| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Hydroxylase Deficiency Diagnosed through High-Performance Liquid Chromatography Serum Adrenal Profile: Identification of Two Novel CYP17 Mutations
Maimonides Infants and Childrens Hospital of Brooklyn (J.-Q.W.), Brooklyn, New York 11219; and Shandong Genetic Endocrinology Research Group (J.-L.W., J.-Q.W., W.-C.L., Y.-S.B., F.-C.W.), Qilu Hospital, Shandong University, Jinan, Shandong 250012, Peoples Republic of China
Address all correspondence and requests for reprints to: Ji-Qing Wei, Department of Pediatrics, Maimonides Medical Center, 4802 Tenth Avenue, Brooklyn, New York 11219. E-mail: wei_jiqing{at}yahoo.com.
| Abstract |
|---|
|
|
|---|
-Hydroxylase deficiency is a rare form of congenital adrenal hyperplasia caused by CYP17 gene mutations.
Objective: Five Chinese patients with 17
-hydroxylase deficiency were genotyped.
Patients: The five patients derived from four families living in Shandong Province, China. The diagnosis of 17
-hydroxylase deficiency was initially established through HPLC serum adrenal profiles in Qilu Hospital, China, from 19831993.
Results: Three CYP17 gene mutations were identified from these patients. Among them, V311fs and Y329fs are two novel frame-shifting mutations. V311fs is an 8-bp nucleotide (TTAAATGG) deletion in exon 5. Y329fs is a deletion-insertion combined mutation (TAC
AA) at codon 329 in exon 6. Two homozygotes for Y329fs and one compound heterozygote for Y329fs and V311fs were identified from three different families. Two homozygous sisters for the D487_S488_F489 deletion were identified.
Conclusion: The results confirmed the diagnostic value of the HPLC serum adrenal profile for 17
-hydroxylase deficiency. The D487_S488_F489 deletion had been identified in two previously genotyped Chinese families. In our present study, a third Chinese family with this mutation was identified, suggesting that this mutation is a prevalent CYP17 mutation in the Chinese population. The identification of Y329fs mutation in addition to three previously identified mutations at codon 329 suggests that codon 329 is an unstable point of the CYP17 gene. The mutations identified from our five patients appear to be random, but the recurrence of the Y329fs mutation may be attributed to a founder effect. Our studies suggest that 17
-hydroxylase deficiency may not be rare in the Chinese population.
| Introduction |
|---|
|
|
|---|
-hydroxylase and 17,20-lyase activities (1). The enzyme is encoded by the gene CYP17, which is approximately 13 kb long, contains eight exons, is located on chromosome 10 at 10q24.3 (2, 3), and is expressed in the adrenals and gonads (4). The 17
-hydroxylation of progesterone is required for production of cortisol and sex steroids but is not required for the synthesis of mineralocorticoids. The 17,20-lyase activity is required for production of androgen and estrogen in the adrenals and gonads. The 17
-hydroxylase deficiency was first described in 1966 (5). About 150 cases of 17
-hydroxylase deficiency have been reported (6). This is a rare form of congenital adrenal hyperplasia (CAH), accounting for about 1% of cases overall (7). Two types of enzymatic deficiency causing this rare form of CAH have been reported: 1) combined deficiency of 17
-hydroxylase and 17,20-lyase, and 2) isolated 17,20-lyase deficiency (8, 9). The combined form is the most common and leads to diminished cortisol production, compensatory hypersecretion of ACTH, accumulation of mineralocorticoids, and diminished synthesis of androgen and estrogen. Corticosterone levels, which are usually 50- to 100-fold higher than normal, provide adequate glucocorticoid effects and prevent symptoms of cortisol deficiency (8). The excess of mineralocorticoids usually leads to low renin hypertension and hypokalemia with 1015% of reported patients being normotensive (10). Female (46, XX) patients have normal female genitalia at birth but have no sexual development at the expected time of puberty. Male (46, XY) patients usually have been raised as girls with female external genitalia, a blind vaginal pouch, and absence of the uterus and fallopian tubes (7). Considerable variation in the capacity for menstruation in 46, XX female subjects and the degree of genital virilization in 46, XY male subjects has been reported (9). Some 46, XX female subjects have irregular or regular menses, and some 46, XY male subjects have ambiguous genitalia or hypospadias with cryptorchidism (11, 12). Cases with isolated 17,20-lyase deficiency are extremely rare (9, 13). About 40 CYP17 gene defects causing this enzyme deficiency have been defined (14), but only two affected Chinese families have been respectively genotyped until now (15, 16). In our present study, we investigated the CYP17 gene defects of our five Chinese patients from four families by molecular genetic techniques and discuss the CYP17 gene mutation in the Chinese population. | Patients and Methods |
|---|
|
|
|---|
Five Chinese patients with 17
-hydroxylase deficiency were genotyped in the present study. The study was approved by the institutional review board equivalent committee of Qilu Hospital, and consent was obtained from the subjects involved. The five patients derived from four Chinese families who have resided for generations in the Shandong Province of China and denied consanguineous marriage. All patients had complete combined 17
-hydroxylase/17,20-lyase deficiency (Table 1
). Among them, three patients (cases 1, 2, and 3) were previously reported in detail (17). The diagnosis of 17
-hydroxylase deficiency in all five patients was established initially by us through HPLC serum adrenal profile (18, 19), performed in the Affiliated Hospital of Shandong Medical University, now named Qilu Hospital, in Jinan, Shandong Province, China, from 19831993. During that period, a total of 19 patients with CAH were identified by the same method.
|
-hydroxylase deficiency by the preliminary HPLC method (18). Afterward, case 1s hypertension was well controlled by dexamethasone (0.375 mg daily). Case 2 was on no glucocorticoids. The two affected sisters were reevaluated by the optimized HPLC method 5 yr later (17). Case 2 was still normotensive. Their whole family was genotyped in this study.
The other three cases were initially diagnosed through the optimized HPLC serum adrenal profile (19) (Table 2
) and then started on glucocorticoid therapy. Case 3 presented with severe hypertension and primary amenorrhea at age 25. She had one healthy brother and one sister with regular menstruation. The 46, XY case 4 presented as an 18-yr-old female with hypokalemic hypertension. She had female external genitalia with a blind vaginal pouch and no secondary sexual characteristics. Case 4 had three sisters with normal puberty and regular menstruation. Her parents and one of the three sisters were genotyped in the present study. The 46, XY case 5 presented as an 18-yr-old female similar to case 4, but she had bilaterally palpable gonads in her inguinal region. All three elder sisters of case 5 had regular menstruation and fertility. All patients had uneventful early childhoods and became symptomatic at age 1316. None of them showed evidence of adrenal gland enlargement by ultrasonography and/or computed tomography.
|
Using our HPLC method, all patients showed a corticosterone-dominated serum adrenal profile (Table 2
) (17). Their basal corticosterone levels were more than 50-fold higher than reference levels. Each had a dramatic suppressive response to an overnight dexamethasone test. Their basal cortisol levels were undetectable or significantly decreased. The ratios of basal corticosterone to cortisol were more than 200-fold higher than the reference values. Three of the five cases had detectable and significantly elevated 11-deoxycorticosterone (DOC). The levels of 11-deoxycortisol, testosterone, androstenedione, and 17-hydroxyprogesterone (17-OHP) for all five patients were undetectable. The unique chromatogram pattern of the 17
-hydroxylase deficiency patients was a huge corticosterone peak replacing the normal dominant cortisol peak (17).
In all five patients, FSH and LH levels determined through direct RIA were significantly elevated and consistent with primary gonad failure. All aldosterone levels by RIA were within normal range. The levels of 17-OHP, corticosterone, DOC, and other mineralocorticoids were not measured by RIA.
CYP17 gene amplifying and sequencing
Genomic DNA was extracted from peripheral blood leukocytes collected from five patients and six relatives using the conventional phenol/chloroform extraction method (20). The DNA was stored at 20 C until analysis. Oligonucleotide primers (Table 3
) for amplifying and sequencing the CYP17 gene were synthesized by IDT (Coralville, IA). The primers were based on references (14, 21, 22), but some were modified or designed by us. Two fragments (A and B), covering the entire coding area of the CYP17gene, were respectively amplified by PCR. Primers 1 and 8 were used to amplify fragment A. Primers 6 and 15 were used to amplify fragment B. Each PCR mixture (50 µl) contained 100300 ng genomic DNA, 5 µl of 10x buffer provided by the manufacturer, 1 µl of 10 mM dNTP (Invitrogen, Carlsbad, CA), and 0.25 µl HotStar Taq polymerase (QIAGEN, Valencia, CA). All amplifications were done with the following program: 1) initial activation at 95 C for 15 min, followed by 2) 35 three-step cycles of denaturation (94 C, 1 min), annealing (66 C, 1.5 min), and extension (72 C, 4 min), and 3) final extension (72 C, 6 min). The PCR products were purified using QIAQuick PCR Purification Kit (QIAGEN). The purified PCR products were submitted for direct sequencing using Big Dye Terminator chemistry and AmpliTag-FS DNA polymerase on a PE Applied Biosystems automated DNA analyzer (Biotechnology Resource Center, Ithaca, NY). The mutations were identified by comparison with the human CYP17 gene sequence M19489 (2) deposited in GenBank. Identified mutations were confirmed by direct sequencing in the opposite direction. The mutation nomenclature was based on recommendations by the Human Genome Variation Society (23).
|
An allele-specific PCR was established to identify the Y329fs mutation in the parents and siblings of patients with this mutation. The PCR mixture was the same as mentioned above except for the primers. The three primers included an allele-specific primer 16 for wild-type 329 or primer 17 for mutant 329, combining with two nonspecific primers 9 and 11 (Table 3
). The PCR program used included 1) initial activation at 95 C for 15 min, followed by 2) 30 cycles of denaturation (94 C, 45 sec), annealing (60 C, 45 sec), and extension (72 C, 1 min), and 3) final extension (72 C, 10 min). The PCR products were electrophoresed on a 1.5% agarose gel. The 731-bp amplicon served as an internal control of the PCR. The 546-bp amplicon represented wild-type 329 when primer 16 was added to the reaction mixture or represented a mutant 329 when primer 17 was used.
| Results |
|---|
|
|
|---|
Three kinds of CYP17 gene mutations were identified from the five Chinese patients. 1) The D487_S488_F489 deletion (Fig. 1A
) is a 9-bp nucleotide (GACTCTTTC) deletion in exon 8. 2) The Y329fs (Fig. 1
, B and D) is a deletion/insertion combined mutation with the replacement of nucleotide TAC by AA at codon 329 in exon 6, causing a frame-shifting (fs) change with tyrosine-329 as the first affected amino acid and the new reading frame being open for 90 amino acids. 3) The V311fs (Fig. 1
, C and E) is an 8-bp nucleotide (TTAAATGG) deletion in exon 5, resulting in a frame-shifting change with valine-311 as the first affected amino acid and a new reading frame opening for 20 amino acids. The Y329fs and the V311fs are two novel CYP17 gene mutations. The genotypes of our patients are listed in Table 1
. The pedigrees of kindreds I and III are shown in Figs. 2
and 3
, respectively.
|
|
|
|
In the compound heterozygous case 5, V311fs (Fig. 1C
) and Y329fs (Fig. 1D
) were presumed to be located on two different alleles. This was proved by the allele-specific DNA sequencing. A pair of primers (primers 16 and 6) was used to amplify the allele with wild-type 329. Another pair of primers (primers 17 and 6) was used for amplifying the allele with mutant 329. Afterward, the DNA sequencing was performed as mentioned above. The sequencing of the allele with wild-type 329 showed that an 8-bp nucleotide deletion started at codon 311 (Fig. 1E
). The sequencing of the allele with mutant codon 329 showed no 8-bp nucleotide deletion at codon 311.
Differences in CYP17 gene
We persistently found three differences between the sequence of our five patients and the CYP17 gene sequence M19489 deposited in GenBank (2): 1) a 124-bp nucleotide insertion (TGCCCTGCTCCTTACCCAAGCAGTAGTTGG- CTTTGACCCCAGAGTAGAGCTGCCCCATCTTCTGGAA-GCCGGGCCTGGGCCCCAGAGCCACTACTGGGAAGGG-ACTGGACAGGCTCTTCTCGAT) associated with a 44-bp nucleotide deletion (g62956338) (CAGAGCCACTACTGGGAAGGGACTGGACAGGCTCTTCTCGATCG) in intron 5; 2) the codon 283 (GAC
GAT); and 3) a 1-bp (C) deletion at the 50th bp of intron 1. The sequencing reaction for exon 1 failed because of a primer with a 1-bp (c) insertion (5'-CTGAAGACCTGAACcAATCC-3'). However, we found that all three polymorphic sequences of our Chinese patients matched the opposite strand sequence of the CYP17 gene in AC009144 and AL358790 deposited in GenBank.
| Discussion |
|---|
|
|
|---|
Y329fs and V311fs are two novel mutations of the CYP17 gene that were identified in our present study. This is the first study to genotype multiple Chinese families with 17
-hydroxylase deficiency. These two novel mutations cause frame shifting that disrupts the normal reading frame of the CYP17 gene and premature translational termination. As a result, we are able to predict that the mutations result in complete loss of 17
-hydroxylase activities despite the absence of in vitro functional and structural studies in transfected cells. In the present study, there were five patients from four affected Chinese families, all native residents in the Shandong province of China. The province is located in eastern China and is one of 23 provinces and five autonomous regions of China. Although our patients were from an ethnically homogeneous population, we were able to identify the two novel mutations Y329fs and V311fs as well as the D487_S488_F489 deletion in the coding region of the CYP17 gene. The identified mutations appear to be random, but the recurrence of the Y329fs mutation in our three families may be attributed to a founder effect.
Codon 329 is the unstable point of the CYP17 gene
Tyrosine at amino acid position 329 of P450c17 enzyme is very important for the normal functioning of the enzyme. According to the molecular modeling of the enzyme, tyrosine 329 is located at the J helix of P450c17 protein and is involved in core integration of the enzyme (24). Tyrosine 329 is conserved among the P450c17s of primates (monkey, marmoset, chimpanzee, and baboon), as shown by sequence alignment. Three kinds of mutations, Y329X iA (25), Y329D (gTAC
GAC) (26), and Y329X (gTAC
TAG) (14) causing 17
-hydroxylase deficiency had already been identified at amino acid 329 of the CYP17 gene. The novel mutation Y329fs is the fourth kind of mutation identified at the same codon. It is rare for many mutations to occur at the same codon on a gene. Because four different mutations occur at codon 329, we believe codon 329 is an unstable point of the CYP17 gene.
D487_S488_F489 deletion is a prevalent Chinese mutation of the CYP17 gene
In kindred I, two affected sisters were identified as homozygotes and their parents as well as a healthy sister were identified as heterozygotes for the D487_S488_F489 deletion of the CYP17 gene (Fig. 2
). The D487_S488_F489 deletion was first identified from a Thai homozygous patient in 1993 (27). It has been proven that this mutation causes complete abolishment of the enzyme activities through heterologous expression of in vitro transfected cells (27). Interestingly, all patients from the two previously genotyped Chinese families were heterozygous for this mutation. However, they came from different geographic regions of China. One of them was from Hong Kong (15) and the other was from Anhui Province (16). Our patients were from Shandong Province. Thus it can be seen that patients carrying the D487_S488_F489 deletion came from a wide range of geographic regions in China. This strongly suggests that the deletion of D487_S488_F489 is a prevalent Chinese mutation of the CYP17 gene and is widely propagated in the Chinese population.
Factors other than the CYP17 genotype may determine the phenotype of an individual with 17
-hydroxylase deficiency
The phenotypic manifestations of 17
-hydroxylase deficiency are a consequence of the biochemical defects caused by the mutations of the CYP17 gene. However, the two affected sisters of kindred I whom we studied had the same genotype but differing phenotypes. Case 1 had severe hypertension documented at 13 yr old, but case 2 was normotensive even though both had sexual infantilism. The reason for this phenotypic difference remains unknown. About 1015% of reported patients are neither hypertensive nor hypotensive (10). In the Brazilian study, differences in blood pressure as well as in genital differentiation were described in multiple homozygous individuals for mutations R326C and W406R (14). All of these findings suggest that there are factors other than the CYP17 genotype that determine the phenotype of an individual with 17
-hydroxylase deficiency (9, 14).
Observed CYP17 gene sequence differences between our patients and M19489
Three differences of the CYP17 gene sequence were observed consistently between our patients and M19489. 1) The polymorphism at D283 (GAT
GAC) was described previously in the Brazilian study (14). 2) The 124-bp nucleotide insertion was associated with a 44-bp nucleotide (g61716214) deletion in intron 5. 3) There was a 1-bp nucleotide (C) deletion at the 50th bp nucleotide in intron 1. However, all three polymorphic sequences in our patients match the opposite strand of the CYP17 gene sequences in AC009144 and AL358790 deposited in GenBank. These differences should be considered when designing primers, even though the reasons for these differences are not known at the present.
HPLC adrenal profile is an efficient diagnostic assay for 17
-hydroxylase deficiency
The diagnosis of 17
-hydroxylase deficiency can be established based on elevated levels of 17-deoxy-C21 steroids such as progesterone, pregnenolone, DOC, and corticosterone in blood and increased urinary excretion of their metabolites (8) through RIA, gas chromatography/mass spectrometry, HPLC, and other analytic techniques. In this study, the diagnosis in all five of our patients was established initially by the HPLC serum adrenal profile (17, 19) and was further confirmed by CYP17genotyping. The HPLC serum adrenal profiles for patients with 17
-hydroxylase deficiency showed extremely elevated corticosterone levels that were 50- to 100-fold higher than the reference level, associated with a significantly decreased cortisol level. The ratios of corticosterone to cortisol in the patients were 200-fold higher than the reference. Because the patients adrenal profile is so characteristic, misdiagnosis of combined 17
-hydroxylase deficiency is unlikely. HPLC adrenal profile provides not only individual steroid values but also shows a pattern of multiple steroids. Therefore, it is a cost-effective diagnostic test for CAH resulting from 17
-hydroxylase deficiency and other enzyme defects (19). Currently, most steroid hormones are usually determined by RIA in commercial laboratories. Although a significantly elevated corticosterone level almost only occurs in 17
-hydroxylase deficiency, the corticosterone level is rarely measured. This may lead to underdiagnosis of 17
-hydroxylase deficiency. A significantly elevated progesterone level is another valued diagnostic index (26). However, it must be noted that the diagnosis of isolated 17,20-lyase deficiency is very difficult (28). Genotyping as well as detailed in vitro functional and structural studies may be necessary.
17
-Hydroxylase deficiency may not be rare in the Chinese population
The 17
-hydroxylase deficiency is a rare disorder that occurs in approximately one in 50,000 individuals (8). However, this disorder is no longer considered rare in the diverse Brazilian population (14, 26, 29). The actual prevalence in the Chinese population, as well as in most other populations, remains unknown. In our studies, 1) five patients were identified in one local hospital of Shandong Province in China; 2) these patients accounted for 26% of all CAH patients identified at the hospital during the same period; and 3) these patients had diverse CYP17 gene mutations. Thus, our studies suggest that 17
-hydroxylase deficiency may not be rare in Shandong province or in the general Chinese population. In fact, it may be the second most common form of CAH in the Chinese population.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online July 5, 2006
Abbreviations: CAH, Congenital adrenal hyperplasia; DOC, 11-deoxycorticosterone; 17-OHP, 17-hydroxyprogesterone.
Received January 26, 2006.
Accepted June 23, 2006.
| References |
|---|
|
|
|---|
-hydroxylase/C17,20-lyase cytochrome P-450. J Biol Chem 259:39713976
-hydroxylase/17,20 lyase): similarity with the gene for P450c21. DNA 6:439448[Medline]
-hydroxylase/17,20 lyase): cloning of the human adrenal and testes cDNAs indicate the same gene is expressed in both tissues. Proc Natl Acad Sci USA 84:407411
-Hydroxylation in man. J Clin Invest 45:19461954[Medline]
-Hydroxylase/17,20-lyase deficiency: from clinical investigation to molecular definition. Endocr Rev 12:91108
-hydroxylase deficiency. Endocrinol Metab Clin North Am 23:341357[Medline]
-hydroxylase deficiency with retained menstruation. Endocr J 41:213218[Medline]
gene (CYP17) in a Japanese patient previously reported as having glucocorticoid-responsive hyperaldosteronism: with a review of Japanese patients with mutations of CYP17. J Clin Endocrinol Metab 81:37973801[Abstract]
-hydroxylase deficiency. Mol Genet Metab 72:254259[CrossRef][Medline]
-hydroxylase/17,20-lyase deficiency in three Chinese sisters. Mol Cell Endocrinol 201:189195[CrossRef][Medline]
-hydroxylase deficiency. J Biol Chem 266:1599215998
-hydroxylase deficiency. J Biol Chem 268:2581125817
-hydroxylase/17,20-lyase): insights into reaction mechanisms and effects of mutations. Mol Endocrinol 13:11691182
-Hydroxylase/17,20-lyase deficiency as a model to study enzymatic activity regulation: role of phosphorylation. J Clin Endocrinol Metab 85:12261231
-hydroxylase deficiency. J Clin Endocrinol Metab 77:489493[Abstract]
-hydroxylase deficiencynot rare everywhere. J Clin Endocrinol Metab 89:4042
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |