| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Fundación IVI (J.A.H., F.D., A.P., C.S.), Instituto Universitario IVI, University of Valencia, 46022 Valencia, Spain; Department of Pathology (A.M.S., R.D.C., J.R.A.S.), Reproductive Molecular Research Group, University of Cambridge, Cambridge CB2 1TN, United Kingdom; and Génesis Unidad de Fertilidad y Reproducción (L.A.B., A.C., M.R.P.), Instituto Médico La Floresta, Policlínica Metropolitana, 1060 Caracas, Venezuela
Address all correspondence and requests for reprints to: C. Simón, Fundación IVI, Instituto Universitario IVI, University of Valencia, Valencia, Spain. E-mail: csimon{at}ivi.es.
| Abstract |
|---|
|
|
|---|
Objective: The objective of the study was to analyze the endometrial gene expression profile induced by an inert intrauterine device (IUD) at the time of implantation.
Design: We used a microarray containing more than 16,000 cDNAs to investigate the gene expression profile of receptive vs. refractory endometrium in the same women induced by the presence of an IUD. We compared the gene expression profile of endometrium obtained at LH+7 (window of receptivity) from the same women (n = 5) at the following time points: month 1, corresponding to the natural cycle before IUD insertion; month 3, just before IUD removal; and months 5 and 15. Data were validated by quantitative RT-PCR for IGF binding protein-3, peroxisome proliferative activated receptor-
, glycodelin, and leukemia inhibitory factor and immunohistochemistry for glycodelin.
Results: We identified 147 genes significantly dysregulated in the refractory endometrium (78 up- and 69 down-regulated). Interestingly, 52 of these genes have previously been reported to be regulated during window of implantation. Surprisingly, the majority of genes (96.6%) remained dysregulated 2 months after IUD removal, but 1 yr later most of them (80%) returned to normal.
Conclusions: Our results reveal that a refractory endometrium in a fertile woman produced by an IUD is induced by preventing the normal transition to a receptive gene expression profile through effects on a specific subset or cluster of genes that impact on endometrial receptivity.
| Introduction |
|---|
|
|
|---|
In the last 3 yr, several studies (4, 5, 6, 7, 8) investigated the gene expression profile of the human endometrium during the WOI, compared with other phases of the menstrual cycle. These analyses have generated long lists of genes that are up- or down-regulated during this specific period in which the endometrium is receptive (9). However, it is not clear from these studies which of the many genes altered during the WOI are functionally important. Additional strategies have been designed to investigate the genomics of the endometrium in subfertile conditions such as endometriosis (10, 11), RU486 treatment (12, 13), or in patients with controlled ovarian stimulation in in vitro fertilization (14, 15, 16). These approaches have generated indirect evidence of the functional relevance of WOI genes.
Over the past four decades, intrauterine devices (IUDs) have been established as one of the most effective interceptive methods with a typical Pearl index around 0.5 (number of pregnancies per 100 women per year) (17). IUDs induce changes in the endometrium causing refractoriness that prevents embryonic implantation. We hypothesize that the refractoriness induced by the IUD must be due to changes in the WOI endometrial gene expression profile. Until now, only morphology and few studies of individual genes have been reported in the literature using IUDs with levonorgestrel (18, 19). In this work, we investigated the global gene expression profile of the endometrium during the WOI in the same fertile woman, in the presence or absence of an inert IUD. We also analyzed the short- and long-term effect of the IUD on the gene expression pattern of the endometrium.
| Subjects and Methods |
|---|
|
|
|---|
This study was conducted in accordance with the guidelines in The Declaration of Helsinki and was approved by the ethics committee of the institution at which the endometrial biopsies were obtained (Génesis Unidad de Fertilidad y Reproducción, Caracas, Venezuela) and processed (Instituto Valenciano de Infertilidad, Valencia, Spain). Written informed consent was obtained from all patients. Healthy fertile volunteers (aged 2339 yr, with a body mass index between 19 and 25 kg/m2) (n = 5) were monitored as follows: month 1 was a natural cycle before IUD insertion; in month 2, the IUD was inserted; in month 3, the IUD was removed; and from month 4 onward, natural cycles without any intervention were monitored. Endometrial biopsies were obtained at months 1, 3, 5, and 15 (biopsies 1, 2, 3, and 4, respectively) from each woman at LH+7 as determined by assaying the serum LH surge. Transvaginal ultrasound was performed in late follicular phase and early luteal phase to localize the dominant follicle or corpus luteum to assure that ovulation occurred. Patients resumed menstrual cycles consistent with their previous gynecological history. Overall, 18 biopsies (n = 5 at cycle 1, 3, and 5 and n = 3 for endometrial biopsy at cycle 15) were obtained using a Pipelle catheter (Genetics, Namont-Achel, Belgium) under sterile conditions from the uterine fundus. Endometrial dating was performed using the Noyes criteria (20). The inert IUD used in this study (Lippes Loop Intrauterine Double-S; Ortho Pharmaceutical Corp., Raritan, NJ) was chosen because of the absence of any hormone associated that could modify the refractoriness gene expression profile.
Gene expression profiling
Total RNA was extracted from human endometrium using Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturers instructions and treated with RQ1 DNase I (Promega, Southampton, UK) for 30 min at 37 C and then reextracted with Trizol. RNA quality was assessed by loading 300 ng of total RNA onto an RNA Labchip and analyzed on an A2100 bioanalyzer (Agilent Technologies, Waldbronn, Germany).
The microarray was printed on two slides (HMN1 and HMN2). The manufacturing of the slides is described by Rossi et al. (13) and Evans et al. (21). A full list of the cDNAs is available (http://www.path.cam.ac.uk/resources/microarray/microarrays/).
Array hybridization
The generation of the amplified labeled cDNA targets and the chip hybridization was performed using the method of Petalidis et al. (22). The fluorescence signal on the microarrays was acquired by using a Genepix 4100 microarray scanner (Axon Instruments, Foster City, CA). The scanned images were processed by using the GenePix Pro 3.0 software (Axon Instruments).
Statistical analysis
The raw data were normalized per spot and per chip using GeneSpring version 7.0 software with intensity dependent (Lowess) normalization (percent of the data used for smoothing 10%) and per chip normalized to 50th percentile. Low hybridization signals were removed to give an average of 10,000 different RNA transcripts expressed above background. For each cDNA spot on the array, a ratio was derived in which the signal from the test sample (Cy5) was expressed relative to its expression in the Cy3-labeled control sample (same women before IUD) hybridized to the array at the same time. Genes that showed statistically different expression levels were identified by performing pairwise comparisons between the different time points using Welchs t test with Benjamini and Hochberg multiple testing correction. Transcripts with a P < 0.05 were selected for inclusion in Table 1![]()
![]()
. In addition, fold change ratios between groups (i.e. LH+7 pre-IUD vs. LH+7 in the presence of the IUD) were subsequently derived, and up- and down-regulated genes were selected on the basis that they showed a change of at least 3-fold in three of five women and also had an overall median fold change over 2 and a P < 0.05 (23, 24).
|
|
|
To verify the results obtained from the cDNA microarray, real-time PCR (Taqman) was performed for four selected genes: IGF binding protein (IGFBP)-3, peroxisome proliferative activated receptor (PPAR)-
glycodelin (also known as placental protein 14) and leukemia inhibitory factor (LIF). Immunohistochemistry was also performed for glycodelin. It was carried out on endometrial sections using an LSAB peroxidase kit (Dako Corp., Barcelona, Spain) with a protocol previously described (25). It used glycodelin polyclonal antiserum diluted 1:1000 (this antibody was kindly provided by Dr. Koistinen, Helsinki, Finland).
Relative expression levels of each gene in total RNA from endometrium was determined by real-time RT-PCR using specific primers and FAM-labeled probes for each gene: primer sequence (5'-3') for IGFBP-3 forward, GCACAGATACCCAGAACTTCTCC, reverse, CAGGTGATTCAGTGTGTCTTCCA, and probe, AGACAGAATATGGTCCCTGCCGCA; PPAR
forward, CAGAGCAAAGAGGTGGCCAT, reverse, GCTTTTGGCATACTCTGTGATCTC, and probe, CATCTTTCA-GGGCTGCCAGTTTCGC; glycodelin forward, TGGTCTGTGGTGT-CCCGG, reverse, AGGGAGATGTTGTTGGTCGC, and probe, ACATC-CCCCAGACCAAGCAGGACCT. LIF transcript levels were measured using primers provided as an assay on demand (Applied Biosystems, Warrington, UK). Primers were labeled with 5'FAM and 3'TAMRA. Real-time PCR was performed using an ABI PRISM 7700 sequence detection system (TaqMan) according to the manufacturers instructions (Applied Biosystems). cDNA was produced from each RNA sample by reverse transcription with random hexamers using 5 µg of total RNA with 200 IU Superscript RT (Invitrogen Life Technologies). The expression values obtained were normalized against those from the control ribosomal 18S to account for differing amounts of starting material. Expression levels in different endometrial biopsies from each patient were compared using the paired t test; statistical significance was accepted when P < 0.05.
| Results |
|---|
|
|
|---|
In the presence of the IUD (biopsy 2 vs. biopsy 1), 78 transcripts were up-regulated and 69 genes down-regulated. Table 1![]()
![]()
shows the fold increase (A) and decrease (B) of the 147 genes with known identity that were dysregulated at the time of implantation. WOI genes (7, 15) characterize the normal transition from nonreceptive to a receptive state. In our study, 52 of them (35%) corresponded to WOI genes and are presented in Table 1![]()
![]()
(bold).
We then sought to determine the effect of removal of the IUD on the endometrial gene expression. Two months after IUD, biopsy 3 was taken at LH+7 in the same patient. When we compared biopsy 3 (LH+7, 2 months after IUD insertion) vs. biopsy 1 (LH+7 before IUD insertion), 142 of the 147 dysregulated transcripts (96% of the total) remained dysregulated. Only five transcripts recovered their normal expression 2 months after IUD insertion: matrix metalloproteinase 12 (macrophage elastase), matrix metalloproteinase 10 (stromelysin 2), G protein-coupled receptor 109B, hemoglobin-
2 and serine (or cysteine) proteinase inhibitor, and clade B (ovalbumin) member 3. Interestingly, only one gene, matrix metalloproteinase 10, was a known WOI gene.
To examine the long-term effect imposed by the IUD on endometrial receptivity, we analyzed the gene expression profile in biopsy 4 obtained at LH+7, 1 yr after IUD removal. Only three endometrial biopsies could be collected: one patient refused to continue the study and the other one was under oral contraceptive treatment. Of the three biopsies, one was excluded because the histology revealed that the tissue showed incorrect dating. The gene expression profiles of these samples were compared with biopsy 1 (pre-IUD) from the same women. We found that, 1 yr later, 118 genes (80% of the total) recovered their normal expression at the time of implantation. Figure 1
shows the expression profile time line after the IUD removal of those 147 genes that were up- and down-regulated in the presence of IUD. It is remarkable that most of the genes (96%) showed very similar expression levels in the presence of IUD and 2 months after IUD. These results show an unexpectedly long-term effect of the IUD on the endometrial gene expression profile. However, most of the genes recovered their normal expression 1 yr after IUD removal (80%) (Fig. 1
).
|
-catenin and nuclear factor I/B. Array validation
Real time RT-PCR was used to verify the changes in RNA expression levels indicated by the cDNA analysis. Four genes, IGFBP-3, PPAR
, LIF, and glycodelin, which apparently changed on average more than 2-fold in the presence of the IUD and which were highly expressed, were chosen for verification. Levels of these transcripts were measured by real-time RT-PCR in each cDNA sample relative to a reference RNA, and the values were corrected for differences in loading relative to the 18S ribosomal RNA. RNA transcripts for PPAR
showed consistent up-regulation in all five patients in the endometrium in the presence of the IUD (Fig. 2B
). PPAR
expression remained significantly elevated two cycles after IUD removal. In contrast, the array analysis indicated that transcripts for IGFBP-3 were down-regulated in the presence of an IUD. Analysis of IGFBP-3 mRNA by real-time RT-PCR confirmed this decrease with the IUD in place (Fig. 2A
). However, one of the five patients (patient 4) did not show a decrease in IGFBP-3 on IUD insertion, so this change was not quite statistically significant. As in the case of PPAR
, IGFBP-3 levels remained significantly altered two cycles after IUD removal. Similarly, glycodelin transcripts also decreased in the presence of an IUD with the IUD in place (Fig. 2C
). Decreased expression for LIF was also confirmed by RT-PCR (Fig. 2D
). As seen with IGFBP-3, one patient (patient 4) did not show this change, but the expression of glycodelin and LIF remained decreased at the time of the biopsy in the other patients two cycles after IUD removal. Although there was some heterogeneity in response between patients (e.g. patient 4), the real-time RT-PCR results confirmed the changes identified by the microarray analysis. This indicates that the microarray analysis has reliably detected changes in gene expression after IUD treatment of secretory phase endometrium.
|
|
| Discussion |
|---|
|
|
|---|
Furthermore, comparing the genomic profile between the receptive (15) and refractory endometrium (present work), we identified four unique groups of genes related to the refractoriness induced by the IUD with potential functional relevance (Table 2
). The first group is composed by genes that were up-regulated during the implantation window in women during the natural cycle but significantly decreased in the presence of IUD (22 genes). Group 2 comprises genes that are down-regulated during the WOI but significantly increased in endometrium in fertile women with IUD (10 genes). Group 3 was formed by six genes up-regulated during the WOI and further increased in the presence of IUD. Finally, group 4, composed of one gene, which is down-regulated during the WOI and in the presence of the IUD, is further decreased. All these genes recovered their normal expression 1 yr after the IUD removal. This suggests that one of the primary mechanisms of action of the IUD is to prevent on a large scale the normal transition of gene expression during the WOI. In addition, we found changes in many genes not previously shown to be regulated in the endometrium at the time of implantation.
|
The normalization of the endometrial gene expression profile was confirmed 1 yr after IUD. These results demonstrated that, 1 yr after, the majority (80%) of the genes recovered their normal expression profile at LH+7 corroborating the existing epidemiological data (29, 30, 31, 32).
In summary, in an attempt to understand endometrial refractoriness, we examined the gene expression changes induced by the presence of an inert IUD. Significant dysregulation of many genes during the WOI was found, and several mechanisms by which the IUD may induce a nonreceptive state have been put forward. There is a failure to up-regulate many of the genes that are normally increased during the WOI. Second, there is an up-regulation of a group of genes that is not induced at LH+7 including immune response mediators. Finally, we identified abnormal expression of several genes such as LIF and PPAR
that are known to play an essential role in murine implantation. Disruption of these genes may also contribute to the nonreceptive state in the presence of IUD. We have also shown that this effect persists for some time after IUD removal. The gene expression profile of the endometrium 2 months after the IUD removal at LH+7 does not correspond to a normal endometrium at the time of implantation. This effect is reversible, and our results suggest that within 1 yr the endometrial tissue largely recovers its normal gene expression profile. This correlates with epidemiological studies showing normal implantation rates 1 yr after IUD removal. These results should be taken into consideration in the development of new interceptive strategies.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online May 30, 2006
Abbreviations: IGFBP, IGF binding protein; IUD, intrauterine device; LIF, leukemia inhibitory factor; PPAR, peroxisome proliferative activated receptor; WOI, window of implantation.
Received February 24, 2006.
Accepted May 19, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Dominguez, T. Garrido-Gomez, J.A. Lopez, E. Camafeita, A. Quinonero, A. Pellicer, and C. Simon Proteomic analysis of the human receptive versus non-receptive endometrium using differential in-gel electrophoresis and MALDI-MS unveils stathmin 1 and annexin A2 as differentially regulated Hum. Reprod., October 1, 2009; 24(10): 2607 - 2617. [Abstract] [Full Text] [PDF] |
||||
![]() |
The ESHRE Capri Workshop Group Intrauterine devices and intrauterine systems Hum. Reprod. Update, May 1, 2008; 14(3): 197 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tapia, L. M. Gangi, F. Zegers-Hochschild, J. Balmaceda, R. Pommer, L. Trejo, I. M. Pacheco, A. M. Salvatierra, S. Henriquez, M. Quezada, et al. Differences in the endometrial transcript profile during the receptive period between women who were refractory to implantation and those who achieved pregnancy Hum. Reprod., February 1, 2008; 23(2): 340 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.D. Catalano, H.O. Critchley, O. Heikinheimo, D.T. Baird, D. Hapangama, J.R.A. Sherwin, D.S. Charnock-Jones, S.K. Smith, and A.M. Sharkey Mifepristone induced progesterone withdrawal reveals novel regulatory pathways in human endometrium Mol. Hum. Reprod., September 1, 2007; 13(9): 641 - 654. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |