help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-0638
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity
Related Collections
Right arrow Metabolism
Right arrow Obesity
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 9 3592-3597
Copyright © 2006 by The Endocrine Society

The Suppressor of Cytokine Signaling 3 Inhibits Leptin Activation of AMP-Kinase in Cultured Skeletal Muscle of Obese Humans

Gregory R. Steinberg, Andrew J. McAinch, Michael B. Chen, Paul E. O’Brien, John B. Dixon, David Cameron-Smith and Bruce E. Kemp

St. Vincent’s Institute and Department of Medicine (G.R.S., M.B.C., B.E.K.), University of Melbourne, Fitzroy, Victoria 3065, Australia; Commonwealth Scientific and Industrial Research Organization (B.E.K.), Molecular and Health Technologies, Parkville, Victoria 3052, Australia; School of Exercise and Nutrition Sciences (A.J.M., D.C.-S.), Deakin University, Burwood, Victoria 3125, Australia; and Centre of Obesity Research and Education (P.E.O., J.B.D.), Monash University, Alfred Hospital, Melbourne, Victoria 3181, Australia

Address all correspondence and requests for reprints to: Gregory R. Steinberg, Ph.D., St. Vincent’s Institute, 9 Princes Street, Fitzroy, Victoria 3065, Australia. E-mail: gsteinberg{at}svi.edu.au.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Leptin is thought to regulate whole-body adiposity and insulin sensitivity, at least in part, by stimulating fatty acid metabolism via activation of AMP-kinase (AMPK) in skeletal muscle. Human obesity is associated with leptin resistance, and recent studies have demonstrated that hypothalamic expression of the suppressors of cytokine signaling 3 (SOCS3) regulates leptin sensitivity in rodents.

Objective: The objective of the study was to investigate the effects of leptin on fatty acid oxidation and AMPK signaling in primary myotubes derived from lean and obese skeletal muscle and evaluate the contribution of SOCS3 to leptin resistance and AMPK signaling in obese humans.

Results: We demonstrate that leptin stimulates AMPK activity and increases AMPK Thr172 and acetyl-CoA carboxylase-ß Ser222 phosphorylation and fatty acid oxidation in lean myotubes but that in obese subjects leptin-dependent AMPK signaling and fatty acid oxidation are suppressed. Reduced activation of AMPK was associated with elevated expression of IL-6 (~3.5-fold) and SOCS3 mRNA (~2.5-fold) in myotubes of obese subjects. Overexpression of SOCS3 via adenovirus-mediated infection in lean myotubes to a similar degree as observed in obese myotubes prevented leptin but not AICAR (5-amino-imidazole-4-carboxamide-1-ß-D-ribofuranoside) activation of AMPK signaling.

Conclusions: These data demonstrate that SOCS3 inhibits leptin activation of AMPK. These data suggest that this impairment of leptin signaling in skeletal muscle may contribute to the aberrant regulation of fatty acid metabolism observed in obesity and that pharmacological activation of AMPK may be an effective therapy to bypass SOCS3-mediated skeletal muscle leptin resistance for the treatment of obesity-related disorders.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
SUPPRESSED RATES OF skeletal muscle fatty acid oxidation (1) combined with increased rates of fatty acid uptake (2) and esterification (3) contribute to the accumulation of im lipid and facilitate the development of skeletal muscle insulin resistance in obese humans (4). In rodents leptin acutely (5) and chronically (6) stimulates skeletal muscle fatty acid oxidation reducing im triacylglycerol storage (7). These acute (8) and chronic (9) effects are attributed to the activation of AMP-activated protein kinase (AMPK), which stimulates fatty acid oxidation by phosphorylation and inhibition of acetyl-CoA carboxylase (ACC)-ß leading to reduced malonyl-CoA and increased carnitine palmitoyl-transferase-1 activity and mitochondrial fatty acid flux (10). In skeletal muscle the activity of AMPK shows an absolute dependence on phosphorylation of Thr172 in the activation loop of the {alpha}-subunit by the upstream kinase LKB1 (11). AMP acts allosterically via the {gamma}-subunit to enhance phosphorylation of AMPK Thr172 by LKB1 kinase (12, 13) as well as further activating the phosphorylated holoenzyme.

Although leptin has pronounced effects in rodents fed a high-carbohydrate chow diet (6) and rodents with lipodystrophy (14), we and others (15, 16, 17) have demonstrated the presence of leptin resistance after high-fat feeding. Human obesity is characterized by elevated levels of circulating leptin (18), and a blunting of leptin’s effects on skeletal muscle fatty acid oxidation suggests the presence of skeletal muscle leptin resistance (19). A potential mediator of leptin resistance is the suppressors of cytokine signaling (SOCS)-3. SOCS3 is a member of a family of proteins (SOCS1-SOCS7, and cytokine-induced SH2-containing protein) that bind with their central SH2 domains to phosphotyrosine residues in cytokine receptors (20). Initial studies by Bjorbaek et al. (21) demonstrated the inhibition of leptin signaling via the signal transducer and activator of transcription-3 in hypothalamic nuclei was blocked by SOCS3 binding of pTyr985 of the leptin receptor (22). Recent studies in vivo have supported these findings as mutation of the leptin receptor at Tyr985 to Leu prevents SOCS3 binding resulting in enhanced activation of hypothalamic signal transducer and activator of transcription-3, reductions in food intake, and reduced adiposity in mice harboring the Y985L mutation, demonstrating a critical role of this residue in mediating hypothalamic leptin resistance (23). In addition, both SOCS3 hypothalamic-specific null mice (24) and SOCS3 mice with haploinsufficiency (25) have recently been found to have enhanced leptin sensitivity and are resistant to diet-induced obesity. In liver, SOCS3 expression is elevated in insulin-resistant rodents, and inhibition of SOCS3 with antisense oligonucleotides rescues impaired insulin sensitivity and improves hepatic steatosis in vivo (26). In skeletal muscle, SOCS3 is up-regulated after high-fat feeding, an effect that was associated with skeletal muscle leptin resistance (17, 27).

In this study we used cultured primary myotubes derived from skeletal muscle of lean and obese subjects to directly examine the role of leptin on skeletal muscle fatty acid oxidation and AMPK signaling. The use of primary myotubes represents an excellent model to study the effects of leptin on AMPK signaling and fatty acid oxidation because they express protein characteristics of differentiated muscle cells (28) and maintain the metabolic phenotypes of suppressed fatty acid oxidation under basal conditions (29) and in response to alterations in substrates (30) and hormones (31) analogous to these conditions in vivo. Therefore, the purpose of this study was to investigate the effects of leptin on fatty acid oxidation and AMPK signaling in primary myotubes derived from lean and obese skeletal muscle and evaluate the contribution of SOCS3 to leptin resistance and AMPK signaling in obese humans.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Subjects

The participants were seven (five males and two females in each group) lean [body mass index (BMI) < 25 kg/m2] and obese (BMI > 35 kg/m2) subjects undergoing general abdominal surgery or lap-band surgery, respectively. Written informed consent was obtained from all participants following approval by the Human Ethics Research Committee of Deakin University, the Avenue Hospital, and Cabrini Hospital, Melbourne. After a fast (12–18 h), general anesthesia was induced with a short-acting propofol and maintained by a fentanyl and rocuronium volatile anesthetic mixture, and a muscle biopsy of rectus abdominus muscle was removed.

Cell culture

Primary skeletal muscle cell culture was performed as recently described (31). All experiments were conducted on cells that were on passage four.

AMPK activity

For the determination of AMPK-related activity, cells were cultured in 10-cm plates and treated with vehicle (PBS), 2 mM 5-amino-imidazole-4-carboxamide-1-ß-D-ribofuranoside (AICAR; Toronto Research Chemicals, Toronto, Canada), or low (LL; 0.l µg/ml) and high (LH, 0.5 µg/ml) concentrations of recombinant human leptin (R&D Systems, Minneapolis, MN). The leptin concentration and time point used in this study were the same as previously demonstrated to activate AMPK in rodent skeletal muscle (8). AICAR concentrations were selected based on previous studies in cell culture demonstrating activation of AMPK in primary human myotubes (31, 32). AMPK expression, activity, and Thr172 phosphorylation as well as ACC expression and phosphorylation were determined as previously described (31).

Fatty acid oxidation

Fatty acid oxidation was measured in myotubes cultured on 10-cm plates as previously described (31). Briefly, cells were preincubated with 3 ml of 4% fatty acid-free bovine albumin (ICN), 1 mM palmitate (Sigma-Aldrich Co., St. Louis, MO), 0.1% fetal bovine serum, 1% penicillin, streptomycin, and amphotericin B (PSA) {alpha}MEM at 37 C for 1 h. Cells were then treated with the same media but with the addition of 1 µCi/ml palmitate (Amersham Biosciences, Buckinghamshire, UK) with vehicle (PBS), AICAR (2 mM), or low and high concentrations of recombinant human leptin for 2 h. Total palmitate oxidation was calculated by the addition of aqueous phase counts representing acid soluble metabolites to 14CO2 counts captured within the benzethonium hydroxide. The quantity of palmitate oxidized was calculated from the specific activity of labeled palmitate in the incubation medium (15).

SOCS3 mRNA

Total cellular RNA and real-time RT-PCR was performed as previously described (31). Briefly, forward and reverse primers and cDNA (12 ng), were run for 40 cycles of PCR in a total volume of 20 µl. To compensate for variations in input RNA amounts, and efficiency of reverse transcription, cyclophilin (GenBank cyclophilin X52851) mRNA was quantified, and all results were normalized to these values. Cyclophilin expression did not differ between groups. Fluorescent emission data were analyzed for the critical threshold (CT) values, with the expression of the gene of interest normalized to cyclophilin and expressed as 2–{Delta}CT (33). The sequences of the forward (F) and reverse (R) primers are listed from 5'-3' and are as follows: SOCS3 (NM_003955) (F) GACCAGCGCCACTTCTTCA, (R) CTGGATGCGCAGGTTCTTG; IL-6 (NM_000600) (F) GTG ACA TCC TCG ACG GCA TCT, (R) GTG CCT CTT TGC TGC TTT CAC; and cyclophilin (X52851) (F) CATCTGCACTGCCAAGACTGA, (R) TTCATGCCTTCTTTCACTTTGC. Leptin receptor expression (NM_001003679) was determined using an Assay-on-Demand gene expression kit (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions.

SOCS3 adenovirus infection

Primary human myotubes from a lean subject were differentiated as described above. After 4 d of differentiation, cells were infected with a SOCS3 adenovirus (Ad-SOCS3, 100 PFU/plate) or control vector (Ad-Null, 100 PFU/plate). Two days after infection, cells were serum starved overnight and treated the following morning with 0.5 µg/ml leptin or 2 mM AICAR for 30 min, lysed, snap frozen in liquid nitrogen, and analyzed for AMPK activity and ACCß phosphorylation as described above and LKB1 activity as previously described (31). Briefly, for LKB1 activity, sheep anti-LKB1 antibody (Upstate Biotechnology, Lake Placid, NY) was prebound to protein A beads and incubated with the muscle lysates for 2 h at 4 C. LKB1 assays were performed on the beads using a two-step reaction with full-length, bacterially expressed, human AMPK ({alpha}1ß1{gamma}1) as substrate. The AMPK ({alpha}1ß1{gamma}1) activity was then determined using the AMPK SAMS peptide assay. SOCS3 expression was measured via immunoblot using anti-SOCS3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) from 100 µg of protein resolved on a 12% acrylamide gel. In separate experiments, cells treated with vehicle or leptin for 30 min were lysed in 0.5 M perchloric acid (1 mM EDTA) and neutralized with 2.2 M KHCO3. This extract was used for the determination of AMP (ATP), phosphocreatine, creatine, and lactate by spectrophotometric assays as described (34).

Calculations and statistical analysis

Data are reported as mean ± SE for figures and mean ± SD for tables. AMPK and ACC phosphorylation were corrected for AMPK {alpha}-pan ({alpha}1 and {alpha}2) and ACCß expression, respectively. One experimental replicate per subject (n = 7) was used to determine differences between lean and obese subjects. Adenovirus infection of SOCS3 was conducted in one leptin-responsive lean cell line cultured to passage four in two separate experiments with three repeats per condition (n = 6). Results were analyzed using ANOVA procedures, and a Tukey’s post hoc test was used to test for significant differences revealed by the ANOVA. A Student’s t test for unpaired samples was used where appropriate. Significance was accepted at P ≤ 0.05.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
Clinical characteristics for lean and obese subjects are listed in Table 1Go. Obese subjects had greater body mass and BMI than lean subjects and had elevated fasting plasma insulin levels relative to lean controls, suggesting the presence of peripheral insulin resistance. Two of the seven obese subjects had a family history of diabetes, but because responses to leptin and basal AMPK expression/activity and fatty acid oxidation were similar between these individuals and the rest of the group, their data were included in the analysis. Neither lean nor obese subjects were taking any medications known to alter carbohydrate or fatty acid metabolism.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Clinical characteristics

 
AICAR stimulated AMPK{alpha}1 and AMPK{alpha}2 activities (Fig. 1Go, A and B) in myotubes from lean and obese subjects. In skeletal muscle myotubes from lean subjects, a LH increased AMPK{alpha}2 activity relative to vehicle-treated cells (P < 0.001) or a low dose of leptin (Fig. 1BGo). A LH also increased AMPK{alpha}1 activity (Fig. 1AGo). Unlike skeletal muscle from lean subjects, in obese cultured skeletal muscle, LH did not increase AMPK{alpha}1 or AMPK{alpha}2 activities (Fig. 1Go, A and B). In agreement with previous findings (31), we found that AMPK{alpha}1 was approximately 10-fold more active than AMPK{alpha}2 in primary human myotubes. In human skeletal muscle, AMPK{alpha}1 and AMPK{alpha}2 display similar activities (19, 35), and AMPK{alpha}2 is more sensitive to activation by AICAR (19). The reason for this shift in isoform activity in primary myotubes is unknown.


Figure 1
View larger version (36K):
[in this window]
[in a new window]
  		FIG. 1. AMPK{alpha}1 (A) and AMPK{alpha}2 (B) activity, AMPK Thr172 phosphorylation (C), and ACCß Ser222 phosphorylation (D) in cultured myotubes of lean and obese subjects after 30 min of treatment with vehicle (PBS), AICAR (2 mM), or LL (0.1 µg/ml) and LH (0.5 µg/ml). Data are shown as means ± SEM, n = 7. a, Significantly different from vehicle treatment; b, same condition from lean cells.

 
Consistent with increases in AMPK activity, AICAR increased AMPK Thr172 phosphorylation (Fig. 1CGo) and ACCß Ser222 phosphorylation (Fig. 1DGo) in both lean and obese subjects. AMPK{alpha} and ACCß protein expression was unaltered between lean and obese subjects (data not shown). In lean subjects, AMPK Thr172 phosphorylation was elevated after treatment with a LH but not a LL (Fig. 1CGo), but both LL and LH elevated ACCß phosphorylation (Fig. 1DGo). Consistent with a lack of AMPK activation in obese skeletal muscle, AMPK Thr172 phosphorylation (Fig. 1CGo) and ACCß Ser222 phosphorylation (Fig. 1DGo) were unaltered after leptin treatment.

AICAR treatment increased palmitate oxidation in both lean and obese myotubes (Fig. 2Go). Consistent with changes in ACCß Ser222 phosphorylation, a LH increased palmitate oxidation in lean myotubes but did not alter palmitate oxidation in myotubes from lean subjects.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Palmitate oxidation in cultured myotubes from lean and obese subjects treated with vehicle (PBS), AICAR (2 mM), or LL (0.1 µg/ml) and LH (0.5 µg/ml) of leptin for 120 min. Data are shown as means ± SEM, n = 7. a, Significantly different from vehicle treatment; b, same condition from lean cells.

 
To investigate potential mechanisms contributing to leptin resistance observed in obese myotubes, we examined the expression of SOCS3. Skeletal muscle myotubes from obese subjects had greater SOCS3 mRNA expression relative to myotubes derived from lean subjects (lean, 3.69 ± 1.56; obese, 7.71 ± 2.02 arbitrary units, P = 0.034). SOCS3 expression was related to BMI (R = 0.524, P = 0.030). Similarly, IL-6 expression was also elevated in obese subjects (lean, 1.0 ± 0.22; obese, 3.76 ± 1.2 arbitrary units, P = 0.019) and was also positively correlated with BMI (r = 0.501, P = 0.034). Leptin receptor expression was not significantly altered between lean and obese subjects (lean, 2.70 ± 1.66; obese, 4.24 ± 2.43 arbitrary units).

To determine whether there was a causal link between elevated SOCS3 mRNA expression and reduced leptin sensitivity in myotubes from obese subjects, we infected primary human myotubes from a lean subject with a SOCS3 adenovirus (Ad-SOCS3) or green fluorescent protein control virus (Ad-Null). Seventy-two hours after infection, SOCS3 was overexpressed in skeletal muscle myotubes from lean subjects in Ad-SOCS3-infected (2.64 ± 0.94 arbitrary density units) but not Ad-Null-infected (1.00 ± 0.94 arbitrary density units) cells. AMPK{alpha}-pan ({alpha}1 and {alpha}2) expression was not different between Ad-Null- and Ad-SOCS3-infected cells. AICAR increased AMPK{alpha}1 and -{alpha}2 activities and increased ACCß phosphorylation and fatty acid oxidation to a similar degree in both Ad-Null- and Ad-SOCS3-infected cells (Table 2Go). In contrast, whereas leptin treatment in Ad-Null increased AMPK{alpha}1, AMPK{alpha}2, ACCß phosphorylation, and fatty acid oxidation, this effect was suppressed in Ad-SOCS3 (Table 2Go).


View this table:
[in this window]
[in a new window]
  		TABLE 2. AMPK {alpha}1 and {alpha}2 activities, ACC phosphorylation and palmitate oxidation from a lean subject differentiated for 4 d and infected with a control (Ad-Null) or SOCS3 (Ad-SOCS3) adenovirus for 72 h followed by treatment with vehicle, AICAR, or leptin for 30 min (AMPK and ACC) or 120 min (palmitate oxidation)

 
To examine mechanisms mediating the suppression of AMPK signaling by SOCS3, we measured ATP, AMP, phosphocreatine, creatine, and lactate after vehicle or leptin treatment in Ad-Null- and Ad-SOCS3-infected cells. Leptin increased cellular AMP and reduced ATP in Ad-Null, but this effect was abolished in Ad-SOCS3 (Table 3Go). Phosphocreatine, creatine, or lactate was unaltered by either leptin or SOCS3. LKB1 activity was not affected by either leptin or SOCS3 (Table 3Go).


View this table:
[in this window]
[in a new window]
  		TABLE 3. Adenine nucleotides, muscle metabolites, and LKB1 activity in primary myotubes from a lean subject differentiated for 4 d and infected with a control (Ad-Null) or SOCS3 (Ad-SOCS3) adenovirus for 72 h followed by treatment with vehicle or leptin for 30 min

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
More than a decade ago, leptin was found to rapidly restore euglycemia independent of weight loss in ob/ob mice, suggesting a role of leptin in regulating insulin sensitivity in peripheral tissues (36). However, it was later found that rodents with diet-induced obesity (37) and obese humans (18) have elevated levels of leptin, suggesting the development of leptin resistance in human obesity. Indeed clinical trials subsequently demonstrated that leptin was largely ineffective in treating most cases of human obesity (38).

Leptin signaling is mediated by short and long leptin receptor isoforms, both of which are expressed in skeletal muscle (39). Skeletal muscle is an important target tissue for leptin action because it is the primary tissue contributing to basal metabolic rate and whole-body fatty acid metabolism, and the aberrant regulation of skeletal muscle fatty acid metabolism contributes to the development of insulin resistance (4). In the present study, we provide the first evidence that leptin also stimulates AMPK activity, ACCß phosphorylation, and fatty acid oxidation in cultured skeletal muscle of lean subjects.

The most significant finding of this study is that leptin activation of AMPK signaling is blunted with obesity. We (19) and others (40) recently demonstrated that the mRNA and protein expression of AMPK isoforms is not altered in skeletal muscle of obese or type 2 diabetic subjects and that pharmacological activation of AMPK by AICAR is maintained (19, 31, 41). AMPK activation by AICAR is also maintained in myotubes in culture, indicating that the suppressed activation of AMPK by leptin in obesity is not due to defects in AMPK signaling. These findings are consistent with leptin resistance in myotubes cultured from obese individuals being due to defects upstream of AMPK.

A potential mediator of leptin resistance is SOCS3. In the present study, we illustrate that SOCS3 is up-regulated in skeletal muscle myotubes of obese humans. The SOCS family of proteins were first identified by their rapid up-regulation in response to IL-6 acting in a classical negative feedback loop to regulate cytokine signal transduction (42). Human obesity is characterized by elevated levels of circulating IL-6 (43). Recent studies demonstrated that IL-6 is highly expressed in skeletal muscle (44); therefore, we hypothesized that elevated levels of SOCS3 in obese myotubes may be due to increased IL-6 expression. We found that IL-6 expression was positively associated with BMI and was elevated in obese myotubes. Interestingly, whereas Rieusset et al. (45) demonstrated the up-regulation of SOCS3 by IL-6 in primary myotubes and elevated SOCS3 in type 2 diabetic skeletal muscle, SOCS3 was not elevated in skeletal muscle of obese subjects (BMI 32.9 kg/m2). One potential reason for the disparity between our data and Riessuet et al. (45) may be due to the morbidly obese subjects (BMI 47.3 kg/m2) used in the present study. In support of this possibility, we observed a positive correlation between both IL-6 and SOCS3 expression and BMI. These data suggest that elevated IL-6 levels in obese myotubes may be of genetic origin because myotubes were passaged four times before experiments, thus most likely eliminating any contribution from their in vivo environment. The mechanisms contributing to elevated IL-6 in obese myotubes may involve the C-174G promoter polymorphism of the IL-6 gene, which is associated with elevated circulating IL-6, reduced energy expenditure and insulin sensitivity, and an increased predisposition for obesity (46).

To examine whether there was a relationship between the elevation of SOCS3 in myotubes of obese subjects and reduced AMPK activation by leptin, SOCS3 was overexpressed in leptin-sensitive myotubes of a lean subject via adenovirus infection to a similar degree as observed in obese myotubes. The up-regulation of SOCS3 inhibited leptin activation of AMPK but importantly, not activation of AMPK by AICAR, demonstrating a direct effect of SOCS3 on leptin signaling upstream of AMPK. Reduced activation of AMPK was accompanied by reduced ACCß phosphorylation and fatty acid oxidation after leptin treatment, indicating that increased SOCS3 expression with obesity may contribute to the suppressed rates of skeletal muscle fatty acid oxidation observed in vivo and may therefore contribute to the accumulation of im lipid and subsequent insulin resistance common in obesity (1).

Leptin directly activates AMPK, stimulating fatty acid oxidation acutely in skeletal muscle by altering the AMP to ATP ratio (8). We provide evidence that a similar mechanism exists for activating AMPK in human myotubes and that SOCS3 inhibits leptin-induced increases in cellular AMP, which in turn suppresses leptin activation of AMPK signaling. The mechanism by which leptin and other hormones such as adiponectin (47) and ciliary neurotrophic factor (17) increase cellular AMP is currently unknown but may involve mitochondrial uncoupling or futile cycling. In the present study, we illustrate that LKB1 is not activated by leptin. These findings are in agreement with previous studies in a variety of cell systems (12, 13) that indicate that LKB1 is constitutively active despite large alterations in AMPK Thr172 phosphorylation and activity, suggesting that increases in nucleotide levels and localization of the LKB1 accessory proteins MO25 and STRAD may be more critical determinants of AMPK phosphorylation/activity.

In conclusion, the principal findings of this study are that leptin stimulates AMPK activity, ACCß phosphorylation, and fatty acid oxidation in skeletal muscle myotubes from lean subjects. Of significance in myotubes of morbidly obese subjects, increased SOCS3 expression was associated with blunted leptin-dependent activation of AMPK signaling, an effect that was replicated in lean skeletal muscle myotubes overexpressing SOCS3. These data indicate that SOCS3 expression in skeletal muscle may be an important factor contributing to the development of skeletal muscle leptin resistance and the suppressed rates of skeletal muscle fatty acid oxidation observed in obesity.


   Acknowledgments
 
We thank AMRAD Operations Pty. Ltd. (Richmond, Victoria, Australia) for providing the SOCS3 adenovirus construct and Dr. Walter Thomas (Baker Heart Research Institute, Melbourne, Australia) for assistance with purification. We gratefully acknowledge the invaluable contributions of the surgeons, Dr. Simon Woods, F.R.A.C.S. (Monash University Academic Surgery Unit, Cabrini Hospital) and Dr. Mark Lawrence (Network Director, Obstetrics and Gynaecology, Bayside Health). We thank Ms. Janelle Mollica for assisting with the preparation of the human muscle cell culture.


   Footnotes
 
This work was supported by the National Health and Medical Research Council (to B.E.K., G.R.S.), Diabetes Australia Research Trust (to G.R.S.), and the National Heart Foundation (to B.E.K.). G.R.S. is supported by a Target Obesity Research Fellowship from the Canadian Institutes of Health Research, the Heart and Stroke Foundation of Canada, and the Canadian Diabetes Association. B.E.K. is an Australian Research Council Federation Fellow.

Disclosure statement: The authors have nothing to declare.

First Published Online July 5, 2006

Abbreviations: ACC, Acetyl-CoA carboxylase; AMPK, AMP kinase; BMI, body mass index; F, forward; LH, high concentration of leptin; LL, low concentration of leptin; R, reverse; SOCS, suppressors of cytokine signaling.

Received March 23, 2006.

Accepted June 26, 2006.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Kelley DE, Simoneau J-A 1994 Impaired free fatty acid utilization by skeletal muscle in non-insulin-dependent diabetes mellitus. J Clin Invest 94:2349–2356[Medline]
  2. Bonen A, Parolin ML, Steinberg GR, Calles-Escandon J, Tandon NN, Glatz JFC, Luiken JJFP, Heigenhauser GJF, Dyck DJ 2004 Triacylglycerol accumulation in human obesity and type 2 diabetes is associated with increased rates of skeletal muscle fatty acid transport and increased sarcolemmal FAT/CD36. FASEB J 18:1144–1146[Abstract/Free Full Text]
  3. Steinberg GR, Parolin ML, Heigenhauser GJ, Dyck DJ 2002 Leptin increases FA oxidation in lean but not obese human skeletal muscle: evidence of peripheral leptin resistance. Am J Physiol 283:E187–E192
  4. Shulman GI 2000 Cellular mechanisms of insulin resistance. J Clin Invest 106:171–176[Medline]
  5. Muoio DM, Dohm GL, Fiedorek FTJ, Tapscott EB, Coleman RA 1997 Leptin directly alters lipid partitioning in skeletal muscle. Diabetes 46:1360–1363[Abstract]
  6. Steinberg GR, Bonen A, Dyck DJ 2002 Fatty acid oxidation and triacylglycerol hydrolysis are enhanced following chronic leptin treatment in rats. Am J Physiol 282:E593–EE600
  7. Steinberg GR, Dyck DJ, Calles-Escandon J, Tandon NN, Luiken JJ, Glatz JF, Bonen A 2002 Chronic leptin administration decreases fatty acid uptake and fatty acid transporters in rat skeletal muscle. J Biol Chem 277:8854–8860[Abstract/Free Full Text]
  8. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415:339–343[CrossRef][Medline]
  9. Steinberg GR, Rush JWE, Dyck DJ 2003 AMPK expression and phosphorylation are increased in rodent muscle after chronic leptin treatment. Am J Physiol 284:E648–E654
  10. Ruderman NB, Saha AK, Vavvas D, Witters LA 1999 Malonyl-CoA, fuel sensing, and insulin resistance. Am J Physiol 276:E1–E18
  11. Sakamoto K, McCarthy A, Smith D, Green KA, Grahame Hardie D, Ashworth A, Alessi DR 2005 Deficiency of LKB1 in skeletal muscle prevents AMPK activation and glucose uptake during contraction. EMBO J 24:1810–1820[CrossRef][Medline]
  12. Woods A, Johnstone SR, Dickerson K, Leiper FC, Fryer LG, Neumann D, Schlattner U, Wallimann T, Carlson M, Carling D 2003 LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr Biol 13:2004–2008[CrossRef][Medline]
  13. Hawley S, Boudeau J, Reid J, Mustard K, Udd L, Makela T, Alessi D, Hardie DG 2003 Complexes between the LKB1 tumor suppressor, STRAD{alpha}/ß and MO25{alpha}/ß are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2:28
  14. Asilmaz E, Cohen P, Miyazaki M, Dobrzyn P, Ueki K, Fayzikhodjaeva G, Soukas AA, Kahn CR, Ntambi JM, Socci ND, Friedman JM 2004 Site and mechanism of leptin action in a rodent form of congenital lipodystrophy. J Clin Invest 113:414–424[CrossRef][Medline]
  15. Steinberg GR, Dyck DJ 2000 Development of leptin resistance in rat soleus muscle in response to high-fat diets. Am J Physiol 279:E1374–E1382
  16. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, Sybertz EJ, Strader CD, Davis JHR 1997 Diet-induced mice develop peripheral, but not central, resistance to leptin. J Clin Invest 99:385–390[Medline]
  17. Watt MJ, Dzamko N, Thomas WG, Rose-John S, Ernst M, Carling D, Kemp BE, Febbraio MA, Steinberg GR 2006 CNTF reverse obesity-induced insulin resistance by activating skeletal muscle AMPK. Nat Med 12:541–548[CrossRef][Medline]
  18. Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim S, Lallone R, Ranganathan S, Kern PA, Friedman JM 1995 Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med 1:1155–1161[CrossRef][Medline]
  19. Steinberg GR, Smith AC, van Denderen BJW, Chen Z, Murthy S, Campbell DJ, Heigenhauser GJF, Dyck DJ, Kemp BE 2004 AMP-activated protein kinase is not down-regulated in human skeletal muscle of obese females. J Clin Endocrinol Metab 89:4575–4580[Abstract/Free Full Text]
  20. Wormald S, Hilton DJ 2004 Inhibitors of cytokine signal transduction. J Biol Chem 279:821–824[Abstract/Free Full Text]
  21. Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS 1998 Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619–625[CrossRef][Medline]
  22. Bjorbaek C, El-Haschimi K, Frantz JD, Flier JS 1999 The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274:30059–30065[Abstract/Free Full Text]
  23. Dunn SL, Bjornholm M, Bates SH, Chen Z, Seifert M, Myers Jr MG 2005 Feedback inhibition of leptin receptor/Jak2 signaling via Tyr1138 of the leptin receptor and suppressor of cytokine signaling 3. Mol Endocrinol 19:925–938[Abstract/Free Full Text]
  24. Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura H, Torisu T, Chien KR, Yasukawa H, Yoshimura A 2004 Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity. Nat Med 10:739–743[CrossRef][Medline]
  25. Howard JK, Cave BJ, Oksanen LJ, Tzameli I, Bjorbaek C, Flier JS 2004 Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3. Nat Med 10:734–738[CrossRef][Medline]
  26. Ueki K, Kondo T, Tseng Y-H, Kahn CR 2004 Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad Sci USA 101:10422–10427[Abstract/Free Full Text]
  27. Steinberg GR, Smith AC, Wormald S, Malenfant P, Collier C, Dyck DJ 2004 Endurance training partially reverses dietary-induced leptin resistance in rodent skeletal muscle. Am J Physiol 286:E57–E63
  28. Henry RR, Ciaraldi TP, Abrams-Carter L, Mudaliar S, Park KS, Nikoulina SE 1996 Insulin-dependent diabetes mellitus subjects. Biochemical and molecular mechanisms. J Clin Invest 98:1231–1236[Medline]
  29. Gaster M, Rustan AC, Aas V, Beck-Nielsen H 2004 Reduced lipid oxidation in skeletal muscle from type 2 diabetic subjects may be of genetic origin: evidence from cultured myotubes. Diabetes 53:542–548[Abstract/Free Full Text]
  30. Ukropcova B, McNeil M, Sereda O, de Jonge L, Xie H, Bray GA, Smith SR 2005 Dynamic changes in fat oxidation in human primary myocytes mirror metabolic characteristics of the donor. J Clin Invest 115:1934–1941[CrossRef][Medline]
  31. Chen MB, McAinch AJ, Macaulay SL, Castelli LA, O’Brien P E, Dixon JB, Cameron-Smith D, Kemp BE, Steinberg GR 2005 Impaired activation of AMP-kinase and fatty acid oxidation by globular adiponectin in cultured human skeletal muscle of obese type 2 diabetics. J Clin Endocrinol Metab 90:3665–3672[Abstract/Free Full Text]
  32. McIntyre EA, Halse R, Yeaman SJ, Walker M 2004 Cultured muscle cells from insulin-resistant type 2 diabetes patients have impaired insulin, but normal 5-amino-4-imidazolecarboxamide riboside-stimulated, glucose uptake. J Clin Endocrinol Metab 89:3440–3448[Abstract/Free Full Text]
  33. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW 2000 Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem 285:194–204[CrossRef][Medline]
  34. Watt MJ, Steinberg GR, Chen ZP, Kemp BE, Febbraio MA 2006 Fatty acids stimulate AMP-activated protein kinase and enhance fatty acid oxidation in L6 myotubes. J Physiol 574(Pt 1):139–147
  35. Chen X-P, McConell GK, Michell BJ, Snow RJ, Canny BJ, Kemp BE 2000 AMPK signaling in contracting human skeletal muscle: acetyl-CoA carboxylase and NO synthase phosphorylation. Am J Physiol 279:E1202–E1206
  36. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM 1995 Weight reducing effects of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  37. Frederich RC, Lollmann B, Hamann A, Napolitano-Rosen A, Kahn BB, Lowell BB, Flier JS 1995 Expression of ob mRNA and its encoded protein in rodents: Impact of nutrition and obesity. J Clin Invest 96:1658–1663[Medline]
  38. Heymsfield SB, Greenberg AS, Fujioka K, Dixon RM, Kuschner R, Hunt T, Lubina JA, Patane J, Self B, Hunt P, McCamish M 1999 Recombinant leptin for weight loss in obese and lean adults: a randomized, controlled, dose-escalation trial. JAMA 282:1568–1575[Abstract/Free Full Text]
  39. Tartaglia L, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J, Muir C, Sanker S, Moriarty A, Moore KJ, Smutko JS, Mays GG, Woolf EA, Monroe CA, Tepper RI 1995 Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263–1271[CrossRef][Medline]
  40. Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG, Kemp BE, Kiens B, Richter EA 2003 Regulation of 5'AMP-activated protein kinase activity and substrate utilization in exercising human skeletal muscle. Am J Physiol 284:E813–E822
  41. Koistinen HA, Galuska D, Chibalin AV, Yang J, Zierath JR, Holman GD, Wallberg-Henriksson H 2003 5-amino-imidazole carboxamide riboside increases glucose transport and cell-surface GLUT4 content in skeletal muscle from subjects with type 2 diabetes. Diabetes 52:1066–1072[Abstract/Free Full Text]
  42. Starr R, Wilson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA, Hilton DJ 1997 A family of cytokine-inducible inhibitors of signalling. Nature 387:917–921[CrossRef][Medline]
  43. Pradhan AD, Manson JE, Rifai N, Buring JE, Ridker PM 2001 C-reactive protein, interleukin-6 and risk of developing type 2 diabetes mellitus. JAMA 286:327–334[Abstract/Free Full Text]
  44. Febbraio MA, Pedersen BK 2002 Muscle-derived interleukin-6: mechanisms for activation and possible biological roles. FASEB J 16:1335–1347[Abstract/Free Full Text]
  45. Rieusset J, Bouzakri K, Chevillotte E, Ricard N, Jacquet D, Bastard J-P, Laville M, Vidal H 2004 Suppressor of cytokine signaling 3 expression and insulin resistance in skeletal muscle of obese and type 2 diabetic patients. Diabetes 53:2232–2241[Abstract/Free Full Text]
  46. Kubaszek A, Pihlajamaki J, Punnonen K, Karhapaa P, Vauhkonen I, Laakso M 2003 The C-174G promoter polymorphism of the IL-6 gene affects energy expenditure and insulin sensitivity. Diabetes 52:558–561[Abstract/Free Full Text]
  47. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med 8:1288–1295[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Physiol. Rev.Home page
G. R. Steinberg and B. E. Kemp
AMPK in Health and Disease
Physiol Rev, July 1, 2009; 89(3): 1025 - 1078.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
S. B. Jorgensen, J. Honeyman, J. S. Oakhill, D. Fazakerley, J. Stockli, B. E. Kemp, and G. R. Steinberg
Oligomeric resistin impairs insulin and AICAR-stimulated glucose uptake in mouse skeletal muscle by inhibiting GLUT4 translocation
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E57 - E66.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
G. Yang, L. Badeanlou, J. Bielawski, A. J. Roberts, Y. A. Hannun, and F. Samad
Central role of ceramide biosynthesis in body weight regulation, energy metabolism, and the metabolic syndrome
Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E211 - E224.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
N. Cook, S. A. Fraser, M. Katerelos, F. Katsis, K. Gleich, P. F. Mount, G. R. Steinberg, V. Levidiotis, B. E. Kemp, and D. A. Power
Low salt concentrations activate AMP-activated protein kinase in mouse macula densa cells
Am J Physiol Renal Physiol, April 1, 2009; 296(4): F801 - F809.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. L. Mullen, J. Pritchard, I. Ritchie, L. A. Snook, A. Chabowski, A. Bonen, D. Wright, and D. J. Dyck
Adiponectin resistance precedes the accumulation of skeletal muscle lipids and insulin resistance in high-fat-fed rats
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R243 - R251.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
K. Begriche, P. Letteron, A. Abbey-Toby, N. Vadrot, M.-A. Robin, A. Bado, D. Pessayre, and B. Fromenty
Partial leptin deficiency favors diet-induced obesity and related metabolic disorders in mice
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E939 - E951.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Wei, K. Chen, A. T. Whaley-Connell, C. S. Stump, J. A. Ibdah, and J. R. Sowers
Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R673 - R680.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
B. Guerra, A. Santana, T. Fuentes, S. Delgado-Guerra, A. Cabrera-Socorro, C. Dorado, and J. A. L. Calbet
Leptin receptors in human skeletal muscle
J Appl Physiol, May 1, 2007; 102(5): 1786 - 1792.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinberg, G. R.
Right arrow Articles by Kemp, B. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity
Related Collections
Right arrow Metabolism
Right arrow Obesity

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals