japanese and Koreans (4, 9), R182L in Palestinians (3), R182H in eastern Saudia Arabians (4), and L260P in the Swiss (10). The R182L mutation reported in five Palestinian patients is a recurrent mutation because it was identified in various sequence contexts including a Japanese patient (3, 4, 11). Other reported StAR mutations in Palestinians include R193X (11) and c.327_328delCT in exon 3, which is equivalent to c.201_202delCT (12) (subjects D-1 and D-2 of this report).
We report here eight recently diagnosed CLAH cases including six new Palestinian CLAH patients from three families, all homozygous for the c.201_202delCT StAR mutation. Furthermore, we demonstrated that this is a common founder mutation that should lead to improved genetic testing and counseling for CLAH in Palestinians. In addition, this study revealed premalignant changes in the excised testes of 1-yr-old 46 XY CLAH patients, suggesting that early gonadectomy may be beneficial to prevent testicular tumors.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
We studied eight patients from four unrelated Palestinian families (A–D). Family A originates from Hebron, family B from Jerusalem, and families C and D from Ramallah but currently live in New York. The two sisters from family D were previously reported (12). Pedigrees for families A–C are shown in Fig. 1
demonstrating consanguinity in each family. Informed consent was obtained from study participants, and studies were approved by the Institutional Review Boards of Hadassah Hebrew University Medical Center and Columbia University Medical Center.
|
). A pelvic magnetic resonance imaging (MRI) at 12 yr of age showed small gonads (2 ml), the left located in the proximal inguinal canal, and the right, in the lower pelvis, with no uterus. Bilateral gonadectomy was performed. She is an average student, and her prepubertal height is 148.3 cm (8th percentile).
|
), whereas ACTH was elevated (205 pmol/liter). She responded well to replacement therapy. The karyotype was 46 XY. Bilateral inguinal herniorrhaphy and gonadectomy were performed at 1 yr of age. She is a good student in second grade without neurocognitive deficits.
Patient A-3 (A-IV7), a phenotypic female, was diagnosed on the first day of life due to hyperpigmentation. The low maternal serum estriol level and the XY karyotype in amniotic fibroblasts strongly suggested CLAH prenatally, given the family history. Replacement therapy with hydrocortisone and fludrocortisone was initiated. An ACTH test done at 3 months of age revealed severe adrenal insufficiency (Table 1), whereas ACTH levels were significantly elevated (1365 pmol/liter). Left gonadectomy was performed at 9 months of age during surgical correction of a left inguinal hernia. The right gonad was not found in the right inguinal canal. An MRI is planned to localize the right testis. Currently at 3 yr she is developing normally.
Patient A-4 (A-IV8), born at 35 wk gestation, small for gestational age (1700 g) due to placental abruption, was suspected to have CLAH because of skin hyperpigmentation and her family history. Her high ACTH (1257 pmol/liter) and low cortisol (<27.6 nmol/liter) levels confirmed the diagnosis, and hormonal replacement therapy was initiated. Karyotype was 46, XX. Pelvic ultrasound showed a normal uterus and ovaries. Her neonatal head ultrasound was normal. Weight gain, neurological examination, and developmental milestones were normal at 1 yr of age.
Patient B-1 (B-IV1), a 6-yr-old female, was born after a normal pregnancy except low maternal serum estriol. Her physical examination was normal except for hyperpigmentation and a left club foot. At 2 wk of age, she was admitted for recurrent vomiting and weight loss. Laboratory tests revealed severe hyponatremia (107 mmol/liter), hyperkalemia (7.6 mmol/liter), and aldosterone at the lower limit of normal (199 pmol/liter). ACTH stimulation failed to increase the cortisol (0 min, 60.6 nmol/liter; 30 min, 41.3 nmol/liter; 60 min, 74.4 nmol/liter). ACTH was elevated (>200 pmol/liter), and 17-hydroxyprogesterone was undetectable. Karyotype was 46 XX. Her clinical status improved after replacement therapy with hydrocortisone and fludrocortisone. She is an excellent student without neurological deficits.
During the third pregnancy in family B, chorionic villous sampling was performed. An affected XX fetus was diagnosed by mutation analysis, and the pregnancy was electively terminated.
Patient C-1 (C-IV1), a 2-month-old phenotypic female, with hyperpigmentation since the first week of life, presented with a 3-d history of poor appetite, diarrhea, and lethargy. Upon presentation, she had hyponatremia (125 mmol/liter), hyperkalemia (11.7 mmol/liter, hemolyzed), metabolic acidosis (bicarbonate of 14 mmol/liter), and glucose of 80 mg/dl. Her clinical condition improved after iv fluids and empiric ceftriaxone; repeat electrolytes before discharge were improved (Na, 132 mmol/liter; K, 5 mmol/liter; and bicarbonate, 15 mmol/liter). Three days later she developed recurrent vomiting and feeding intolerance. When readmitted she had a tonic-clonic seizure with hyponatremia (111 mmol/liter), hyperkalemia (5.7 mmol/liter), metabolic acidosis (bicarbonate 14 mmol/liter), and glucose of 96 mg/dl. Head computed tomography, abdominal x-ray, and upper gastrointestinal series were normal. A random cortisol level was 27.5 nmol/liter. CLAH was considered with undetectable levels of adrenal hormones and precursors and elevated plasma renin activity (9485 ng/dl·h) (Table 1). An abdominal/pelvic sonogram demonstrated a right adrenal mass measuring 4 cm in largest diameter and a normal uterus and ovaries. Abdominal MRI showed bilaterally enlarged adrenal glands consistent with congenital adrenal hyperplasia. Her karyotype was 46 XX. She currently has met normal developmental milestones at 18 months of age.
The clinical presentation of patients D-1 and D-2 was fully described previously (12). A summary of their clinical data is shown in Table 1.
Hormonal studies
Standard ACTH stimulation tests using Synacthene 0.25 mg/m2 were performed for patients A-1, A-2, A-3, and B-1 at ages of 11 yr, 5 yr, 3 months, and 2 wk, respectively. For family A, these tests were performed later after original presentation when the family was reevaluated. Hydrocortisone was stopped 36 h before the test. For patients B-1 only, the cortisol level was tested after ACTH stimulation. Patient A-4 was diagnosed based on her familial and clinical presentation and the results of basal hormonal tests.
Genetic studies
DNA extraction and sequencing. Genomic DNA was isolated from whole blood according to manufacturer’s instructions (Promega, Madison, WI; or Flexi gene DNA kit; QIAGEN, Valencia, CA). Coding exons of StAR were amplified by PCR (3), and amplicons were bidirectionally sequenced with the BigDye terminator kit using the ABI 310 or ABI 377 sequencer (Applied Biosystems, Foster City, CA). Sequence was analyzed using Sequencher software (Gene Codes Corporation, Ann Arbor, MI) to compare subjects’ sequence to controls’ and reference sequence. In addition, each electropherogram was visually reviewed to identify any heterozygous DNA variants not detected by the automated sequencing software.
Mutation genotyping assay. To genotype the families’ members and normal subjects for the mutation, a mismatch was introduced in the forward primer that creates a restriction site for RsaI in the mutant allele. Using the primers STAREX3mis (TTCTCGGCTGGAAGAGACTGT) and STARex3R (CCTTGAGGATGGCAGTGGA), a PCR product of 180 bp was amplified. In the presence of the mutant allele, this product was cut to 160 bp. Restricted PCR products were electrophoresed on a 3% agarose gel. One hundred unaffected subjects from the general Palestinian population in east Jerusalem were screened by this assay.
Haplotype analysis.
Haplotype analysis of eight informative single-nucleotide polymorphisms (SNPs) and short tandem repeats sequence within and around StAR (Fig. 2A) were performed for patients A-1, B-1, C-1, D-1, and their parents. The polymorphic short tandem repeat identified in the 5' sequence of StAR (Fig. 2A) was amplified by PCR using the primers [STAR (CCTT)n forward, GAGCCAGGGCTTTGGAGCA; (STAR (CCTT)n reverse, GCTCTACGACTGTCCATACT]. PCR products were analyzed on the ABI 3100 with Genescan software (Applied Biosystems). SNPs for eight intragenic and flanking markers (rs12541064, rs2517388, rs6474491, rs2843727, re10112856, rs1488934, rs10102341, and rs10101168) to StAR were genotyped by dideoxy sequencing in patients and parents.
|
Both gonads were excised from patients A-1 and patient A-2 at ages of 12 and 1 yr, respectively. In patient A-3, only the left gonad was excised at 9 months of age.
Gonads were fixed in 10% buffered formaldehyde solution, embedded in paraffin, cut into 5-µm-thick sections, and then deparaffinized and stained with hematoxylin and eosin. In addition, frozen sections from patient A-1 were cut at 5–7 µm and stained with Oil red O. In all cases, consecutive sections were stained with polyclonal antibodies against human placental alkaline phosphatase (PLAP) (Biogenex, San Ramon, CA) and octamer binding transcription factor (OCT 3/4) (Santa Cruz Biotechnology, Santa Cruz, CA).
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Table 1 summarizes the clinical and hormonal data of our patients supporting the diagnosis of CLAH. All patients developed symptoms of primary adrenal insufficiency in the neonatal period. Skin hyperpigmentation was evident by the first week of life, and salt-losing crisis with hypovolemic shock, hyponatremia, and hyperkalemia were common findings. Hypoglycemia was detected in patients A-1, A-2, and D-2. Three siblings (A1–A3) with XY karyotype had female external genitalia with palpable inguinal masses in the two youngest children. Neurological exam and neurocognitive development were grossly normal in all but patient D-1. Only patients D-1 and D-2 were found to have brain MRI findings of focal supratentorial white matter lesions and tonsillar ectopia consistent with Chiari-I malformation, respectively (12). Brain MRI was not performed for the other six patients because it was not clinically indicated. Levels of adrenal steroid precursors and hormones were undetectable along with extremely elevated levels of ACTH and plasma renin activity. ACTH stimulation testing completed in patients A1–A3 on reevaluation revealed no rise in measured 17-hydroxypregnenolone, dehydroepiandrosterone sulfate, testosterone, and cortisol levels. In patients D-1 and D-2, high ACTH levels were suppressed by low-dose dexamethasone (12). All patients grew well on glucocorticoid and mineralocorticoid replacement therapy.
Mutation identification and founder mutation studies
Sequencing of all StAR exons revealed a common mutation in all families. The mutation c.201_202delCT (when 1 is the adenine in the first transcription initiating ATG of the cDNA) is a deletion of a CT in three sequential CTs (Fig. 1B). The deletion creates a stop codon at amino acid 68. The probands are homozygous for the mutation, and all the parents are carriers (Fig. 1C). The same mutation (previously referred to as c.327_328delCT using different nucleotide numbering) was previously reported in family D (12).
After identifying the same mutation in four unrelated families, we tested the hypothesis that this represents a common founder mutation by genotyping a polymorphic short tandem repeat sequence in the 5' sequence of StAR. The affected individuals from the four families are all homozygous for the same polymorphic allele (Fig. 2). In addition, affected individuals from all four families were analyzed for a series of eight informative SNPs spanning approximately 0.5 Mb, located within and flanking StAR. All affected individuals were homozygous for a common AGTGATCT haplotype for the eight markers (Fig. 2B).
To determine the carrier frequency of this founder mutation, we genotyped 100 unaffected Palestinians in east Jerusalem. None of the subjects carried the c.201_202delCT StAR mutation.
Gonadal histopathology
The excised gonads of all XY patients (A1–A3) were histologically abnormal. Those of the younger patients, (A-2, A-3) were identical in appearance, with relatively small, oval seminiferous tubular outlines without basal lamina thickening, and no interstitial fibrosis. As expected at this age, Leydig cells were not visible (see Fig. 4, A and B). The gonads of the oldest sibling A-1, showed significant thickening of the tubular basal lamina and focal intraluminal microcalcifications (Fig. 3, A and B). Leydig cells were visualized in groups of greatly enlarged foam cells, which stained with Oil red O (Fig. 3C).
|
|
, C and D). OCT 3/4 stained occasional intraluminal germ cells in patient A-3, similar to PLAP. These results were consistent with maturation delay (Fig. 4E). In the gonad of patient A-2, however, OCT 3/4 immunostaining was observed in both intraluminal germ cells and germ cells adjacent to the tubular basement membrane (Fig. 4F).
The gonads from the oldest patient, A-1, showed an increased number of germ cells per tubule, compared with her younger siblings. Along with the concerning maturation delay in the younger patients, the germ cells in this patient had further neoplastic changes and met several of the World Health Organization criteria for carcinoma in situ (CIS), including large size; abundant, clear, vacuolated cytoplasm; hyperchromatic nuclei; basal location of the germ cells; and absence of spermatogenesis. PLAP (Fig. 3D) and OCT 3/4 immunostaining were strongly positive in these cells.
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
) was found to have the same founder mutation. This mutation results in a truncated StAR protein at amino acid 68. The amino-terminal end of STAR is important to its localization to the mitochondria, whereas the carboxyl-terminal domain is crucial to its activity (3, 13). Truncated StAR proteins with much smaller deletions of 28 carboxyl-terminal amino acids completely abolishes its activity (2), suggesting that the c.201_202delCT mutation lacking 217 carboxyamino acids will have no activity and would be predicted to result in a severe phenotype. All eight patients were symptomatic early in the neonatal period as would have been predicted based on the severity of the mutation.
|
Variable, rare neurological abnormalities have been described in a number of CLAH patients with StAR mutations including mental retardation, cerebral atrophy, cerebral palsy, and seizures. Patient D-1 from our cohort has reduced IQ of 80, attention-deficit hyperactivity disorder, and white matter lesions consistent with demyelination. Patient D-2 has Chiari-I malformation (12). One of the suggested explanations is that the aberrant StAR function in the brain may cause a decrease in neurosteroid production (16, 17, 18, 19). Another hypothesis is that neonatal hypoglycemia or electrolyte derangements may cause damage to the brain that is manifested later as mental retardation or attention-deficit hyperactivity disorder in CLAH patients (12, 19). In the current study, six of eight cases have no neurological deficits and have normal development and cognitive function into adolescence (A-1). Although there may be an increase in neurocognitive deficits with CLAH, the frequency may be low, especially with prompt diagnosis and intervention. Therefore, StAR mutations may not be a sole explanation for previously reported neurological deficits in CLAH. Prospective long-term neurodevelopmental evaluations will be important in discerning StAR’s role in the brain.
On review of disorders in testosterone biosynthesis, gonads were initially thought not to be prone to neoplasia (20). Korsch et al. (15) reported the first case of gonadal neoplasia and the pathological findings in a 15-yr-old female patient with 46 XY karyotype and a mutation in StAR. No lipid accumulation was found in the Leydig cells. Our contrasting finding of enlarged foamy Leydig cells in the XY 12-yr-old patient similar to previous reports (21, 22, 23) supports the two-hit model of pathogenesis of CLAH, proposed by Bose et al. (3). This model theorizes that the steroidogenic defect in CLAH is caused by two separate events: the initial StAR mutation allows a low level of StAR-independent steroidogenesis, followed by a compensatory increase in ACTH and LH that stimulates cholesterol uptake and de novo synthesis, resulting in cholesterol ester accumulation within lipid droplets of the adrenal and gonadal cells, ultimately leading to cellular damage and complete loss of steroidogenesis.
Immunohistochemical markers, such as PLAP and OCT 3/4, which are expressed in fetal gonads and occasionally shortly after birth, are used later to demonstrate CIS in children with intersex and undervirilization (24, 25, 26, 27, 28, 29). In the 15-yr-old patient with CIS described by Korsch et al. (15), positive PLAP immunoreactivity was detected in the right intrabdominal gonad but not in the left inguinal gonad. Our 12-yr-old patient, A-1, was found to have CIS in both gonads (right pelvic, left inguinal), confirming the neoplastic potential of gonads with disorders in testosterone biosynthesis. Furthermore, germ cells in our 9-month- and 1-yr-old XY CLAH patients also demonstrated PLAP staining. Retention of PLAP in germ cells in the two younger affected siblings as well as retention of OCT 3/4 expression in intraluminal germ cells in patient A-3 is concerning but may be interpreted as a maturation delay. However, the presence of OCT 3/4-positive germ cells both intraluminally and along the tubular basement membrane in patient A-2 (1 yr) is suggestive of early neoplastic changes. Similar immunohistochemical findings have been reported in a 4-yr-old patient with 17-hydroxysteroid dehydrogenase deficiency (29).
It has been hypothesized that maturation delay of gonadal cells, in gonadal dysgenesis disorders, may render them susceptible to neoplastic transformation (30). Impaired gonadal development resulting in the arrest of gonocyte differentiation and retention of its embryonic features, associated with an increasing genomic instability, is the most probable model for the pathogenesis of CIS (31). The positive PLAP and OCT 3/4 immunostaining in excised gonads of all our XY CLAH patients supports this hypothesis. The current recommendation is to perform gonadectomy in patients with androgen biosynthesis defects raised as females before puberty to prevent malignancy (32); however, the optimal timing for gonadectomy is controversial. Because the estimated risk of developing an invasive testicular germ cell tumor in a CIS testis is believed to be 50% within 5 yr and 70% within 7 yr (at least in adults) (33, 34) our positive PLAP and OCT 3/4 immunostaining results already appreciated at 1 yr of age may support gonadectomy as early as the time of diagnosis.
Lastly, we demonstrate here that the c.201_202delCT mutation is probably the most common mutation in the Palestinian population (Table 2). We confirmed that the c.201_202delCT mutation is a Palestinian founder mutation and is probably not frequently found in the Palestinian population sampled in east Jerusalem. This has important clinical implications because of the potential life-threatening nature of this disease. Affected individuals at birth could be promptly genetically tested for this common StAR mutation and treated with hormonal supplementation to improve outcomes. Although the four families were not aware of any common ancestry, they have identified their ancestral backgrounds to Hebron, Jerusalem, and Ramallah, cities that are relatively close to each other (within 100 miles distance). Each of the four families is consanguineous, and there may be population stratification within the Palestinians such that the 100 Palestinians genotyped may not have sampled all subpopulations. More exhaustive carrier screening is necessary to determine the potential utility of population-based carrier screening as part of a panel of recessive conditions such as cystic fibrosis or Tay Sachs currently done for the Ashkenazim population. Carrier screening for CLAH would allow couples to make informed premarital and reproductive decisions and/or allow for presymptomatic management of affected newborns.
In conclusion, we have identified a founder mutation, c.201_202delCT in StAR, as a common cause of CLAH in Palestinians. The normal neurological examination in most of these children does not support a primary role for the StAR protein in the brain. The severe neonatal presentation likely reflects the nature of the mutation that results in a severely truncated protein. Finally, we advocate early gonadectomy in XY CLAH cases given the early neoplastic potential we observed.
|
Footnotes |
|---|
Disclosure Information: All authors have nothing to declare.
First Published Online July 31, 2007
1 M.A.-A. and A.J. contributed equally to this study. 
Abbreviations: CIS, Carcinoma in situ; CLAH, congenital lipoid adrenal hyperplasia; MRI, magnetic resonance imaging; OCT, octamer binding transcription factor; PLAP, placental alkaline phosphatase; SNP, single-nucleotide polymorphism; StAR, steroidogenic acute regulatory protein.
Received June 13, 2007.
Accepted July 19, 2007.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
nlichen scheinzwitter. Z Allg Pathol Anat 97:346–357
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
