help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2007-0284
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vallette-Kasic, S.
Right arrow Articles by Drouin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vallette-Kasic, S.
Right arrow Articles by Drouin, J.
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 92, No. 10 3991-3999
Copyright © 2007 by The Endocrine Society

The TPIT Gene Mutation M86R Associated with Isolated Adrenocorticotropin Deficiency Interferes with Protein: Protein Interactions

Sophie Vallette-Kasic, Catherine Couture, Aurelio Balsalobre, Yves Gauthier, Louise Metherell, Mehul Dattani and Jacques Drouin

Laboratoire de Génétique Moléculaire (S.V.-K., C.C., A.B., Y.G., J.D.), Institut de Recherches Cliniques de Montréal, Montréal, QC, Canada H2W 1R7; Molecular Endocrinology (L.M.), William Harvey Research Institute, London EC1M 6BQ, United Kingdom; and Developmental Endocrinology Research Group (M.D.), Clinical and Molecular Genetics Unit, Institute of Child Health London, University College London, London, WC1N 1EH, United Kingdom

Address all correspondence and requests for reprints to: Dr. Jacques Drouin, Laboratoire de génétique moléculaire, Institut de recherches cliniques de Montréal, 110, avenue des Pins Ouest, Montréal, QC, Canada H2W 1R7. E-mail: jacques.drouin{at}ircm.qc.ca.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Context: Tpit is a T-box transcription factor important for terminal differentiation of pituitary proopiomelanocortin-expressing cells. We previously showed that human and murine mutations in the gene encoding this highly cortico/melanotrope-specific transcription factor cause a neonatal onset form of congenital isolated ACTH deficiency (IAD). We characterized the largest series of neonatal IAD patients caused by TPIT mutations, and this revealed a highly homogeneous clinical presentation. So far, 12 different loss-of-function TPIT mutations have been identified. The methionine 86 arginine (M86R) TPIT mutation was recently identified in compound heterozygosity with the 782delA frame-shift mutation in two siblings with early-onset IAD.

Objective: We conducted a functional analysis of the missense M86R mutation to assess transcriptional activity, DNA binding activity, and nuclear location, as well as protein-protein interactions.

Results: Although the M86 residue is located within the T-box DNA-binding domain, it did not affect monomer DNA-binding activity per se, but it impaired DNA binding with other DNA-bound proteins, including itself (homodimers) and pituitary homeobox 1 (Pitx1). The M86 residue is at the interface between T domains in the T dimers crystal structure, and it appears that the same residue is involved in heterodimer formation with pituitary Pitx1. Furthermore, TPIT M86R is deficient in the recruitment of the coactivator SRC2 that partly mediates the CRH stimulation of proopiomelanocortin transcription.

Conclusion: Thus, the M86R TPIT mutation is defining an important surface of the T domain for multiple protein interactions and for transcription.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
DURING PITUITARY ontogenesis, corticotropes are the first hormone-producing cells to reach terminal differentiation (1). The corticotropes appear at embryonic d 12.5 in mice, and the molecular mechanisms that regulate their differentiation require ubiquitous, as well as pituitary and corticotrope-specific transcription factors. One of the early regulators of pituitary development, the transcription factor pituitary homeobox 1 (Pitx1), was cloned in our laboratory a decade ago for its involvement in cell-specific transcription of proopiomelanocortin (POMC) (2). The paired-like transcription factors Pitx1/2 are expressed early in Rathke’s pouch (3) and are still present in all adult pituitary cells (4). Pitx1–/– mice exhibit no marked pituitary phenotype (4, 5) because of redundancy with Pitx2 (6); indeed, double mutant mice have pituitary development blocked at the rudimentary Rathke’s pouch stage. Pitx1/2 activate transcription of many pituitary-specific genes, including POMC, {alpha}-glycoprotein hormone subunit gene, LHß, FSHß, GnRH-receptor, TSHß, PRL, and GH (7, 8, 9, 10), in each case acting in synergism with cell-restricted transcription factors.

Whereas Pitx1 marks the oral ectoderm of the pituitary and is expressed in all pituitary cells, the T-box transcription factor Tpit was first identified as a transcriptional partner of Pitx1 for the tissue-specific activation of POMC transcription (11). Tpit is restricted to the pituitary POMC-expressing lineages, corticotropes and melanotropes, and to normal and adenomatous corticotropes in humans (12). Tpit is expressed a few hours before POMC and is essential for terminal differentiation of POMC-expressing cells (13). In the POMC promoter, Tpit binds to a T element located 5 bp away from the Pitx1 binding site (11). Interactions between Tpit and Pitx1 and between Tpit and the basic helix-loop-helix (bHLH) transcription factor NeuroD1/ß2 (14) are required for POMC gene transcription.

NeuroD1 is expressed during pituitary development between embryonic d 12 and 16, and is also present in pancreas, intestine, and various parts of the nervous system. NeuroD1 heterodimerizes with ubiquitous bHLH, such as E12 (Pan1), and these heterodimers bind to a specific E-box, E-boxneuro, within the POMC promoter to activate transcription (15). This transcriptional effect is enhanced synergistically by physical and functional interaction with Pitx1 (16).

The effects of CRH signaling in corticotrope cells are mediated through recruitment of the coactivator SRC2 and through the protein kinase A (PKA) signaling pathway (17). The SRC/p160 coactivators were first cloned as transcriptional partners for nuclear receptors, but they also function with other transcription factors, such as the bHLH factor myogenin. They enhance the activity of transcription factors in part because of their intrinsic histone acetyltransferase activity and by recruitment of other transcriptional regulators. We have previously shown that Tpit recruits SRC coactivators, resulting in enhancement of Tpit-dependent transcription of the POMC gene (18).

Because Tpit is restricted to POMC-expressing cells, we expected and found that Tpit mutations only affect pituitary POMC production. Indeed, human and murine Tpit mutations cause a neonatal onset form of congenital isolated ACTH deficiency (IAD) (19, 20). We previously described the largest series of neonatal IAD, and showed that this rare inherited disease is clinically homogeneous and is caused by TPIT coding mutations in about 65% of cases (20). Neonatal hypoglycemia was found in all patients, with prolonged neonatal cholestatic jaundice in half of them. For all patients, ACTH and cortisol levels were very low or undetectable at baseline and after CRH stimulation tests. In the absence of glucocorticoid replacement, IAD may lead to neonatal death by acute adrenal insufficiency. IAD patients usually have TPIT mutations in each allele of this gene, and their unaffected parents are all heterozygous carriers, showing a recessive mode of transmission of this disease.

So far, 12 different TPIT mutations that cause loss of function have been identified (Fig. 1Go) (11, 19, 20, 21, 22). These mutations include three nonsense mutations and three deletions within the TPIT gene, one splice-site mutation and five missense mutations. Nonsense mutations and deletions within the TPIT gene are thought to lead to loss of function because of nonsense mRNA degradation caused by the insertion of a stop codon in the penultimate or an earlier exon of the gene (24). We performed functional analyses of four TPIT missense mutations and revealed a defect in transcriptional activation resulting from loss of DNA-binding activity, confirming that Tpit DNA binding is essential for POMC gene transcription (19, 20).


Figure 1
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 1. TPIT gene mutations identified in early-onset IAD. A, Summary of different TPIT mutations found in cases of early-onset IAD. B, Sequence alignment of the TPIT M86R. The M86 amino acid is highly conserved in Tpit from several species. C, Alignment of the T-box domain showed that M86 is not conserved in several mouse T-box proteins. This residue is only conserved in the mouse Brachyury (or T) T box. D, The position of TPIT M86 residue modeled onto the crystal structure of the Brachyury T box (23 ). The M86 amino acid is located in the T-box domain at the dimerization interface.

 
The most recently identified TPIT mutation, methionine 86 arginine (M86R), seemed to be more interesting, possibly acting by a different mechanism compared with other mutations. The M86R mutation was recently found in two siblings with early-onset IAD. Both patients had very low ACTH and cortisol levels, normal levels of other pituitary hormones, and no structural pituitary defects (21). They were compound heterozygotes for the missense mutation M86R in exon 2 and a frame-shift mutation in exon 6 (782delA). Their unaffected mother was heterozygous for the M86R mutation, and their healthy father was heterozygous for 782delA.

In the present manuscript, we performed functional analysis of the M86R mutant protein and demonstrated that although the M86R (residue 84 in mouse Tpit) is located within the T-box DNA-binding domain of Tpit, it did not affect DNA binding activity per se (as a monomer), but it prevented interactions with DNA-bound proteins, including with itself (homodimerization) and with Pitx1 (heterodimerization). Thus, the M86R mutation leads to decreased recruitment to the POMC promoter and to the loss of SRC2 coactivator action. This new TPIT mutation provides unique insight into the mechanism of action of Tpit and on its interactions with protein partners for execution of the corticotrope-specific program of gene expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture, transfection, and plasmids

CV-1, COS1, and GH3 cells were cultured in DMEM supplemented with 10% fetal calf serum and antibiotics, and maintained at 37 C in 5% CO2. CV-1 and COS1 cells were plated in 12-well dishes at a density of 50,000 cells per well the evening before transfection and then transfected by the calcium phosphate coprecipitation method, as described (18). Each sample contained a total of 1.5 µg DNA, including 500 ng reporter plasmid, 125 ng RSV-Tpit or RSV-Tpit M86R, 250 ng RSV-PKA, and/or CMV-SRC-2 when indicated or the empty corresponding vectors in other cases, and pSP64 to make up the total amount. GH3 cells were plated in 12-well dishes at a density of 250,000 cells per well the evening before transfection and then transfected by the Lipofectamine (Invitrogen Corp., Carlsbad, CA) method. Each sample contained a total of 750 ng DNA, including 500 ng reporter plasmid, 0–100 ng effector plasmid (RSV-Tpit or RSV-Tpit M86R) when indicated or the empty corresponding vectors in other cases, and pSP64 to make up the total amount. Cells were harvested 48 h later. Tpit reporter and expression plasmids have previously been described (11). The Tpit M86R mutation was inserted into the mouse Tpit coding sequences and generated using the QuickChange mutagenesis kit (Stratagene, La Jolla, CA). Results are presented as the means ± SEM of three independent experiments performed in duplicates. Transfection experiments in CV-1 cells to show Tpit/M86R-Pitx1 synergism and in GH3 cells to show Tpit/M86R-bHLH synergism were performed as previously described (11, 14).

Gel retardation assays and Western blotting

Band shift assays were performed as previously described (11, 19). Band shift assays using the palindromic T-box binding consensus site (GATCCAATTTCACACCTAGGTGTGA AATT) were performed with 5 µl in vitro translated protein lysates (wheat germ extract; Promega Corp., Madison, WI). Band shift assays using the Tpit-Pitx1 binding site (GATCCTGCCTCACACCA GGATGCTAAGCCTCTG) were performed with maltose binding protein (MBP)-Tpit and MBP-M86R produced and purified according to the manufacturer’s protocol (New England Biolabs Ltd., Pickering, Ontario, Canada). Binding reactions were performed as described by Lamolet et al. (11). For supershift experiments, rabbit anti-Tpit and anti-Pitx1 antibodies were added to the mix during the last 20 min of the incubation. Western blots were performed as described (7) with rabbit anti-Tpit 1:1000 (11).

Coimmunoprecipitation experiments

A total of 293 cells (10-cm plates) were transfected with 10 µg total DNA, and cell extracts were prepared 24 h later. For coimmunoprecipitation, we used 1 mg cell extracts in 250 µl binding buffer [20 mM HEPES (pH 7.9), 150 mM KCl, 5% glycerol, 1.5 mM MgCl2]. Coimmunoprecipitation assays were performed using anti-FLAG affinity beads (Sigma A2220; Sigma-Aldrich, St. Louis, MO). Forty microliters of anti-FLAG beads (washed twice with 0.5 ml Tris-buffered saline) were added, and immunoprecipitation was performed at 4 C for 2 h in a roller shaker. Immunoprecipitates were washed thrice in 10 volumes of washing buffer (150 mM KCl, 0.05% NP-40, 10% glycerol, 20 mM HEPES, and 0.2 mM EDTA) and eluted in Laemmli buffer with 2.5% ß-mercaptoethanol. The samples were then subjected to SDS-PAGE and Western blot analysis with the rabbit anti-Tpit antibody (1:1000).

Chromatin immunoprecipitation (ChIP)

To analyze POMC promoter recruitment of Tpit compared with M86R Tpit, we produced pools of AtT-20 cells stably transfected with expression vectors for Tpit-Flag or M86R Tpit-Flag using the EcoPack2 packaging cell line (Clontech Laboratories, Inc., Mountain View, CA) according to the manufacturer’s procedures. The pLNCX2 expression vector was used for this purpose. This led to expression levels for Flagged proteins that are similar to endogenous Tpit. ChIP was performed as described (25) using either Tpit (11) or Flag antibodies (Sigma M2; Sigma-Aldrich).

Pull-down assays

All MBP proteins were produced, 35S-labeled proteins were synthesized, and binding reactions were performed as described (18).

Immunofluorescence

CV-1 cells were plated in 12-well dishes with coverslips at a density of 50,000 cells per well the evening before transfection and transiently transfected with 500 ng DNA (empty expression vector RSV, or RSV-Tpit, or RSV-M86R) using the Lipofectamine (Invitrogen) method. After 48 h, coverslips were incubated overnight with rabbit anti-Tpit (1:200), and antirabbit-biotinylated (1:200; Vector Laboratories, Burlingame, CA) was added next and, finally, avidin-fluorescein (1:200; Vector Laboratories). Coverslips were placed in blocking solution (Tris-buffered saline 0.2% Tween 20) between each step.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
The TPIT mutation M86R was identified in a family with neonatal onset IAD (21); this mutation is within the T-box coding region of the TPIT gene (Fig. 1AGo). The M86R is conserved in all sequenced Tpit genes (Fig. 1BGo), but a methionine is found at this position only in Tpit and Brachyury (T), and not in other T boxes (Fig. 1CGo). It is noteworthy that Tpit and T are the only two T-box factors tested that exhibit transcriptional synergism with the Pitx factors (11). When the M86R of the T domain is modeled on the crystal structure of T dimers (23), it appears that this residue sits within the interface between two T monomers (Fig. 1DGo). Therefore, we hypothesized that changes in this residue may interfere with Tpit dimerization.

The Tpit M86R mutant protein does not bind DNA as dimer and has reduced transcriptional activity

In view of the localization of the M86R within the dimerization interface of T (Fig. 1DGo), it was reasonable to test whether mutagenesis of this residue may interfere with DNA binding. For this purpose, expression vectors were constructed for wild-type Tpit and the M86R mutant, and both were shown by Western blot to be expressed at similar levels (Fig. 2AGo). The ability of Tpit M86R to bind DNA was assessed using a palindromic DNA probe that has the ability to bind T and Tpit as either monomer or dimer (19). Interestingly, the mutant M86R has a similar ability as wild-type Tpit to form monomer complexes with this probe but is completely unable to bind as a dimer (Fig. 2AGo). This finding is consistent with the position of M86 at the dimerization interface; the introduction of an arginine residue at such a position would likely cause repulsion between Tpit moieties. It is noteworthy that monomer binding of M86R Tpit is intact, clearly indicative that the intrinsic DNA binding ability of the mutant protein is not affected by the mutation.


Figure 2
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 2. The TPIT M86R mutant protein is unable to form dimers on DNA. A, The DNA-binding ability of TPIT M86R was assessed by gel retardation using in vitro translated proteins and a T-box palindromic consensus binding site. Synthesis of mutant and wild-type proteins was assessed by Western blot ({alpha}-Tpit, top of each panel) showing slightly less mutant than wild-type protein. The M86R TPIT mutant is still able to bind DNA as monomer but cannot form dimers. Tpit monomers and dimers are both supershifted in the presence of Tpit antibody ({alpha}-Tpit). B, Like Tpit, the TPIT M86R mutant protein is located to the nucleus, as shown by immunofluorescence. CV1 cells were transfected with 500 ng DNA [empty expression vector (EV), RSV-Tpit or RSV-M86R] using the Lipofectamine (Invitrogen) method. For immunofluorescence, rabbit anti-Tpit (1:200), biotinylated antirabbit IgG (1:200; Vector Laboratories) and avidin-fluorescein (1:200; Vector Laboratories) were used. C, The M86R mutation retained 30% transcriptional activity when assayed by transient transfection (25–100 ng expression vectors) into GH3 cells using a palindromic T-box consensus reporter plasmid. Data are presented as mean ± SEM of five experiments, each performed in duplicate.

 
To assess the effect of this mutation on transcriptional ability, expression vectors for the Tpit M86R protein were transfected into cultured cells. At the onset, the ability of this mutant protein to be localized in the nucleus was assessed by immunofluorescence and found to be similar to the wild-type protein (Fig. 2BGo). In agreement with the inability of Tpit M86R to form dimers on a palindromic T-box binding site (Fig. 2AGo), it was found that Tpit M86R has reduced transcriptional activity compared with wild-type Tpit when assessed by cotransfection with a luciferase reporter containing a copy of the palindromic consensus T-response element (Fig. 2CGo). The decrease in transcriptional activity is approximately 70%.

Impaired synergism of Tpit M86R with Pitx1

The position of the M86R at the T-box dimerization interface might also result in impaired interaction with other interaction partners of Tpit. The best-known dimerization partner of Tpit is Pitx1 that was shown to be an obligate partner of Tpit for activation of the POMC gene (11). The easiest system to assess the activity of Tpit in the presence of Pitx1 is by the use of cotransfection in pituitary GH3 cells that express high levels of endogenous Pitx1. Using this cell line and a luciferase reporter containing three copies of the Tpit-Pitx response element (Tpit-PitxRE) from the POMC gene, we found that Tpit M86R has considerably reduced (>90%) transcriptional activity compared with wild-type Tpit (Fig. 3AGo). To show that this reduced activity is indeed dependent on Pitx1, a reconstituted system was developed in CV1 cells that do not express Pitx1. Using these cells, Pitx1 was found to have little transcriptional activity on its own, whereas Tpit has weak activity and Tpit M86R no significant activity (Fig. 3BGo). The addition of Pitx1 to wild-type Tpit results in marked transcriptional synergism, whereas Tpit M86R exhibited only limited activity with Pitx1. The data suggest that the inability of Tpit M86R to interact with Pitx1 is reduced because of the mutant residue.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 3. The M86R TPIT mutant has very weak transcriptional activity with Pitx1 and is deficient in cooperative DNA binding with Pitx1 but is still recruited to the POMC promoter. A, The M86R mutation was almost devoid of transcriptional activity when assayed by transient transfections into GH3 cells (that express Pitx1) using a Tpit-Pitx1 binding site reporter plasmid. Data presented as mean ± SEM of five experiments, each performed in duplicate. B, The M86R mutation was unable to synergize efficiently with Pitx1 when assayed by transient cotransfections into CV-1 cells (that do not express Pitx1) using a Tpit-Pitx1 binding site reporter plasmid. Data presented as mean ± SEM of five experiments, each performed in duplicate. C, The DNA-binding ability of the M86R mutant protein was assessed using the Tpit-Pitx1 binding site of the POMC promoter. Tpit and Pitx1 formed a tri-molecular complex with the probe (lane 6), whereas M86R was not able to form a similar complex (lane 9). This complex was blocked or supershifted in the presence of antibodies directed against Tpit (lane 7) or Pitx1 (lane 8). D, ChIP assessment of Tpit-Flag and M86R-Flag recruitment to the POMC promoter in AtT-20 cells stably expressing these proteins. Western blot analyses with Tpit antibodies showed similar protein expression levels for Flag and endogenous Tpit. ChIP was performed with Flag antibody to measure chimeric protein recruitment to the POMC promoter, relative to background recruitment to the MyoD promoter. As control, ChIP was also performed with the Tpit antibody. The data represent the means ± SEM of four experiments. WT, wild-type.

 
Deficient Tpit M86R cooperative binding with Pitx1 on Tpit-PitxRE

To test the respective abilities of Tpit and M86R to interact physically with Pitx1 and with DNA, we used a gel retardation assay that was previously shown to exhibit cooperative interaction of Tpit with Pitx1 (11). Using this system (Fig. 3CGo), the cooperative formation of protein complexes containing both Pitx1 and Tpit could be reproduced (Fig. 3CGo, lane 6), but Tpit M86R was found to be unable to form such complexes (Fig. 3CGo, lane 9). In fact, whereas binding of Tpit with the Tpit-PitxRE probe could be observed (Fig. 3CGo, lane 2) and supershifted with anti-Tpit antibody (Fig. 3CGo, lane 3), weaker binding of Tpit M86R was observed (Fig. 3CGo, lane 4). Thus, it is possible that the intrinsic affinity of Tpit M86R for DNA is lower than wild-type Tpit. The ability of this mutant protein to interact with Pitx1 on DNA is also severely curtailed.

Reduced POMC promoter recruitment of Tpit M86R

We assessed directly the ability of Tpit M86R to be recruited to the POMC promoter using the ChIP method. AtT-20 cells were engineered to express stably either Tpit-Flag or Tpit-M86R-Flag at levels that are comparable to those of endogenous Tpit as assessed by Western blot (Fig. 3DGo). In ChIP experiments with a Flag antibody, TpitM86R-Flag was recruited to the POMC promoter with 25% efficiency compared with Tpit-Flag. Total Tpit recruitment to the promoter was similar in both pools of cells. Although these data indicate decreased promoter recruitment in agreement with the loss of DNA binding activity in the presence of Pitx1, they also reveal significant residual binding (25%), suggesting that protein interactions other than with Pitx1 may be perturbed to account for the marked decrease in activity (Fig. 3AGo) produced by the mutation.

Conserved synergism of Tpit M86R with bHLH factors

To assess whether other protein interactions of Tpit are also impaired because of the M86R mutation, we assessed the synergism exerted by NeuroD1/E12 heterodimers with Tpit (14) and M86R in GH3 cells (Fig. 4Go). In this system (Fig. 4AGo), bHLH heterodimers have very weak activity when transfected alone, and Tpit on its own has much greater activity than M86R as shown previously (Fig. 3AGo). Interestingly, the ability of bHLH heterodimers (NeuroD1/E12) to enhance this activity is maintained and even greater for the mutant (8-fold) compared with wild-type Tpit (2.5-fold). We also performed coimmunoprecipitation experiments using epitope-tagged NeuroD1 and showed a similar interaction between Tpit and M86R with NeuroD1 (Fig. 4BGo). Thus, it appears that the M86R mutation does not impair the ability of Tpit to exhibit transcriptional synergism with bHLH heterodimers.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 4. The M86R TPIT mutant protein is still able to synergize with bHLH heterodimers. A, The M86R mutation has weak basal transcriptional activity when assayed by transient transfections into GH3 cells using a Tpit-Pitx-NeuroD1 binding site reporter plasmid (empty bars) but is still able to synergize with increasing amounts (25–250 ng expression plasmids) of bHLH factors [NeuroD1/E12 (Pan1) 1:1], as observed with wild-type Tpit (gray bars). Data presented as mean ± SEM of five experiments, each performed in duplicate. B, M86R Tpit exhibits a similar direct interaction with NeuroD1 than Tpit wild type. 293 cells were transfected with NeuroD1-(Flag)3 and RSV-Tpit or RSV-M86R. The cell extracts were incubated with anti-Flag beads (Sigma-Aldrich). Immunoprecipitated complexes were subjected to SDS-PAGE and revealed using a rabbit anti-Tpit antibody (1:1000). IP, immunoprecipitate; WB, Western blot.

 
Impaired CRH signaling in presence of Tpit M86R

We have previously shown that Tpit mediates in part the stimulatory effect of CRH-induced signaling in corticotrope cells, such as in AtT-20 cells (18). The effects of CRH signaling on Tpit-dependent transcription are mediated through the PKA signaling pathway and the recruitment of the coactivator SRC2. Thus, we assessed the ability of Tpit M86R to be activated by SRC2 (TIF2). Overexpression of SRC2 led to a significant enhancement of Tpit-dependent transcription, as assessed with a luciferase reporter containing the Tpit-PitxRE cotransfected in COS1 cells (Fig. 5AGo), but M86R completely lost this enhancement even though it has weak transcriptional activity. The impact of PKA signaling on Tpit and M86R was tested by expression of a constitutively active form of PKA (18); the synergism exerted by SRC2 and PKA signaling was not observed with the M86R mutant compared with wild-type Tpit (Fig. 5AGo). In agreement with these results, we observed by coimmunoprecipitation (Fig. 5BGo) and pull-down (Fig. 5CGo, lane 9 compared with lane 6) experiments that the direct interaction between Tpit M86R and SRC2 is greatly reduced compared with wild-type Tpit. It is noteworthy that the pull-down assay (Fig. 5CGo) for in vitro protein interactions did not reveal the decreased interactions of Tpit M86R with itself (Fig. 5CGo, lane 7 compared with lane 4) or with Pitx1 (Fig. 5CGo, lane 8 compared with lane 5) that were observed in DNA interactions (Figs. 2AGo and 3CGo, respectively); this likely reflects the greater permissiveness of this solution assay performed with relatively high protein concentrations. Thus, these data clearly indicate that the Tpit M86R mutant is unable to recruit SRC2 and is deficient in responsiveness to PKA/CRH signaling.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 5. Deficient SRC2 enhancement of Tpit activity in the presence of the M86R mutation. A, M86R Tpit had about 50% basal transcriptional activity compared with Tpit, both in th absence and presence of constitutively active PKA. The coactivator SRC2 enhanced Tpit activity but did not enhance M86R activity. COS1 cells were transfected with 125 ng RSV-Tpit or RSV-Tpit M86R, and/or 250 ng CMV-SRC-2. Data are presented as mean ± SEM of five experiments, each performed in duplicate. B, Direct interaction between M86R and SRC2 is greatly reduced compared with Tpit wild type. 293 cells were transfected with SRC2-(Flag)3 and RSV-Tpit or RSV-M86R. The cell extracts were incubated with anti-Flag beads (Sigma-Aldrich). Immunoprecipitated complexes were subjected to SDS-PAGE and revealed using a rabbit anti-Tpit antibody (1:1000). C, In pull-down assays, physical interaction between M86R and SRC2 (lane 9) is reduced compared with Tpit wild type (lane 6), but direct interactions of M86R with itself (lane 7) and with Pitx1 (lane 8) are conserved in the same conditions. Radiolabeled in vitro translated Tpit or M86R, Pitx1 and SRC2 were tested for interaction with a MBP-Tpit or MBP-M86R fusion proteins or MBP as a negative control (Ctl). IP, Immunoprecipitate; WB, Western blot.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present work investigated the mechanism of action of a TPIT mutation that causes IAD. We showed that the M86R mutation in Tpit is associated with decreased transcriptional activity in the context of the POMC promoter Tpit-PitxRE (Fig. 3AGo), in agreement with its implication in the IAD phenotype observed in patients. The M86R TPIT mutation is interesting because this residue is part of a dimerization interface identified for homodimers of Brachyury (T). This dimerization interface (Fig. 1DGo) defined by x-ray structure (23) appears valid to model Tpit because the M86R mutant protein is unable to bind a palindromic T-box element as a dimer, whereas it still retains complete DNA binding ability as a monomer. This suggests that the mutant residue does not impair the overall structure of the DNA binding T domain but rather has a discrete effect on the dimerization interface suggested by its position in the dimer crystal structure (Fig. 1DGo). In agreement with this decreased dimer formation, Tpit M86R still retains about a third of the activity of wild-type Tpit when assessed for transcriptional ability using a reporter driven by a palindromic T-box response element (Fig. 2CGo).

In contrast, the effect of the same mutation is far more dramatic when assessed using a reporter driven by the Tpit-PitxRE of the POMC gene (Fig. 3AGo). In this case, the loss of transcriptional activity is greater than 90%. This suggests that the ability of Tpit to interact with Pitx1 is severely curtailed by the presence of the M86R mutation, and this was indeed found to be the case in gel retardation experiments (Fig. 3CGo). However, all Tpit protein interactions are not similarly impaired because the ability for transcriptional synergism of the bHLH heterodimers containing NeuroD1 and E12 was similar for M86R compared with wild-type Tpit, despite the significant loss of basal activity of the mutant protein (Fig. 4Go). These results suggest that the interactions between the bHLH factors and Tpit rely on a different protein interface compared with the Tpit/Pitx interaction.

Whereas the DNA-binding ability of Tpit M86R as a monomer is intact when assessed with a consensus T box (Fig. 2AGo), it appeared that monomer binding of Tpit M86R to the Tpit-PitxRE of POMC is weaker than for wild-type Tpit (Fig. 3CGo, compare lane 4 with lane 2). The POMC T-box binding site is slightly divergent compared with a consensus T-box response element, and the binding of Tpit to the POMC Tpit-PitxRE needs higher amounts of MBP-Tpit than for its binding to the palindromic consensus T-box response element (Figs. 2AGo and 3CGo). It is possible that this lower affinity is accentuated by the Tpit M86R mutation because of a slightly perturbed T-box DNA binding domain. Be that as it may, it is clear that the M86R mutation prevents the cooperative binding with Pitx1 (Fig. 3CGo, lane 6). However, the loss of Pitx1 interaction and the resulting loss of in vitro DNA binding ability are somewhat at odds with residual 25% POMC promoter recruitment of TpitM86R (Fig. 3DGo). Another effect of the mutation appeared necessary to account for the loss of transcriptional activity (Fig. 3AGo). Indeed, Tpit M86R has also lost the ability to recruit the coactivator SRC2 (Fig. 5Go). We previously showed that SRC2 coactivator physically interacts with Tpit and enhances Tpit-dependent but not Pitx1-dependent transcription of the POMC gene (17). Because Tpit M86R still retains significant activity with the palindromic consensus T-box response element, the loss of interaction with Pitx1 in the context of the POMC promoter and the loss of SRC2 and PKA responsiveness likely represent two different mechanisms explaining the loss of function of this mutant protein.

In summary, the present work suggests that critical features of Tpit action are lost by the introduction of the M86R amino acid replacement, namely the critical ability of Tpit for protein interactions with Pitx1 and/or SRC2.


   Acknowledgments
 
We thank Lise Laroche for her expert and efficient secretarial assistance.


   Footnotes
 
This work was supported by grants from the National Cancer Institute of Canada and the Canadian Institutes of Health Research.

Disclosure Statement: The authors have nothing to disclose.

First Published Online July 24, 2007

Abbreviations: bHLH, Basic helix-loop-helix; ChIP, chromatin immunoprecipitation; IAD, isolated ACTH deficiency; MBP, maltose binding protein; M86R, methionine 86 arginine; Pitx1, pituitary homeobox 1; PKA, protein kinase A; POMC, proopiomelanocortin; Tpit-PitxRE, Tpit-Pitx response element.

Received February 7, 2007.

Accepted July 16, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Japon MA, Rubinstein M, Low MJ 1994 In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J Histochem Cytochem 42:1117–1125[Abstract]
  2. Lamonerie T, Tremblay JJ, Lanctôt C, Therrien M, Gauthier Y, Drouin J 1996 Ptx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opiomelanocortin gene. Genes Dev 10:1284–1295[Abstract/Free Full Text]
  3. Lanctôt C, Lamolet B, Drouin J 1997 The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development 124:2807–2817[Abstract]
  4. Lanctôt C, Gauthier Y, Drouin J 1999 Pituitary homeobox 1 (Ptx1) is differentially expressed during pituitary development. Endocrinology 140:1416–1422[Abstract/Free Full Text]
  5. Szeto DP, Rodriguez-Esteban C, Ryan AK, O’Connell SM, Liu F, Kioussi C, Gleiberman AS, Izpisua-Belmonte JC, Rosenfeld MG 1999 Role of the Bicoid-related homeodomain factor Pitx1 in specifying hindlimb morphogenesis and pituitary development. Genes Dev 13:484–494[Abstract/Free Full Text]
  6. Charles MA, Suh H, Drouin J, Camper SA, Gage PJ 2005 PITX genes are required for cell survival and Lhx3 activation. Mol Endocrinol 19:1893–1903[Abstract/Free Full Text]
  7. Tremblay JJ, Lanctôt C, Drouin J 1998 The pan-pituitary activator of transcription, Ptx1 (pituitary homeobox 1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol Endocrinol 12:428–441[Abstract/Free Full Text]
  8. Tremblay JJ, Marcil A, Gauthier Y, Drouin J 1999 Ptx1 regulates SF-1 activity by an interaction that mimics the role of the ligand-binding domain. EMBO J 18:3431–3441[CrossRef][Medline]
  9. Tremblay JJ, Drouin J 1999 Egr-1 is a downstream effector of GnRH and synergizes by direct interaction with Ptx1 and SF-1 to enhance luteinizing hormone ß gene transcription. Mol Cell Biol 19:2567–2576[Abstract/Free Full Text]
  10. Tremblay JJ, Goodyer CG, Drouin J 2000 Transcriptional properties of Ptx1 and Ptx2 isoforms. Neuroendocrinology 71:277–286[CrossRef][Medline]
  11. Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T-box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849–859[CrossRef][Medline]
  12. Vallette-Kasic S, Figarella-Branger D, Grino M, Pulichino AM, Dufour H, Grisoli F, Enjalbert A, Drouin J, Brue T 2003 Differential regulation of proopiomelanocortin and pituitary-restricted transcription factor (TPIT), a new marker of normal and adenomatous human corticotrophs. J Clin Endocrinol Metab 88:3050–3056[Abstract/Free Full Text]
  13. Pulichino AM, Vallette-Kasic S, Tsai JPY, Couture C, Gauthier Y, Drouin J 2003 Tpit determines alternate fates during pituitary cell differentiation. Genes Dev 17:738–747[Abstract/Free Full Text]
  14. Lamolet B, Poulin G, Chu K, Guillemot F, Tsai MJ, Drouin J 2004 Tpit-independent function of NeuroD1(ß2) in pituitary corticotroph differentiation. Mol Endocrinol 18:995–1003[Abstract/Free Full Text]
  15. Poulin G, Turgeon B, Drouin J 1997 NeuroD1/BETA2 contributes to cell-specific transcription of the POMC gene. Mol Cell Biol 17:6673–6682[Abstract]
  16. Poulin G, Lebel M, Chamberland M, Paradis FW, Drouin J 2000 Specific protein:protein interaction between basic helix-loop-helix transcription factors and homeoproteins of the Pitx family. Mol Cell Biol 20:4826–4837[Abstract/Free Full Text]
  17. Maira MH, Martens C, Batsche E, Gauthier Y, Drouin J 2003 Dimer-specific potentiation of NGFI-B (Nur77) transcriptional activity by the protein kinase A pathway and AF-1-dependent coactivator recruitment. Mol Cell Biol 23:763–776[Abstract/Free Full Text]
  18. Maira MH, Couture C, Le Martelot G, Pulichino AM, Bilodeau S, Drouin J 2003 The T-box factor Tpit recruits SRC/p160 coactivators and mediates hormone action. J Biol Chem 278:46523–46532[Abstract/Free Full Text]
  19. Pulichino AM, Vallette-Kasic S, Couture C, Gauthier Y, Brue T, David M, Malpuech G, Deal C, Van Vliet G, De Vroede M, Riepe FG, Partsch CJ, Sippell WG, Berberoglu M, Atasay B, Drouin J 2003 Human and mouse Tpit gene mutations cause early onset pituitary ACTH deficiency. Genes Dev 17:711–716[Abstract/Free Full Text]
  20. Vallette-Kasic S, Brue T, Pulichino AM, Gueydan M, Barlier A, David M, Nicolino M, Malpuech G, Déchelotte P, Deal C, Van Vliet G, De Vroede M, Riepe FG, Partsch CJ, Sippell WG, Berberoglu M, Atasay B, de Zegher F, Beckers D, Kyllo J, Donohoue P, Fassnacht M, Hahner S, Allolio B, Noordam C, Dunkel L, Hero M, Pigeon B, Weill J, Yigit S, Brauner R, Heinrich JJ, Cummings E, Riddell C, Enjalbert A, Drouin J 2005 Congenital isolated adrenocorticotropin deficiency: an underestimated cause of neonatal death, explained by TPIT gene mutations. J Clin Endocrinol Metab 90:1323–1331[Abstract/Free Full Text]
  21. Metherell LA, Savage MO, Dattani M, Walker J, Clayton PE, Farooqi IS, Clark AJ 2004 TPIT mutations are associated with early-onset, but not late-onset isolated ACTH deficiency. Eur J Endocrinol 151:463–465[Abstract]
  22. Weintrob N, Drouin J, Vallette-Kasic S, Taub E, Marom D, Lebenthal Y, Klinger G, Bron-Harlev E, Shohat M 2005 Low estriol levels in the maternal triple-marker screen as a predictor of isolated ACTH deficiency caused by a new mutation in the TPIT gene. Pediatrics 117:e322–e327
  23. Muller CW, Herrmann BG 1997 Crystallographic structure of the T domain-DNA complex of the Brachyury transcription factor. Nature 389:884–888[CrossRef][Medline]
  24. Frischmeyer PA, Dietz HC 1999 Nonsense-mediated mRNA decay in health and disease. Hum Mol Genet 8:1893–1900[Abstract/Free Full Text]
  25. Bilodeau S, Vallette-Kasic S, Gauthier Y, Figarella-Branger D, Brue T, Berthelet F, Lacroix A, Batista D, Stratakis S, Hanson J, Meij B, Drouin J 2006 Role of Brg1 and HDAC2 in GR trans-repression of pituitary POMC gene and misexpression in Cushing disease. Genes Dev 20:2871–2886[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Genes Dev.Home page
S. A. Miller, A. C. Huang, M. M. Miazgowicz, M. M. Brassil, and A. S. Weinmann
Coordinated but physically separable interaction with H3K27-demethylase and H3K4-methyltransferase activities are required for T-box protein-mediated activation of developmental gene expression
Genes & Dev., November 1, 2008; 22(21): 2980 - 2993.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
P.-L. Lavoie, L. Budry, A. Balsalobre, and J. Drouin
Developmental Dependence on NurRE and EboxNeuro for Expression of Pituitary Proopiomelanocortin
Mol. Endocrinol., July 1, 2008; 22(7): 1647 - 1657.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vallette-Kasic, S.
Right arrow Articles by Drouin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vallette-Kasic, S.
Right arrow Articles by Drouin, J.
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals