help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-0430
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horcajadas, J. A.
Right arrow Articles by Simón, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horcajadas, J. A.
Right arrow Articles by Simón, C.
Related Collections
Right arrow Female Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 8 3199-3207
Copyright © 2006 by The Endocrine Society

Effect of an Intrauterine Device on the Gene Expression Profile of the Endometrium

J. A. Horcajadas, A. M. Sharkey, R. D. Catalano, J. R. A. Sherwin, F. Domínguez, L. A. Burgos, A. Castro, M. R. Peraza, A. Pellicer and C. Simón

Fundación IVI (J.A.H., F.D., A.P., C.S.), Instituto Universitario IVI, University of Valencia, 46022 Valencia, Spain; Department of Pathology (A.M.S., R.D.C., J.R.A.S.), Reproductive Molecular Research Group, University of Cambridge, Cambridge CB2 1TN, United Kingdom; and Génesis Unidad de Fertilidad y Reproducción (L.A.B., A.C., M.R.P.), Instituto Médico La Floresta, Policlínica Metropolitana, 1060 Caracas, Venezuela

Address all correspondence and requests for reprints to: C. Simón, Fundación IVI, Instituto Universitario IVI, University of Valencia, Valencia, Spain. E-mail: csimon{at}ivi.es.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: The human endometrium acquires the ability to allow embryo attachment just for a specific period of time during each menstrual cycle. Understanding of the opposite functional status, referred to as refractoriness, can potentially be used to improve receptivity in infertile patients or as an interceptive approach to prevent gestation.

Objective: The objective of the study was to analyze the endometrial gene expression profile induced by an inert intrauterine device (IUD) at the time of implantation.

Design: We used a microarray containing more than 16,000 cDNAs to investigate the gene expression profile of receptive vs. refractory endometrium in the same women induced by the presence of an IUD. We compared the gene expression profile of endometrium obtained at LH+7 (window of receptivity) from the same women (n = 5) at the following time points: month 1, corresponding to the natural cycle before IUD insertion; month 3, just before IUD removal; and months 5 and 15. Data were validated by quantitative RT-PCR for IGF binding protein-3, peroxisome proliferative activated receptor-{gamma}, glycodelin, and leukemia inhibitory factor and immunohistochemistry for glycodelin.

Results: We identified 147 genes significantly dysregulated in the refractory endometrium (78 up- and 69 down-regulated). Interestingly, 52 of these genes have previously been reported to be regulated during window of implantation. Surprisingly, the majority of genes (96.6%) remained dysregulated 2 months after IUD removal, but 1 yr later most of them (80%) returned to normal.

Conclusions: Our results reveal that a refractory endometrium in a fertile woman produced by an IUD is induced by preventing the normal transition to a receptive gene expression profile through effects on a specific subset or cluster of genes that impact on endometrial receptivity.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
SUCCESSFUL HUMAN EMBRYONIC implantation requires a functionally normal embryo and a receptive endometrium. The window of implantation (WOI) is a self-limited period, in which the endometrial epithelium acquires a functional ability to support blastocyst adhesion. Uncovering the molecular basis of endometrial receptivity is fundamental for the understanding of the mechanisms that govern embryonic implantation and human reproduction (1, 2, 3).

In the last 3 yr, several studies (4, 5, 6, 7, 8) investigated the gene expression profile of the human endometrium during the WOI, compared with other phases of the menstrual cycle. These analyses have generated long lists of genes that are up- or down-regulated during this specific period in which the endometrium is receptive (9). However, it is not clear from these studies which of the many genes altered during the WOI are functionally important. Additional strategies have been designed to investigate the genomics of the endometrium in subfertile conditions such as endometriosis (10, 11), RU486 treatment (12, 13), or in patients with controlled ovarian stimulation in in vitro fertilization (14, 15, 16). These approaches have generated indirect evidence of the functional relevance of WOI genes.

Over the past four decades, intrauterine devices (IUDs) have been established as one of the most effective interceptive methods with a typical Pearl index around 0.5 (number of pregnancies per 100 women per year) (17). IUDs induce changes in the endometrium causing refractoriness that prevents embryonic implantation. We hypothesize that the refractoriness induced by the IUD must be due to changes in the WOI endometrial gene expression profile. Until now, only morphology and few studies of individual genes have been reported in the literature using IUDs with levonorgestrel (18, 19). In this work, we investigated the global gene expression profile of the endometrium during the WOI in the same fertile woman, in the presence or absence of an inert IUD. We also analyzed the short- and long-term effect of the IUD on the gene expression pattern of the endometrium.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Study design and tissue collection

This study was conducted in accordance with the guidelines in The Declaration of Helsinki and was approved by the ethics committee of the institution at which the endometrial biopsies were obtained (Génesis Unidad de Fertilidad y Reproducción, Caracas, Venezuela) and processed (Instituto Valenciano de Infertilidad, Valencia, Spain). Written informed consent was obtained from all patients. Healthy fertile volunteers (aged 23–39 yr, with a body mass index between 19 and 25 kg/m2) (n = 5) were monitored as follows: month 1 was a natural cycle before IUD insertion; in month 2, the IUD was inserted; in month 3, the IUD was removed; and from month 4 onward, natural cycles without any intervention were monitored. Endometrial biopsies were obtained at months 1, 3, 5, and 15 (biopsies 1, 2, 3, and 4, respectively) from each woman at LH+7 as determined by assaying the serum LH surge. Transvaginal ultrasound was performed in late follicular phase and early luteal phase to localize the dominant follicle or corpus luteum to assure that ovulation occurred. Patients resumed menstrual cycles consistent with their previous gynecological history. Overall, 18 biopsies (n = 5 at cycle 1, 3, and 5 and n = 3 for endometrial biopsy at cycle 15) were obtained using a Pipelle catheter (Genetics, Namont-Achel, Belgium) under sterile conditions from the uterine fundus. Endometrial dating was performed using the Noyes criteria (20). The inert IUD used in this study (Lippes Loop Intrauterine Double-S; Ortho Pharmaceutical Corp., Raritan, NJ) was chosen because of the absence of any hormone associated that could modify the refractoriness gene expression profile.

Gene expression profiling

Total RNA was extracted from human endometrium using Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions and treated with RQ1 DNase I (Promega, Southampton, UK) for 30 min at 37 C and then reextracted with Trizol. RNA quality was assessed by loading 300 ng of total RNA onto an RNA Labchip and analyzed on an A2100 bioanalyzer (Agilent Technologies, Waldbronn, Germany).

The microarray was printed on two slides (HMN1 and HMN2). The manufacturing of the slides is described by Rossi et al. (13) and Evans et al. (21). A full list of the cDNAs is available (http://www.path.cam.ac.uk/resources/microarray/microarrays/).

Array hybridization

The generation of the amplified labeled cDNA targets and the chip hybridization was performed using the method of Petalidis et al. (22). The fluorescence signal on the microarrays was acquired by using a Genepix 4100 microarray scanner (Axon Instruments, Foster City, CA). The scanned images were processed by using the GenePix Pro 3.0 software (Axon Instruments).

Statistical analysis

The raw data were normalized per spot and per chip using GeneSpring version 7.0 software with intensity dependent (Lowess) normalization (percent of the data used for smoothing 10%) and per chip normalized to 50th percentile. Low hybridization signals were removed to give an average of 10,000 different RNA transcripts expressed above background. For each cDNA spot on the array, a ratio was derived in which the signal from the test sample (Cy5) was expressed relative to its expression in the Cy3-labeled control sample (same women before IUD) hybridized to the array at the same time. Genes that showed statistically different expression levels were identified by performing pairwise comparisons between the different time points using Welch’s t test with Benjamini and Hochberg multiple testing correction. Transcripts with a P < 0.05 were selected for inclusion in Table 1GoGoGo. In addition, fold change ratios between groups (i.e. LH+7 pre-IUD vs. LH+7 in the presence of the IUD) were subsequently derived, and up- and down-regulated genes were selected on the basis that they showed a change of at least 3-fold in three of five women and also had an overall median fold change over 2 and a P < 0.05 (23, 24).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Endometrial genes up-regulated (A) and down-regulated (B) in the presence of the IUD and their outcome 2 months and 1 yr after IUD removal

 

View this table:
[in this window]
[in a new window]
 
TABLE 1A. Continued

 

View this table:
[in this window]
[in a new window]
 
TABLE 1B. Continued

 
Array validation

To verify the results obtained from the cDNA microarray, real-time PCR (Taqman) was performed for four selected genes: IGF binding protein (IGFBP)-3, peroxisome proliferative activated receptor (PPAR)-{gamma} glycodelin (also known as placental protein 14) and leukemia inhibitory factor (LIF). Immunohistochemistry was also performed for glycodelin. It was carried out on endometrial sections using an LSAB peroxidase kit (Dako Corp., Barcelona, Spain) with a protocol previously described (25). It used glycodelin polyclonal antiserum diluted 1:1000 (this antibody was kindly provided by Dr. Koistinen, Helsinki, Finland).

Relative expression levels of each gene in total RNA from endometrium was determined by real-time RT-PCR using specific primers and FAM-labeled probes for each gene: primer sequence (5'-3') for IGFBP-3 forward, GCACAGATACCCAGAACTTCTCC, reverse, CAGGTGATTCAGTGTGTCTTCCA, and probe, AGACAGAATATGGTCCCTGCCGCA; PPAR{gamma} forward, CAGAGCAAAGAGGTGGCCAT, reverse, GCTTTTGGCATACTCTGTGATCTC, and probe, CATCTTTCA-GGGCTGCCAGTTTCGC; glycodelin forward, TGGTCTGTGGTGT-CCCGG, reverse, AGGGAGATGTTGTTGGTCGC, and probe, ACATC-CCCCAGACCAAGCAGGACCT. LIF transcript levels were measured using primers provided as an assay on demand (Applied Biosystems, Warrington, UK). Primers were labeled with 5'FAM and 3'TAMRA. Real-time PCR was performed using an ABI PRISM 7700 sequence detection system (TaqMan) according to the manufacturer’s instructions (Applied Biosystems). cDNA was produced from each RNA sample by reverse transcription with random hexamers using 5 µg of total RNA with 200 IU Superscript RT (Invitrogen Life Technologies). The expression values obtained were normalized against those from the control ribosomal 18S to account for differing amounts of starting material. Expression levels in different endometrial biopsies from each patient were compared using the paired t test; statistical significance was accepted when P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Identification of genes involved in endometrial refractoriness

In the presence of the IUD (biopsy 2 vs. biopsy 1), 78 transcripts were up-regulated and 69 genes down-regulated. Table 1GoGoGo shows the fold increase (A) and decrease (B) of the 147 genes with known identity that were dysregulated at the time of implantation. WOI genes (7, 15) characterize the normal transition from nonreceptive to a receptive state. In our study, 52 of them (35%) corresponded to WOI genes and are presented in Table 1GoGoGo (bold).

We then sought to determine the effect of removal of the IUD on the endometrial gene expression. Two months after IUD, biopsy 3 was taken at LH+7 in the same patient. When we compared biopsy 3 (LH+7, 2 months after IUD insertion) vs. biopsy 1 (LH+7 before IUD insertion), 142 of the 147 dysregulated transcripts (96% of the total) remained dysregulated. Only five transcripts recovered their normal expression 2 months after IUD insertion: matrix metalloproteinase 12 (macrophage elastase), matrix metalloproteinase 10 (stromelysin 2), G protein-coupled receptor 109B, hemoglobin-{alpha}2 and serine (or cysteine) proteinase inhibitor, and clade B (ovalbumin) member 3. Interestingly, only one gene, matrix metalloproteinase 10, was a known WOI gene.

To examine the long-term effect imposed by the IUD on endometrial receptivity, we analyzed the gene expression profile in biopsy 4 obtained at LH+7, 1 yr after IUD removal. Only three endometrial biopsies could be collected: one patient refused to continue the study and the other one was under oral contraceptive treatment. Of the three biopsies, one was excluded because the histology revealed that the tissue showed incorrect dating. The gene expression profiles of these samples were compared with biopsy 1 (pre-IUD) from the same women. We found that, 1 yr later, 118 genes (80% of the total) recovered their normal expression at the time of implantation. Figure 1Go shows the expression profile time line after the IUD removal of those 147 genes that were up- and down-regulated in the presence of IUD. It is remarkable that most of the genes (96%) showed very similar expression levels in the presence of IUD and 2 months after IUD. These results show an unexpectedly long-term effect of the IUD on the endometrial gene expression profile. However, most of the genes recovered their normal expression 1 yr after IUD removal (80%) (Fig. 1Go).


Figure 1
View larger version (41K):
[in this window]
[in a new window]
 
FIG. 1. Graphs indicating median ratio across each experimental group for final gene list. Only genes identified as altered by the presence of an IUD are shown (listed in Table 1GoGoGo). The fold change for each gene was calculated relative to expression of the same gene in biopsy 1 from the corresponding patient, and then the median for that gene in all the patients was plotted at each time point in the vertical axis: line 1 (biopsy 2 vs. biopsy 1), line 2 (biopsy 3 vs. biopsy 1), and line 3 (biopsy 4 vs. biopsy 1). Each panel represents one slide, HMN1 and HMN2. All genes are by definition identified as altered in expression in biopsy 2 (IUD present) vs. biopsy 1 (pre-IUD). The majority remain altered in biopsy 3 (2 months after IUD removal) vs. biopsy 1. However, 1 yr after biopsy removal, the expression of most genes has returned to similar levels as seen in biopsy 1.

 
We compared the expression changes of the 52 dysregulated WOI genes with the natural cycle during the transition from LH+2 (nonreceptive) to LH+7 (receptive). Thirty-two of 33 WOI genes down-regulated at LH+7 in the presence of an IUD are normally up-regulated during the transition from LH+2 to LH+7. Relevant genes include glycodelin or LIF, two of the genes normally up-regulated at the time of implantation. On the other hand, of the 19 WOI genes increased at LH+7 with the IUD, 15 of them are usually down-regulated between LH+2 and LH+7. These genes include {alpha}-catenin and nuclear factor I/B.

Array validation

Real time RT-PCR was used to verify the changes in RNA expression levels indicated by the cDNA analysis. Four genes, IGFBP-3, PPAR{gamma}, LIF, and glycodelin, which apparently changed on average more than 2-fold in the presence of the IUD and which were highly expressed, were chosen for verification. Levels of these transcripts were measured by real-time RT-PCR in each cDNA sample relative to a reference RNA, and the values were corrected for differences in loading relative to the 18S ribosomal RNA. RNA transcripts for PPAR{gamma} showed consistent up-regulation in all five patients in the endometrium in the presence of the IUD (Fig. 2BGo). PPAR{gamma} expression remained significantly elevated two cycles after IUD removal. In contrast, the array analysis indicated that transcripts for IGFBP-3 were down-regulated in the presence of an IUD. Analysis of IGFBP-3 mRNA by real-time RT-PCR confirmed this decrease with the IUD in place (Fig. 2AGo). However, one of the five patients (patient 4) did not show a decrease in IGFBP-3 on IUD insertion, so this change was not quite statistically significant. As in the case of PPAR{gamma}, IGFBP-3 levels remained significantly altered two cycles after IUD removal. Similarly, glycodelin transcripts also decreased in the presence of an IUD with the IUD in place (Fig. 2CGo). Decreased expression for LIF was also confirmed by RT-PCR (Fig. 2DGo). As seen with IGFBP-3, one patient (patient 4) did not show this change, but the expression of glycodelin and LIF remained decreased at the time of the biopsy in the other patients two cycles after IUD removal. Although there was some heterogeneity in response between patients (e.g. patient 4), the real-time RT-PCR results confirmed the changes identified by the microarray analysis. This indicates that the microarray analysis has reliably detected changes in gene expression after IUD treatment of secretory phase endometrium.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Real time RT-PCR analysis of transcript levels in endometrium of five patients at LH+7 before IUD insertion (pre-IUD, biopsy 1), two cycles after IUD had been in place (IUD present, biopsy 2), and 2 months after IUD removal (post-IUD, biopsy 3). RNA transcript levels were measured in the five patients relative to a reference endometrial RNA sample, and values are expressed in arbitrary units relative to this reference. A, PPAR{gamma} transcript levels increased significantly from a median of 1.1 (range 0.9–1.7) to 5.3 (range 1.5–6.4) in paired biopsies from the same patients with the IUD in place (P < 0.03). PPAR{gamma} expression remained significantly elevated two cycles after IUD removal, with median expression levels of 5.0 (range 2.6–6.8; P < 0.01). B, Transcripts for IGFBP-3 were down-regulated from a median expression level of 0.8 (range 0.3–0.9) to 0.26 (range 0.1–2.5) in the presence of an IUD. IGFBP-3 levels remained significantly altered two cycles after IUD removal with a median expression level of 0.22 (range 0.1–0.4). C, Placental protein 14 (PP14) (glycodelin) transcripts also decreased in the presence of an IUD from a median expression at LH+7 of 9.2 (range 4.1–49) before IUD to a median of 2.10 (range 0.4–8.0) with the IUD in place. This decrease was sustained two cycles after IUD removal. D, LIF expression decreased from a median of 3.6 (range 2.2–10.0) to 0.5 (range 0.1–2.5) with the IUD in place and remained decreased 2 months after IUD removal.

 
In the natural cycle, immunoreactive glycodelin appears in endometrial glands 5 d after ovulation, and it is detectable in neither luminal epithelium nor stroma (26). Glycodelin immunoreactivity was clearly lower at LH+7 in the presence of IUD and LH+7, 2 months after the IUD removal in the same fertile woman (Fig. 3Go). Although the localization in both cases is still present in the glandular epithelium, the endometrium with or after IUD showed a decrease in the number of glands stained.


Figure 3
View larger version (163K):
[in this window]
[in a new window]
 
FIG. 3. Immunohistochemical localization of glycodelin in endometrial tissue before, during, and 2 months after IUD use. A, Negative control. B, Endometrial tissue before IUD insertion (biopsy 1). Strong glycodelin immunoreactivity is apparent in glandular epithelium only. We detected some glands strongly stained, whereas other glands were not stained at all. There was no significant staining in the luminal epithelium or stroma. C, Endometrial tissue with IUD in place (biopsy 2). We observed negligible staining in glands. D, Endometrial tissue 2 months after IUD removal (biopsy 3). We detected from weak to strong staining in some glands recovering typical glycodelin expression in human endometrium. Magnification of all microphotographs, x40.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The molecular mechanisms implicated in the uterine refractoriness produced by the IUD are still unknown (27). This is the first time that a genome-wide analysis of the effect of an inert IUD on the endometrium is presented. It is remarkable that the gene expression profile of the endometrium with an IUD showed a consistent pattern in the five women studied. Most of the endometrial biopsies immediately after IUD removal showed inflammatory changes, vascular congestion, and edema consistent with the local effect of the IUD as it has been previously reported (28). We used stringent criteria and reported our results after considering 3.0-fold changes in at least three of five women, a median fold change over 2, and a P < 0.05. We identified genes for apoptosis, ion transporters, immunomodulators, secretory proteins, signal transduction, membrane proteins, and transcription factors (Table 1GoGoGo). Interestingly, 52 of the 147 identified genes belong to the class of previously identified WOI genes, which are characteristically up- or down-regulated when the endometrium becomes receptive during the natural cycle (Table 1GoGoGo). These 52 transcripts appeared dysregulated in the presence of an inert IUD, compared with their normal expression during the WOI.

Furthermore, comparing the genomic profile between the receptive (15) and refractory endometrium (present work), we identified four unique groups of genes related to the refractoriness induced by the IUD with potential functional relevance (Table 2Go). The first group is composed by genes that were up-regulated during the implantation window in women during the natural cycle but significantly decreased in the presence of IUD (22 genes). Group 2 comprises genes that are down-regulated during the WOI but significantly increased in endometrium in fertile women with IUD (10 genes). Group 3 was formed by six genes up-regulated during the WOI and further increased in the presence of IUD. Finally, group 4, composed of one gene, which is down-regulated during the WOI and in the presence of the IUD, is further decreased. All these genes recovered their normal expression 1 yr after the IUD removal. This suggests that one of the primary mechanisms of action of the IUD is to prevent on a large scale the normal transition of gene expression during the WOI. In addition, we found changes in many genes not previously shown to be regulated in the endometrium at the time of implantation.


View this table:
[in this window]
[in a new window]
 
TABLE 2. List of target genes

 
In this study, we also analyzed the endometrial expression pattern 2 months after IUD removal and found that most of the dysregulated genes in the presence of IUD remained dysregulated. In total, five of 147 genes recovered their normal expression at the time of implantation; specifically only one of 52 WOI genes (matrix metalloproteinase 10) recovered normal expression. This demonstrates that 2 months after IUD removal, the endometrium does not recover its normal gene expression pattern and would predict that it should not have recovered its normal receptivity. Several papers examined the recovery of fertility after the use of various types of IUDs. All these works agree that the pregnancy rates after IUD removal remained lower than in control women for up to 3 months, and 1 yr after IUD removal, pregnancy rates are over 90% (29, 30, 31, 32). Cohen (29) estimated that 30% of women become pregnant within 1 month, and another group established a rate of 23.43% after long-term use of IUDs (33). Median time to become pregnant was 3–4 months in one study, depending on the IUD used (30), and 4.4 months in another (31). Our findings indicate that the apparent reduction in pregnancy rate after IUD removal may be due to the transient endometrial genomic modification.

The normalization of the endometrial gene expression profile was confirmed 1 yr after IUD. These results demonstrated that, 1 yr after, the majority (80%) of the genes recovered their normal expression profile at LH+7 corroborating the existing epidemiological data (29, 30, 31, 32).

In summary, in an attempt to understand endometrial refractoriness, we examined the gene expression changes induced by the presence of an inert IUD. Significant dysregulation of many genes during the WOI was found, and several mechanisms by which the IUD may induce a nonreceptive state have been put forward. There is a failure to up-regulate many of the genes that are normally increased during the WOI. Second, there is an up-regulation of a group of genes that is not induced at LH+7 including immune response mediators. Finally, we identified abnormal expression of several genes such as LIF and PPAR{gamma} that are known to play an essential role in murine implantation. Disruption of these genes may also contribute to the nonreceptive state in the presence of IUD. We have also shown that this effect persists for some time after IUD removal. The gene expression profile of the endometrium 2 months after the IUD removal at LH+7 does not correspond to a normal endometrium at the time of implantation. This effect is reversible, and our results suggest that within 1 yr the endometrial tissue largely recovers its normal gene expression profile. This correlates with epidemiological studies showing normal implantation rates 1 yr after IUD removal. These results should be taken into consideration in the development of new interceptive strategies.


    Acknowledgments
 
The authors thank the staff and patients at the Génesis Unidad de Fertilidad y Reproducción for their assistance, especially Dr. Otto Paredes, without which this study would not have been possible. We also thank the Biotechnology and Biological Sciences Research Council (BBSRC) microarray group (BBSRC Grant no. 8/EGH16106, Department of Pathology, Cambridge University) for their assistance in providing microarrays and expertise. We also thank the Royal Society of the United Kingdom for supporting this project with a short-term fellow to J.A.H.


    Footnotes
 
This work was supported by Grants PI 021169 and SAF2004-00204 from the Spanish Government. A.M.S. was supported by the Meres Senior Research Studentship from St. John’s College Cambridge (Cambridge, UK). R.D.C. was supported by the Rockefeller/World Health Organization implantation initiative.

First Published Online May 30, 2006

Abbreviations: IGFBP, IGF binding protein; IUD, intrauterine device; LIF, leukemia inhibitory factor; PPAR, peroxisome proliferative activated receptor; WOI, window of implantation.

Received February 24, 2006.

Accepted May 19, 2006.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Giudice L 2003 Elucidating endometrial function in the post-genomic era. Hum Reprod Update 9:223–235[Abstract/Free Full Text]
  2. Horcajadas JA, Riesewijk A, Dominguez F, Cervero A, Pellicer A, Simon C 2004 Determinants of endometrial receptivity. Ann NY Acad Sci 1034:166–175[CrossRef][Medline]
  3. Simón C 1996 Potential molecular mechanisms for the contraceptive control of implantation. Mol Hum Reprod 2:475–480[Free Full Text]
  4. Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC 2002 Global gene profiling in human endometrium during the window implantation. Endocrinology 143:2119–2138[Abstract/Free Full Text]
  5. Carson DD, Lagow E, Thathiah A, Al-Shami R, Farach-Carson MC, Vernon M, Yuan L, Fritz MA, Lessey B 2002 Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Mol Hum Reprod 8:871–879[Abstract/Free Full Text]
  6. Borthwick JM, Charnock-Jones DS, Tom BD, Hull ML, Teirney R, Phillips SC, Smith SK 2003 Determination of the transcript profile of human endometrium. Mol Hum Reprod 9:19–33[Abstract/Free Full Text]
  7. Riesewijk A, Martin J, van Os R, Horcajadas JA, Polman J, Pellicer A, Mosselman S, Simon C 2003 Gene expression profiling of human endometrial receptivity on days LH+2 versus LH+7 by microarray technology. Mol Hum Reprod 9:253–264[Abstract/Free Full Text]
  8. Mirkin S, Arslan M, Churikov D, Corica A, Diaz JI, Williams S, Bocca S, Oehninger S 2005 In search of candidate genes critically expressed in the human endometrium during the window of implantation. Hum Reprod 8:2104–2117
  9. Horcajadas JA, Riesewijk A, Martin J, Cervero A, Mosselman S, Pellicer A, Simon C 2004 Global gene expression profiling of human endometrial receptivity. J Reprod Immunol 63:41–49[CrossRef][Medline]
  10. Kao LC, Germeyer A, Tulac S, Lobo S, Yang JP, Taylor RN, Osteen K, Lessey BA, Giudice LC 2003 Expression profiling of endometrium from women with endometriosis reveals candidate genes for disease-based implantation failure and infertility. Endocrinology 144:2870–2881[Abstract/Free Full Text]
  11. Giudice L, Kao LC 2004 Endometriosis. Lancet 364:1789–1799[CrossRef][Medline]
  12. Catalano RD, Yanaihara A, Evans AL, Rocha D, Prentice A, Saidi S, Print CG, Charnock-Jones DS, Sharkey AM, Smith SK 2003 The effect of RU486 on the gene expression profile in an endometrial explant model. Mol Hum Reprod 9:465–473[Abstract/Free Full Text]
  13. Rossi M, Sharkey AM, Vigano P, Fiore G, Furlong R, Florio P, Ambrosini G, Smith SK, Petraglia F 2005 Identification of genes regulated by interleukin-1ß in human endometrial stromal cells. Reproduction 130:721–729[Abstract/Free Full Text]
  14. Mirkin S, Nikas G, Hsiu JG, Diaz J, Oehninger S 2004 Gene expression profiles and structural/functional features of the peri-implantation endometrium in natural and gonadotropin-stimulated cycles. J Clin Endocrinol Metab 89:5742–5752[Abstract/Free Full Text]
  15. Horcajadas JA, Riesewijk A, Polman J, van Os R, Pellicer A, Mosselman S, Simon C 2005 Effect of controlled ovarian hyperstimulation in IVF on endometrial gene expression profiles. Mol Hum Reprod 11:195–205[Abstract/Free Full Text]
  16. Simon C, Oberye J, Bellver J, Vidal C, Bosch E, Horcajadas JA, Murphy C, Adams S, Riesewijk A, Mannaerts B, Pellicer A 2005 Similar endometrial development in oocyte donors treated with high- or low-dose GnRH-antagonist compared to GnRH-agonist treatment and natural cycles. Hum Reprod 12:3318–3327
  17. Mosher WD 1990 Use of family planning services in the United States: 1982 and 1988: advance data from vital and health statistics. Report 184. Hyattsville, MD: National Center for Health Statistics
  18. Jones RL, Critchley HO 2000 Morphological and functional changes in human endometrium following intrauterine levonorgestrel delivery. Hum Reprod Suppl 3:162–172
  19. Rutanen EM 2000 Insulin-like growth factors and insulin-like growth factor binding proteins in the endometrium. Effect of intrauterine levonorgestrel delivery. Hum Reprod Suppl 3:173–181
  20. Noyes RW, Hertig AT, Rock J 1950 Dating the endometrial biopsy. Fertil Steril 1:3–25[Medline]
  21. Evans AL, Sharkey AS, Saidi SA, Print CG, Catalano RD, Smith SK, Charnock-Jones DS 2003 Generation and use of a tailored gene array to investigate vascular biology. Angiogenesis 6:93–104[CrossRef][Medline]
  22. Petalidis L, Bhattacharyya S, Morris GA, Collins VP, Freeman TC, Lyons PA 2003 Global amplification of mRNA by template-switching PCR: linearity and application to microarray to microarray analysis. Nucleic Acids Res 31:e142
  23. Claverie JM 1999 Computational methods for the identification of differential and coordinated gene expression. Hum Mol Genet 8:1821–1833[Abstract/Free Full Text]
  24. Lipshutz RJ, Fodor SP, Gingeras TR, Lockhart DJ 1999 High density synthetic oligonucleotide arrays. Nat Genet 21(Suppl):20–24
  25. Domínguez F, Avila S, Cervero A, Martin J, Pellicer A, Castrillo JL, Simón C 2003 A combined approach for gene discovery identifies insulin-like growth factor-binding protein-related protein 1 as a new gene implicated in human endometrial receptivity. J Clin Endocrinol Metab 88:1849–1857[Abstract/Free Full Text]
  26. Julkunen M, Koistinen R, Sjoberg J, Rutanen EM, Wahlstrom T, Seppala M 1986 Secretory endometrium synthesizes placental protein 14. Endocrinology 118:1782–1786[Abstract/Free Full Text]
  27. Stanford JB, Mikolajczyk RT 2002 Mechanisms of action of intrauterine devices: update and estimation of postfertilization effects. Am J Obstet Gynecol 187:1699–1708[CrossRef][Medline]
  28. Nelson AL 2000 The intrauterine contraceptive device. Obstet Gynecol Clin North Am 4:723–740
  29. Cohen J 1981 Fecundity following IUD use. Contracept Fertil Sex 9:465–468
  30. Belhadj H, Sivin I, Diaz S, Pavez M, Tejada AS, Brache V, Alvarez F, Shoupe D, Breaux H, Mishell Jr DR, et al 1986 Recovery of fertility after use of the levonorgestrel 20 mcg/d or Copper T 380 Ag intrauterine device. Contraception 34:261–267[CrossRef][Medline]
  31. Gupta BK, Gupta AN, Lyall S 1989 Return of fertility in various types of IUD users. Int J Fertil 34:123–125[Medline]
  32. Delbarge W, Batar I, Bafort M, Bonnivert J, Colmant C, Dhont M, Fonze V, Gevers R, Janssens D, Lavalley P, Salmin E, Degueldre M, Vrijens M, Van Kets H, Wildemeersch D 2002 Return to fertility in nulliparous and parous women after removal of the GyneFix intrauterine contraceptive system. Eur J Contracept Reprod Health 7:24–30
  33. Hata Y, Ishihama A, Kudo N, Nakamura Y, Miyai T 1969 The effect of long-term use of intrauterine devices. Int J Fertil 14:241–249[Medline]



This article has been cited by other articles:


Home page
Hum ReprodHome page
F. Dominguez, T. Garrido-Gomez, J.A. Lopez, E. Camafeita, A. Quinonero, A. Pellicer, and C. Simon
Proteomic analysis of the human receptive versus non-receptive endometrium using differential in-gel electrophoresis and MALDI-MS unveils stathmin 1 and annexin A2 as differentially regulated
Hum. Reprod., October 1, 2009; 24(10): 2607 - 2617.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
The ESHRE Capri Workshop Group
Intrauterine devices and intrauterine systems
Hum. Reprod. Update, May 1, 2008; 14(3): 197 - 208.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Tapia, L. M. Gangi, F. Zegers-Hochschild, J. Balmaceda, R. Pommer, L. Trejo, I. M. Pacheco, A. M. Salvatierra, S. Henriquez, M. Quezada, et al.
Differences in the endometrial transcript profile during the receptive period between women who were refractory to implantation and those who achieved pregnancy
Hum. Reprod., February 1, 2008; 23(2): 340 - 351.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R.D. Catalano, H.O. Critchley, O. Heikinheimo, D.T. Baird, D. Hapangama, J.R.A. Sherwin, D.S. Charnock-Jones, S.K. Smith, and A.M. Sharkey
Mifepristone induced progesterone withdrawal reveals novel regulatory pathways in human endometrium
Mol. Hum. Reprod., September 1, 2007; 13(9): 641 - 654.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horcajadas, J. A.
Right arrow Articles by Simón, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horcajadas, J. A.
Right arrow Articles by Simón, C.
Related Collections
Right arrow Female Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals