help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-2514
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 8 3208-3214
Copyright © 2006 by The Endocrine Society

Differential Zonal Expression and Adrenocorticotropin Regulation of Secreted Protein Acidic and Rich in Cysteine (SPARC), a Matricellular Protein, in the Midgestation Human Fetal Adrenal Gland: Implications for Adrenal Development

Hitoshi Ishimoto, David G. Ginzinger, Tadashi Matsumoto, Yoshihisa Hattori, Masataka Furuya, Kazuhiro Minegishi, Mamoru Tanaka, Yasunori Yoshimura and Robert B. Jaffe

Department of Obstetrics, Gynecology and Reproductive Sciences (H.I., R.B.J.), Center for Reproductive Sciences, and Comprehensive Cancer Center (D.G.G.), University of California, San Francisco, San Francisco, California 94143; and Department of Obstetrics and Gynecology (H.I., T.M., Y.H., M.F., K.M., M.T., Y.Y.), Keio University School of Medicine, Tokyo, Japan 160-8582

Address all correspondence and requests for reprints to: Robert B. Jaffe, M.D., Center for Reproductive Sciences, 1450 HSW, Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Context: Matricellular proteins are a group of secreted, multifunctional extracellular matrix glycoproteins that includes thrombospondins (TSPs), tenascin-C, and secreted protein acidic and rich in cysteine (SPARC). They may be implicated in the dynamic developmental processes of the human fetal adrenal (HFA) in which the outer, definitive zone (DZ) cells are postulated to proliferate, migrate centripetally, differentiate, and populate the inner, steroidogenic fetal zone (FZ).

Objective: The objective of the study was to identify a matricellular molecule that likely plays a major role in HFA development.

Design: Studies involved RNA, cryosections, and cell cultures from 14- to 23-wk HFAs and human adult adrenal RNA.

Main Outcome Measures: Measures included transcripts encoding matricellular proteins, using real-time quantitative RT-PCR; SPARC localization by immunostaining; and ACTH regulation of SPARC expression and secretion by quantitative RT-PCR and Western blot.

Results: SPARC HFA mRNA was 100-, 700-, and 300-fold higher than TSP-1, TSP-2, and tenascin-C mRNA, respectively. HFA SPARC mRNA was 3-fold higher than adult adrenals (P < 0.005), comparable with levels in adult brain (positive control), whereas mRNAs encoding TSP-1 and TSP-2 were lower in fetal than adult adrenals. SPARC immunoreactivity was detected exclusively in the FZ, not DZ. ACTH, a key regulator of HFA growth and function, increased SPARC mRNA (by 1.7-fold at 1 nM, 48 h, P < 0.05) in isolated FZ cells but not DZ cells. ACTH up-regulation of SPARC protein was also detected in FZ cell lysates and culture medium.

Conclusions: Results suggest a possible role for SPARC in development of functional and/or structural zonation of the HFA.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE FETAL ADRENAL gland plays a critical role in fetomaternal interactions, preparation for extrauterine life, and parturition in several species (1). The structure of the human fetal adrenal (HFA) differs from that of the adult; the inner, fetal zone (FZ) accounts for the bulk (80–90%) of the organ, and the outer, definitive zone (DZ) is subjacent to the capsule, occupies the remainder of the adrenal, and comprises a narrow band of tightly packed small cells surrounding the FZ. Later in gestation, we described the appearance of a third zone, the transitional zone, between the DZ and FZ, having the capacity to synthesize cortisol (2). From early in development (6–8 wk), FZ cells express P450 cholesterol side-chain cleavage enzyme and 17{alpha}-hydroxylase/17, 20 lyase (P450c17), permitting synthesis of large amounts of dehydroepiandrosterone sulfate, a substrate for placental estrogen synthesis. The cells lack 3ß-hydroxysteroid dehydrogenase, however, and thus are not capable of synthesizing glucocorticoids or mineralocorticoids from cholesterol or pregnenolone. The role of the DZ is largely unknown. Before the third trimester, the DZ cells express only P450 cholesterol side-chain cleavage enzyme and do not have the capacity to produce steroids (3). We have suggested that DZ cells may comprise a progenitor population, some of which may proliferate, migrate centripetally, differentiate, and populate the rest of the gland (1, 2). In the central portion of the gland, differentiated FZ cells die by apoptosis (4, 5). We sought zone-specific markers to understand the complex developmental signals involved in ontogeny of the HFA. We identified several zone-specific molecules including CD56 (neural cell adhesion molecule) as a DZ cell marker (6) and low-density lipoprotein receptor (LDL-R) as a cell surface marker on FZ cells (7), likely associated with development and function of the HFA that should be useful for zone-specific studies. Thus, the development of the HFA likely involves zone-regulated cell proliferation, centripetal cell migration, and differentiation as reflected by differential zonal expression of steroidogenic enzymes.

A growing body of evidence indicates that the extracellular microenvironment can orchestrate functions such as cell proliferation, migration, differentiation, and apoptosis, essential components of organogenesis (8). Recently Chamoux et al. (9) described the spatial distribution of several structural components of the extracellular matrix (ECM) including fibronectin, laminin, and collagen IV in the HFA and determined their possible role in cell morphology and steroidogenesis (10). Matricellular proteins, a term coined by Bornstein (11), are another class of ECM proteins. They are secreted macromolecules; interact with cell surface receptors, ECM, growth factors, and/or proteases; but do not themselves subserve strictly structural roles, unlike other ECM proteins such as fibronectin and laminin. Matricellular proteins disrupt cell-matrix interactions and are associated with tissue remodeling, morphogenesis, and vascular growth (12, 13, 14, 15). The group includes thrombospondins (TSPs), tenascin-C (TNC), and secreted protein acidic and rich in cysteine (SPARC). In the adult bovine adrenal, Feige and colleagues (16, 17, 18) described abundant expression of TSP-2 in the external zones of the cortex and ACTH control of TSP-2 expression. However, there are few data concerning expression and regulation of matricellular proteins in the primate fetal adrenal gland.

Therefore, we sought to identify a matricellular protein that may play a potentially important role in the development of the HFA. Here we demonstrate that, among the group of ECM proteins studied, SPARC appears to satisfy the general requirements for such a candidate, with its abundant expression in the HFA, unique FZ-specific localization, and regulation by ACTH, the primary regulator of HFA development and function.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Tissue preparation and reagents

Adrenal glands were obtained from human fetuses (14–23 wk gestation) after elective termination of pregnancy. Gestational age was estimated by foot length. There were no known fetal abnormalities. The study protocol was approved by the Committee on Human Research, University of California, San Francisco. Adrenal glands were collected and placed in ice-cold medium for primary cell culture, in RNA Later (Ambion, Austin, TX) for RNA extraction, in 4% paraformaldehyde in PBS for histological examinations, or snap-frozen for laser capture microdissection studies. Human ACTH [ACTH-(1–24); Cortrosyn] was obtained from Organon (West Orange, NJ). 8-Bromoadenosine cAMP (8-Br-cAMP) and forskolin were purchased from Sigma (St. Louis, MO). Human adult adrenal tissue lysates were obtained from Pierce Biotechnology (Rockford, IL). Human SPARC protein was from Hematologic Technologies (Essex Junction, VT).

RNA isolation and real-time quantitative RT-PCR (qRT-PCR)

Total RNA extraction from HFAs was performed using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Human adult adrenal and brain total RNA was obtained from archival material isolated from operative specimens in our previous studies (4, 19) and a commercial source (BD Biosciences, San Diego, CA). Isolated RNA was further purified with a RNeasy minikit (QIAGEN, Valencia, CA) followed by use of their DNase. Total RNA from primary culture cells and cells captured by laser capture microdissection was isolated and purified with a RNeasy minikit and DNase treatment. Purity and integrity of the RNA were evaluated spectroscopically and by gel electrophoresis before reverse transcription. Reverse transcription reactions with random primers were performed with Omniscript reverse transcriptase (QIAGEN) under conditions described by the supplier. Expression of TSP-1, TSP-2, TNC, SPARC, the ACTH receptor (ACTH-R), LDL-R, and P450c17 was analyzed using the 5' nuclease assay (real-time TaqMan RT-PCR) as we have described previously (6, 20).

The levels of expression of each gene were normalized using ß-glucuronidase (GUS) levels after the comparative threshold cycle method (20, 21). Sequences for the PCR primers and TaqMan fluorogenic probes were: TSP-1 forward, GCTCCAATGCCACAGTTCCT, and reverse, ACTCGGACCATGGAGACCAG; TaqMan probe, FAM (6-carboxy-fluorescein)-CTCGCTGTTGGCCCAGCGACTC-TAMRA (6-carboxytetramethyl-rhodamine), TSP-2 forward, TGGAAGATATTCTAAGCAAGAAGGGT, and reverse, CGGTGGTGACATGCGGA; TaqMan probe, FAM-AGGCCAGGGAGCTGAGATCAACGC-TAMRA, TNC forward, TGGTGTCTTCCCTGAGGGAG, and reverse, TGCTGAAGTTGCCCCGAC; TaqMan probe, FAM-CCTGCCACAGGCCGCTTGGAC-TAMRA, SPARC forward, ATGAGGACAACAACCTTCTGACTG, and reverse, GGTGGTCTCCTGCCTCCAG; TaqMan probe, FAM-CAGAAGCTGCGGGTGAAGAAGATCCA-TAMRA, ACTH-R forward, CAAGTTTCCGTGAAGTCAAGTCC, and reverse, CGAGTTGATAATGTGCTTCATTTCTC; TaqMan probe, FAM-ACATCCCCGCCTTAACCACAAGCA-TAMRA, P450c17 forward, TGGAGACCACCACCTCTGTG, and reverse, GGAGGAGACGGTTACGGTCA; and TaqMan probe, FAM-CCTGCTGCACAATCCTCAGGTGAAGA-TAMRA. All primers and probes, except for those for LDL-R, were purchased from Integrated DNA Technologies (Coralville, IA). The set of primers and TaqMan probe for LDL-R were obtained from Applied Biosystems (Foster City, CA).

Immunofluorescence studies

Ten-micrometer frozen sections were prepared from HFAs and processed for immunofluorescence and subsequent imaging analysis as previously described (6). Primary antibody incubation was performed with a 1:50 dilution of goat antihuman SPARC polyclonal antibody (R&D Systems, Minneapolis, MN), a combination of the anti-SPARC antibody and a 1:30 dilution of rabbit antihuman LDL-R (Research Diagnostics, Flanders, NJ), or a combination of the anti-SPARC antibody and 1:10 dilution of mouse anti-CD56 monoclonal antibody (Leu-19; BD Biosciences, San Jose, CA), for 1 h at room temperature. After washing, incubation with Cy3-conjugated rabbit antigoat antibody (Jackson Laboratories, West Grove, PA) was performed at room temperature for 30 min for SPARC localization. Cy3-conjugated donkey antirabbit and fluorescein isothiocyanate-conjugated donkey antigoat antibodies (Jackson Laboratories) were used to detect staining for LDL-R and SPARC, respectively. Fluorescein isothiocyanate-conjugated donkey antimouse and Cy3-conjugated donkey antigoat antibodies (Jackson Laboratories) were used to detect staining for CD56 and SPARC, respectively. After washing, slides were mounted with VectorShield mounting medium (Vector Laboratories, Inc., Burlingame, CA). Slides were examined with a DMR fluorescent microscope (Leica, Québec, Canada). Image capture was performed with a DCS 430 digital camera (Eastman Kodak Co., Rochester, NY). Confocal microscopy was performed using a 510 META laser scanning microscope (Carl Zeiss, New York, NY). Control sections were stained with appropriate species-specific IgG or serum. Background staining using these controls under the conditions described above was minimal.

Fetal adrenal cortical cell culture

The capsule with the adherent DZ was carefully peeled away from the HFA to separate the DZ from the FZ as described previously (22). Cells in the separated zones were dispersed by enzymatic digestion and plated on plastic culture dishes (Falcon, Los Angeles, CA) at a density of approximately 25,000 cells/cm2. Culture medium consisted of a 1:1 (vol/vol) mixture of DMEM H-16 and Ham’s F-12 with 10% fetal calf serum, 2 mM glutamine, and antibiotics. Cells were incubated at 37 C in a humidified environment consisting of 5% CO2 in air. After 48 h in culture, the medium was changed to one containing 2% fetal calf serum, and nonadherent cells were removed. At the initiation of experiments (usually 96 h after plating), the medium was renewed, and test substances were added in the doses shown in the figures. For studies of the regulation of SPARC protein, only FZ cells were used because they were more abundant. All experiments were replicated on adrenal cortical cells obtained from at least three different fetuses.

Western blot analysis

FZ cells were solubilized in PBS-based radioimmunoprecipitation assay buffer as described elsewhere (23). FZ cell-conditioned medium samples were concentrated approximately 5-fold using Centricon-10 apparatuses (Millipore, Bedford, MA). The protein concentrations were measured by the BCA assay kit (Pierce). Proteins were separated by electrophoresis on a 4–12% gradient gel (NuPAGE BIS-Tris electrophoresis system; Invitrogen) under reducing conditions and transferred onto electroblotted polyvinylidene difluoride membranes as described previously (23). After incubation with anti-SPARC antibody (goat polyclonal, 1:750) for 1 h, followed by a secondary antibody (donkey antigoat IgG horseradish-peroxidase-conjugated antibody, 1:2000; Santa Cruz Biotechnology, Santa Cruz, CA), the immunoreactive proteins were detected with an enhanced chemiluminescence detection system (Amersham Biosciences, Piscataway, NJ). The same blot was stripped with a ReBlot or Blot Restore kit (Chemicon, Temecula, CA) and reprobed with antiactin antibody (I-19; Santa Cruz). The band intensities were measured using the public domain NIH Image program (version 1.62).

Laser capture microdissection

Laser capture microdissection was performed as described previously (7). Captured cells from the DZ or FZ were immediately processed for RNA extraction.

Statistical analysis

For data obtained in ACTH dose-response experiments, Kruskal-Wallis ANOVA or Friedman’s ANOVA was performed, as specified in the figures. Data between two groups were analyzed by Mann-Whitney U test. P < 0.05 was accepted as significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
TSP-1, TSP-2, TNC, and SPARC mRNA expression in human fetal and adult adrenals

To gain insight into the roles of the matricellular proteins in HFAs, we examined mRNA levels of TSP-1, TSP-2, TNC, and SPARC in human fetal (14–23 wk) and adult adrenal glands. qRT-PCR revealed that mRNA levels of SPARC were 100-, 700-, and 300-fold higher than those of TSP1, TSP2, and TNC, respectively (Fig. 1AGo). The mean SPARC mRNA levels in fetal adrenals were 3.8-fold higher than those in adults (P < 0.005; Fig. 1BGo) and were comparable with that of the adult brain (positive control). Also at the protein level, SPARC expression was higher in the human fetal adrenal than the adult adrenal (Fig. 1CGo). In contrast, the fetal adrenal mRNA levels of TSP-1 and TSP-2 showed lower values than those of adult adrenals (P < 0.005). TSP-1, TSP-2, TNC, and SPARC mRNA levels did not change significantly during midgestation.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
  		FIG. 1. Quantification of TSP-1, TSP-2, TNC, and SPARC mRNA expression in human fetal and adult adrenal glands. A, qRT-PCR was performed on RNA isolated from human fetal (14–23 wk, n = 7) and adult adrenals (n = 4). TSP-1 (open circle), TSP-2 (black triangle), TNC (X), and SPARC (black square) mRNA expression normalized to GUS, an endogenous control. The human adult brain serves as a positive control for expression of the matricellular proteins (values are shown on log scale). B, SPARC mRNA levels in fetal and adult adrenals. *, P < 0.005. C, Western blot analysis of SPARC protein in human fetal and adult adrenals. Immunoblot was performed using tissue lysate of a 20-wk human fetal adrenal and human adult adrenal tissue lysate from a commercial source (Pierce). Protein (10 µg/lane) was loaded in right two lanes. Human SPARC protein (10 ng) was used as a positive control (PC). Equal loading of protein was confirmed by probing for actin. Densitometric analysis showed 2.8-fold higher expression of SPARC protein in the fetal adrenal than the adult. The blot shown is representative of two experiments with similar results.

 
SPARC protein localization

Based on the aforementioned results, we focused on SPARC and further localized SPARC protein in the midgestation HFA by immunofluorescence (Fig. 2Go). Strong cytoplasmic staining for SPARC protein was evident specifically in cells of the FZ of the gland (Fig. 2AGo). DZ cells reacted minimally with SPARC antibody. Costaining with a DZ cell marker CD56 (6) or a FZ cell marker LDL-R (7) confirmed the FZ-selective localization of SPARC (Fig. 2Go, B–D). There was no apparent effect of gestational age on the pattern of staining for SPARC over the age range studied (i.e. 18–23 wk).


Figure 2
View larger version (106K):
[in this window]
[in a new window]
  		FIG. 2. SPARC protein expression in the human fetal adrenal gland. A, Immunofluorescence of a 22-wk gestation human fetal adrenal gland showing SPARC staining restricted to the FZ. Note the lack of staining in the narrow band corresponding to the DZ. B, Labeling for SPARC (red) and CD56 (green), a DZ cell marker, in a 21-wk human fetal adrenal gland, illustrating the lack of SPARC immunoreactivity in the DZ. C and D, Labeling for SPARC and LDL-R, a FZ cell marker, on an 18-wk human fetal adrenal gland, illustrating FZ-specific localization of SPARC. Note costaining for LDL-R on the membrane (red) and SPARC protein (green) in the cytoplasm in FZ cells. Original magnification, x100 (A and C) and x200 (B and D).

 
Regulation of SPARC expression and secretion by ACTH

To determine whether ACTH regulates SPARC gene expression, HFA cortical cells were treated with ACTH (Fig. 3Go). Treatment of FZ cells with increasing concentrations of ACTH for 48 h resulted in a moderate, but significant, increase in SPARC mRNA (P < 0.05, by Friedman’s ANOVA; Fig. 3AGo). The action of ACTH on cultured FZ cells was confirmed by assessing its effects on the abundance of P450c17 mRNA, which is up-regulated by ACTH (1). ACTH regulated SPARC mRNA expression differentially in cultured FZ and DZ cells. In FZ cells, a significant 1.7-fold increase in SPARC mRNA levels was detected after 48 h of ACTH (1 nM) treatment (Fig. 3BGo). In contrast, these effects of ACTH on the abundance of SPARC mRNA were not observed in DZ cells. ACTH treatment for 4–24 h did not increase SPARC mRNA in FZ cells (Fig. 3BGo and data not shown). Forskolin or 8-Br-cAMP mimicked the effects of ACTH on the accumulation of mRNA encoding SPARC and P450c17 (Fig. 4Go).


Figure 3
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 3. A, Dose-dependent effect of ACTH on SPARC and P450c17 mRNA levels. Isolated human fetal adrenal cortical cells (FZ cells) were treated with various concentrations of ACTH for 48 h. Total RNA was extracted and analyzed by qRT-PCR. Constitutively expressed GUS mRNA levels served as normalization controls. Data shown are mean ± SE of three independent experiments on cells derived from different fetuses. SPARC and P450c17 mRNA levels were increased after exposure to ACTH for 48 h in a dose-dependent manner (P < 0.05 and P < 0.01, respectively, based on Friedman’s ANOVA). B, Time-dependent effect of ACTH on SPARC mRNA levels. Isolated FZ cells (left panel) or DZ cells (right panel) were treated with ACTH (1 nM) for 24 or 48 h. Each bar represents mean ± SE of four independent experiments using different fetal adrenals. Black and white bars indicate ACTH-treated and time-matched, unstimulated control cells, respectively. *, P < 0.05 vs. control (without ACTH treatment).

 

Figure 4
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. Effects of forskolin and 8-Br-cAMP on SPARC mRNA levels. FZ cells isolated from human fetal adrenals were exposed to forskolin (F; 1 µM) or 8-Br-cAMP (Br; 1 mM) for 48 h. GUS-normalized data (mean ± SE) are from four independent experiments using different fetal adrenals. *, P < 0.05, **, P < 0.01 vs. unstimulated, time-matched controls (Co).

 
To determine whether up-regulation of SPARC mRNA by ACTH was accompanied by an increase in protein synthesis, FZ cells were cultured in media without or with various concentrations of ACTH for 48 h, and cell lysates were analyzed for SPARC protein by immunoblotting. After exposure to ACTH for 48 h, SPARC protein levels were increased (Fig. 5AGo). The effects of ACTH on SPARC protein levels were mimicked by 8-Br-cAMP (Fig. 5BGo). In addition, ACTH or 8-Br-cAMP augmented SPARC secretion by HFA cortical cells into the culture medium (Fig. 5CGo).


Figure 5
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 5. Western blot analysis of SPARC protein in cultured human fetal adrenal cortical cells (FZ cells) and conditioned medium. A, The cells were incubated with basal media or in the presence of different concentrations of ACTH (0.001–10 nM) for 48 h. Total cell protein was analyzed by immunoblot. Fifty micrograms of protein were loaded per lane. Data (mean ± SE) are the densitometric units of SPARC relative to actin from three experiments using different fetal adrenals. The relative ratio of unstimulated cells (control) is arbitrarily presented as 1. SPARC protein levels in cell lysates were increased after exposure to ACTH for 48 h in a dose-dependent manner (P < 0.05, based on Kruskal-Wallis ANOVA). A representative blot from a 21-wk-old human fetal adrenal is shown above. B, Exposure to 8-Br-cAMP (Br; 1 mM) for 48 h increased abundance of SPARC protein in cell lysates (50 µg protein/lane), mimicking the effects of ACTH (Ac; 1 nM). The summary of densitometric evaluation of three independent experiments is shown below. Data (mean ± SE) are the densitometric units of SPARC relative to actin, and the relative ratio of the control (Co; unstimulated cells) is arbitrarily presented as 1. A representative blot from a 19-wk-old human fetal adrenal is shown above. C, Exposure to 8-Br-cAMP (Br; 1 mM) for 48 h increased SPARC secretion into the conditioned medium, mimicking the effects of ACTH (Ac; 1 nM). Total protein (150 µg protein) was loaded in each lane, and equal loading was confirmed by the Ponceau S staining. Densitometry is shown for three experiments using different fetal adrenals, with a representative blot from a 22-wk-old human fetal adrenal. The relative ratio of the control (Co; unstimulated cells) is arbitrarily presented as 1. *, P < 0.05, **, P < 0.01, based on Mann-Whitney U test in comparison with respective control (unstimulated cells).

 
Zonal expression of SPARC, ACTH-R, LDL-R, and P450c17

ACTH increased SPARC expression in isolated FZ cells but not DZ cells. The different responses to ACTH by FZ and DZ cells, consistent with the zonal differential expression of ACTH-R, may in part explain this phenomenon and thus the FZ-specific SPARC expression in vivo. However, conflicting data exist concerning the zonal expression pattern of ACTH-R in the HFA (22). To address this issue in a more quantitative and spatially accurate fashion, we used laser capture microdissection and qRT-PCR, which demonstrated that mRNA levels of ACTH-R and SPARC were 2.5- and 1.4-fold higher in the FZ than the DZ of the HFA at midgestation, respectively (Fig. 6Go). As expected, the zonal expression patterns of FZ cell markers, LDL-R and P450c17, were similar to those of ACTH-R and SPARC.


Figure 6
View larger version (31K):
[in this window]
[in a new window]
  		FIG. 6. Zonal expression of mRNAs encoding SPARC, ACTH-R, LDL-R, and P450c17. Outer, DZ and inner, FZ cells in the midgestation HFA (18–22 wk) were collected using laser capture microdissection. Total RNA was extracted from cells of the respective zones and analyzed by qRT-PCR as described in Materials and Methods. GUS-normalized data are shown. SPARC, ACTH-R, LDL-R, and P450c17 mRNA levels were observed primarily in the FZ (black bars), compared with those of the DZ (white bars).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Organogenesis is a coordinated process involving cell proliferation, differentiation, adhesion, and migration. Recent studies (13, 14, 15) indicate that matricellular proteins, a subgroup of extracellular matrix components that function as adaptors and modulators of cell-matrix interactions, may be involved in these developmental processes. Here we describe the expression profiles of transcripts encoding matricellular proteins in human fetal and adult adrenals for the first time and propose that SPARC may be a key molecule among the family of matricellular proteins that appear to play a role in HFA development.

We present quantitative data on TSP-1, TSP-2, TNC, and SPARC expression in human fetal and adult adrenal glands using real-time qRT-PCR. Markedly higher levels of transcript expression of SPARC were detected in the midgestation HFA than the other matricellular family members (TSP-1, TSP-2, and TNC). SPARC mRNA levels in the HFA were much higher than in adult adrenals, whereas levels of mRNA encoding the other matricellular proteins were lower in the HFA than the adult adrenal gland. These results suggest that SPARC may be implicated in HFA development and merit further investigation.

The matricellular protein, SPARC, also known as osteonectin and BM-40, is spatially and temporally regulated during development (24, 25). High levels of SPARC expression were found in somites, invasive cells of extraembryonic tissue, and developing bones and teeth, whereas SPARC in the adult was generally limited to tissues exhibiting high rates of cellular proliferation, tissue repair, and remodeling (13, 26). In the adult murine adrenal, SPARC mRNA expression was confined to the zona fasciculata and is almost absent in the zonae glomerulosa and reticularis and the medulla (24). Mundlos et al. (27) reported that SPARC localization in the HFA was restricted to the FZ in 7- to 12-wk gestation fetuses. The results in the present study using HFAs at midgestation are consistent with their observations. Double immunostaining with a DZ cell marker, CD56 (6), or a FZ cell marker, LDL-R (7), revealed FZ-specific SPARC localization in the midgestation HFA. Viewed from a different perspective, these results suggest that SPARC can be a useful FZ cell marker. The description of novel cell markers associated with specific zones of the HFA should aid in the further definition of the role of these cells and their products in the developmental processes extant in the HFA.

Our current study also demonstrates that ACTH can regulate SPARC expression and secretion in primary cultures of FZ cells. ACTH is the major drive for the development and function of the HFA (1). Besides its well-documented acute and chronic effects on steroidogenesis, it also drives the developmental organization of this tissue. Our in vitro studies revealed that the magnitude of up-regulation of SPARC by ACTH was only moderate. Whether ACTH also modulates SPARC expression in vivo remains unclear. Because our results showed that the baseline SPARC mRNA levels in isolated FZ cells were lower than those for the FZ in vivo (Figs. 1AGo, 3AGo, and 4Go), there appears to be a mechanism that up-regulates or maintains fetal zone SPARC expression in the in vivo setting. ACTH could be part of this mechanism. In the current study, SPARC mRNA levels were increased only after 48 h of ACTH treatment, suggesting that this 48-h increase of SPARC mRNA could be a secondary effect caused by some ACTH-inducible factor(s), necessitating future studies on regulation of SPARC expression in fetal adrenals.

The mechanism(s) directing FZ-specific SPARC expression remain to be clarified. One possibility is that the zonal pattern of the ACTH-R may be involved. The current study demonstrates that ACTH augmented SPARC expression in isolated FZ cells but not DZ cells. In addition, laser capture microdissection together with qRT-PCR reveals that in vivo ACTH-R mRNA levels as well as those of SPARC are higher in the FZ than the DZ. In the human fetus, both the DZ and FZ should be exposed to comparable levels of circulating ACTH. Therefore, the zonal differential expression of the ACTH-R may explain the differential ACTH regulation of SPARC expression observed in FZ and DZ cells, provided that ACTH-R mRNA is translated into functional protein. This interpretation is in accordance with the concept that the DZ cells are not responsive to ACTH, as evidenced by both in vivo and in vitro studies (1, 28). However, in a previous study using in situ hybridization, we demonstrated that ACTH-R mRNA expression levels, as judged by hybridization signal intensities, were highest in the outermost zones (i.e. the DZ) and decreased in the more central areas of the HFA at midgestation (22). Similar results were obtained by Aberdeen et al. in the baboon fetal adrenal gland (29).

Although these results suggested that DZ cells are more responsive to ACTH, one of the pitfalls in using in situ hybridization for determining spatial transcript expression levels is that hybridization signals depend on cell density and size. Because cells in the DZ are more tightly packed and much smaller than in the FZ, this might affect hybridization signal intensities. Therefore, we set out to revisit this issue in the present study and determined the zonal pattern of ACTH-R mRNA with laser capture microdissection coupled with qRT-PCR techniques that we believe are more sensitive and quantitatively reliable for this purpose. Further studies of ACTH-R protein are warranted, although, as Beuschlein et al. (30) pointed out, this has been hampered by lack of availability of reliable antibodies against human ACTH-R. Second, the FZ-specific localization of SPARC may be associated with its role in differentiation. This is possible because the FZ is a highly specialized structure that synthesizes dehydroepiandrosterone sulfate. Consistent with this possibility, SPARC has exhibited extensive expression during the terminal differentiation of cultured human keratinocytes (31) and in terminally differentiated retinal ganglion cells in vivo (32). Alternatively, there may be involvement of additional factors that differentially regulate SPARC protein expression in the DZ and FZ. Because the current study shows that SPARC mRNA levels are only slightly higher in the FZ than the DZ despite the FZ-specific protein localization, posttranscriptional regulation of SPARC by a factor that exerts its effects in a FZ-specific manner may explain this discrepancy of expression levels of SPARC protein and its transcript. Further studies are required to address this point.

In addition to its possible association with fetal adrenal cortical cell differentiation, there are several possible roles that SPARC may play in the HFA. SPARC modulates cell proliferation and migration (33). In cultured bovine aortic endothelial cells and fibroblasts, SPARC was a potent cell cycle inhibitor that arrested cells in mid-G1 (14, 15, 33, 34). Fibroblasts, mesangial cells, and smooth muscle cells isolated from SPARC-null mice exhibited a higher rate of proliferation than their wild-type counterparts (35). SPARC inhibited the proliferation of endothelial, smooth muscle, mesangial, and fibroblast cells stimulated in vitro with various growth factors and fetal bovine serum (35, 36). SPARC also reduced the proliferative and migratory effects of basic fibroblast growth factor on endothelial cells (37). Thus, SPARC may exert an antiproliferative and antimigratory effect, reflected by the selective expression of SPARC in the FZ, in which cell proliferation is less and cell migration should terminate rather than be initiated. In our hands, exogenous recombinant SPARC protein did not show effects on basic fibroblast growth factor-induced proliferation of FZ cells (data not shown), most likely because abundant secretion of endogenous SPARC protein into conditioned medium by FZ cells themselves, as demonstrated by immunoblot in the current study, may have masked effects of the exogenous protein.

In summary, the present study demonstrates that the matricellular protein, SPARC, is highly expressed in the midgestation HFA. Furthermore, results identify SPARC protein, but not its mRNA, as a novel FZ cell-specific cell marker. Such a novel zone-specific cell marker should be useful for extending our knowledge of HFA development and function.


   Acknowledgments
 
We thank Mikiye Nakanishi for technical assistance and Michiyo Ishimoto for assistance with manuscript preparation.


   Footnotes
 
This work was supported by National Institutes of Health Grant HD08478 (to R.B.J.) and Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (to H.I., T.M., Y.H., K.M., M.T., and Y.Y.).

Present address for H.I.: Department of Obstetrics and Gynecology, Keio University School of Medicine, Tokyo, Japan 160-8582.

Present address for D.G.G.: Applied Biosystems, Foster City, California 94401-1105.

Results from this work were presented, in part, at the 87th annual meeting of The Endocrine Society, San Diego, California, June 2005.

None of the authors has anything to declare.

First Published Online May 30, 2006

Abbreviations: ACTH-R, ACTH receptor; 8-Br-cAMP, 8-bromoadenosine cAMP; DZ, definitive zone; ECM, extracellular matrix; FZ, fetal zone; GUS, ß-glucuronidase; HFA, human fetal adrenal; LDL-R, low-density lipoprotein receptor; P450c17, 17{alpha}-hydroxylase/17, 20 lyase; qRT-PCR, real-time quantitative RT-PCR; SPARC, secreted protein acidic and rich in cysteine; TNC, tenascin-C; TSP, thrombospondin.

Received November 17, 2005.

Accepted May 22, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mesiano S, Jaffe RB 1997 Developmental and functional biology of the primate fetal adrenal cortex. Endocr Rev 18:378–403[Abstract/Free Full Text]
  2. Mesiano S, Coulter CL, Jaffe RB 1993 Localization of cytochrome P450 cholesterol side-chain cleavage, cytochrome P450 17{alpha}-hydroxylase/17, 20-lyase, and 3ß-hydroxysteroid dehydrogenase isomerase steroidogenic enzymes in human and rhesus monkey fetal adrenal glands: reappraisal of functional zonation. J Clin Endocrinol Metab 77:1184–1189[Abstract]
  3. Coulter CL, Goldsmith PC, Mesiano S, Voytek CC, Martin MC, Han VK, Jaffe RB 1996 Functional maturation of the primate fetal adrenal in vivo: I. Role of insulin-like growth factors (IGFs), IGF-I receptor, and IGF binding proteins in growth regulation. Endocrinology 137:4487–4498[Abstract]
  4. Spencer SJ, Mesiano S, Lee JY, Jaffe RB 1999 Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. J Clin Endocrinol Metab 84:1110–1115[Abstract/Free Full Text]
  5. Chamoux E, Breault L, Lehoux JG, Gallo-Payet N 1999 Involvement of the angiotensin II type 2 receptor in apoptosis during human fetal adrenal gland development. J Clin Endocrinol Metab 84:4722–4730[Abstract/Free Full Text]
  6. Muench MO, Ratcliffe JV, Nakanishi M, Ishimoto H, Jaffe RB 2003 Isolation of definitive zone and chromaffin cells based upon expression of CD56 (neural cell adhesion molecule) in the human fetal adrenal gland. J Clin Endocrinol Metab 88:3921–3930[Abstract/Free Full Text]
  7. Ratcliffe J, Nakanishi M, Jaffe RB 2003 Identification of definitive and fetal zone markers in the human fetal adrenal gland reveals putative developmental genes. J Clin Endocrinol Metab 88:3272–3277[Abstract/Free Full Text]
  8. Adams JC, Watt FM 1993 Regulation of development and differentiation by the extracellular matrix. Development 117:1183–1198[Medline]
  9. Chamoux E, Bolduc L, Lehoux JG, Gallo-Payet N 2001 Identification of extracellular matrix components and their integrin receptors in the human fetal adrenal gland. J Clin Endocrinol Metab 86:2090–2098[Abstract/Free Full Text]
  10. Chamoux E, Narcy A, Lehoux JG, Gallo-Payet N 2002 Fibronectin, laminin, and collagen IV as modulators of cell behavior during adrenal gland development in the human fetus. J Clin Endocrinol Metab 87:1819–1828[Abstract/Free Full Text]
  11. Bornstein P 1995 Diversity of function is inherent in matricellular proteins: an appraisal of thrombospondin 1. J Cell Biol 130:503–506[Free Full Text]
  12. Sodek J, Zhu B, Huynh MH, Brown TJ, Ringuette M 2002 Novel functions of the matricellular proteins osteopontin and osteonectin/SPARC. Connect Tissue Res 43:308–319[Medline]
  13. Sage EH, Bornstein P 1991 Extracellular proteins that modulate cell-matrix interactions. SPARC, tenascin, and thrombospondin. J Biol Chem 266:14831–14834[Free Full Text]
  14. Bradshaw AD, Sage EH 2001 SPARC, a matricellular protein that functions in cellular differentiation and tissue response to injury. J Clin Invest 107:1049–1054[Medline]
  15. Brekken RA, Sage EH 2000 SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol 19:569–580[CrossRef][Medline]
  16. Danik M, Chinn AM, Lafeuillade B, Keramidas M, Aguesse-Germon S, Penhoat A, Chen H, Mosher DF, Chambaz EM, Feige JJ 1999 Bovine thrombospondin-2: complete complementary deoxyribonucleic acid sequence and immunolocalization in the external zones of the adrenal cortex. Endocrinology 140:2771–2780[Abstract/Free Full Text]
  17. Pellerin S, Lafeuillade B, Wade RH, Savona C, Chambaz EM, Feige JJ 1993 The molecular structure of corticotropin-induced secreted protein, a novel member of the thrombospondin family. J Biol Chem 268:18810–18817[Abstract/Free Full Text]
  18. Pellerin S, Lafeuillade B, Scherrer N, Gagnon J, Shi DL, Chambaz EM, Feige JJ 1993 Corticotropin-induced secreted protein, an ACTH-induced protein secreted by adrenocortical cells, is structurally related to thrombospondins. J Biol Chem 268:4304–4310[Abstract/Free Full Text]
  19. Shifren JL, Doldi N, Ferrara N, Mesiano S, Jaffe RB 1994 In the human fetus, vascular endothelial growth factor is expressed in epithelial cells and myocytes, but not vascular endothelium: implications for mode of action. J Clin Endocrinol Metab 79:316–322[Abstract]
  20. Geva E, Ginzinger DG, Zaloudek CJ, Moore DH, Byrne A, Jaffe RB 2002 Human placental vascular development: vasculogenic and angiogenic (branching and nonbranching) transformation is regulated by vascular endothelial growth factor-A, angiopoietin-1, and angiopoietin-2. J Clin Endocrinol Metab 87:4213–4224[Abstract/Free Full Text]
  21. Ginzinger DG, Godfrey TE, Nigro J, Moore 2nd DH, Suzuki S, Pallavicini MG, Gray JW, Jensen RH 2000 Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis. Cancer Res 60:5405–5409[Abstract/Free Full Text]
  22. Mesiano S, Fujimoto VY, Nelson LR, Lee JY, Voytek CC, Jaffe RB 1996 Localization and regulation of corticotropin receptor expression in the midgestation human fetal adrenal cortex: implications for in utero homeostasis. J Clin Endocrinol Metab 81:340–345[Abstract]
  23. Ishimoto H, Ginzinger DG, Jaffe RB 2006 Adrenocorticotropin preferentially up-regulates angiopoietin-2 in the human fetal adrenal gland: implications for coordinated adrenal organ growth and angiogenesis. J Clin Endocrinol Metab 91:1909–1915[Abstract/Free Full Text]
  24. Holland PW, Harper SJ, McVey JH, Hogan BL 1987 In vivo expression of mRNA for the Ca++-binding protein SPARC (osteonectin) revealed by in situ hybridization. J Cell Biol 105:473–482[Abstract/Free Full Text]
  25. Sage H, Vernon RB, Decker J, Funk S, Iruela-Arispe ML 1989 Distribution of the calcium-binding protein SPARC in tissues of embryonic and adult mice. J Histochem Cytochem 37:819–829[Abstract]
  26. Mason IJ, Taylor A, Williams JG, Sage H, Hogan BL 1986 Evidence from molecular cloning that SPARC, a major product of mouse embryo parietal endoderm, is related to an endothelial cell ‘culture shock’ glycoprotein of Mr 43,000. EMBO J 5:1465–1472[Medline]
  27. Mundlos S, Schwahn B, Reichert T, Zabel B 1992 Distribution of osteonectin mRNA and protein during human embryonic and fetal development. J Histochem Cytochem 40:283–291[Abstract]
  28. Leavitt MG, Albrecht ED, Pepe GJ 1999 Development of the baboon fetal adrenal gland: regulation of the ontogenesis of the definitive and transitional zones by adrenocorticotropin. J Clin Endocrinol Metab 84:3831–3835[Abstract/Free Full Text]
  29. Aberdeen GW, Babischkin JS, Davies WA, Pepe GJ, Albrecht ED 1997 Decline in adrenocorticotropin receptor messenger ribonucleic acid expression in the baboon fetal adrenocortical zone in the second half of pregnancy. Endocrinology 138:1634–1641[Abstract/Free Full Text]
  30. Beuschlein F, Fassnacht M, Klink A, Allolio B, Reincke M 2001 ACTH-receptor expression, regulation and role in adrenocortical tumor formation. Eur J Endocrinol 144:199–206[Abstract]
  31. Ford R, Wang G, Jannati P, Adler D, Racanelli P, Higgins PJ, Staiano-Coico L 1993 Modulation of SPARC expression during butyrate-induced terminal differentiation of cultured human keratinocytes: regulation via a TGFß-dependent pathway. Exp Cell Res 206:261–275[CrossRef][Medline]
  32. Yan Q, Sage EH, Hendrickson AE 1998 SPARC is expressed by ganglion cells and astrocytes in bovine retina. J Histochem Cytochem 46:3–10[Abstract/Free Full Text]
  33. Lane TF, Sage EH 1994 The biology of SPARC, a protein that modulates cell-matrix interactions. FASEB J 8:163–173[Abstract]
  34. Murphy-Ullrich JE, Lane TF, Pallero MA, Sage EH 1995 SPARC mediates focal adhesion disassembly in endothelial cells through a follistatin-like region and the Ca(2+)-binding EF-hand. J Cell Biochem 57:341–350[CrossRef][Medline]
  35. Bradshaw AD, Francki A, Motamed K, Howe C, Sage EH 1999 Primary mesenchymal cells isolated from SPARC-null mice exhibit altered morphology and rates of proliferation. Mol Biol Cell 10:1569–1579[Abstract/Free Full Text]
  36. Raines EW, Lane TF, Iruela-Arispe ML, Ross R, Sage EH 1992 The extracellular glycoprotein SPARC interacts with platelet-derived growth factor (PDGF)-AB and -BB and inhibits the binding of PDGF to its receptors. Proc Natl Acad Sci USA 89:1281–1285[Abstract/Free Full Text]
  37. Hasselaar P, Sage EH 1992 SPARC antagonizes the effect of basic fibroblast growth factor on the migration of bovine aortic endothelial cells. J Cell Biochem 49:272–283[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Pediatric Endocrinology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals