help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-0209
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krone, N.
Right arrow Articles by Riepe, F. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krone, N.
Right arrow Articles by Riepe, F. G.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HYDROCORTISONE
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 7 2682-2688
Copyright © 2006 by The Endocrine Society

Analyzing the Functional and Structural Consequences of Two Point Mutations (P94L and A368D) in the CYP11B1 Gene Causing Congenital Adrenal Hyperplasia Resulting from 11-Hydroxylase Deficiency

Nils Krone, Yulia Grischuk, Marina Müller, Ruth Elisabeth Volk, Joachim Grötzinger, Paul-Martin Holterhus, Wolfgang G. Sippell and Felix G. Riepe

Division of Pediatric Endocrinology (N.K., Y.G., M.M., R.E.V., P.-M.H., W.G.S., F.G.R.), Department of Pediatrics, Christian-Albrechts-Universität zu Kiel, Universitätsklinikum Schleswig-Holstein (Campus Kiel), D-24105 Kiel, Germany; Engelhardt Institute of Molecular Biology (Y.G.), Russian Academy of Sciences, Moscow 119991, Russian Federation; and Biochemisches Institut (J.G.), Christian-Albrechts-Universität zu Kiel, D-24098 Kiel, Germany

Address all correspondence and requests for reprints to: Nils Krone, M.D., Division of Pediatric Endocrinology, Department of Pediatrics, Christian-Albrechts-Universität zu Kiel, Universitätsklinikum Schleswig-Holstein (Campus Kiel), Schwanenweg 20, D-24105 Kiel, Germany. E-mail: krone{at}pediatrics.uni-kiel.de.


    Abstract
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
Context: Congenital adrenal hyperplasia is a group of autosomal recessive inherited disorders of steroidogenesis. The deficiency of steroid 11-hydroxylase (CYP11B1) resulting from mutations in the CYP11B1 gene is the second most frequent cause.

Objective: We studied the functional and structural consequences of two CYP11B1 missense mutations, which were detected in a 1.8-yr-old boy with acne and precocious pseudopuberty, to prove their clinical relevance and study their impact on CYP11B1 function.

Results: The in vitro expression studies in COS-7 cells revealed an almost complete absence of CYP11B1 activity for the P94L mutant to 0.05% for the conversion of 11-deoxycortisol to cortisol. The A368D mutant severely reduced the CYP11B1 enzymatic activity to 1.17%. Intracellular localization studies by immunofluorescence revealed that the mutants were correctly localized. Introducing these mutations in a three-dimensional model structure of the CYP11B1 protein provides a possible explanation for the effects measured in vitro. We hypothesize that the A368D mutation interferes with structures important for substrate specificity and heme iron binding, thus explaining its major functional impact. However, according to structural analysis, we would expect only a minor effect of the P94L mutant on 11-hydroxylase activity, which contrasts with the observed major effect of this mutation both in vitro and in vivo.

Conclusion: Analyzing the in vitro enzyme function is a complementary procedure to genotyping and a valuable tool for understanding the clinical phenotype of 11-hydroxylase deficiency. This is the basis for accurate genetic counseling, prenatal diagnosis, and treatment. Moreover, the combination of in vitro enzyme function and molecular modeling provides valuable insights in cytochrome P450 structural-functional relationships, although one must be aware of the limitations of in silico-based methods.


    Introduction
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
CONGENITAL ADRENAL HYPERPLASIA (CAH) is a group of autosomal recessive inherited inborn errors in steroidogenesis and ranks among the most frequent inborn errors of metabolism. The majority of cases result from steroid 21-hydroxylase deficiency (21OHD) (1, 2, 3), whereas approximately 5–8% (4) are caused by 11-hydroxylase (CYP11B1) deficiency (11OHD, OMIM +202010). Thus, the disease occurs in about one in 200,000 live births (5, 6).

CYP11B1 deficiency causes a decrease of cortisol synthesis, a subsequent elevation of plasma ACTH level, and accumulation of steroid precursors. The androgen synthesis pathway is flooded by these steroid precursors, resulting in hyperandrogenism. In about two thirds of patients, hypertension can be diagnosed because of an accumulation of 11-deoxycorticosterone and its metabolites. The reactive androgen overproduction in classic 11OHD leads to severe virilization of external genitalia in newborn females and to precocious pseudopuberty combined with rapid somatic growth and bone age acceleration in both sexes (7, 8).

The gene encoding for the 11-hydroxylase (CYP11B1) is located on chromosome 8q21, approximately 40 kb from the highly homologous aldosterone synthase gene (CYP11B2) (9). Although a cluster of mutations has been reported in exons 2, 6, 7, and 8 (10, 11), CYP11B1-inactivating mutations have been shown to be distributed over the entire coding region (8).

In this study, we performed the molecular genetic analysis of the CYP11B1 gene in a patient with 11OHD. The functional analysis of the two missense mutations (P94L and A368D) proved their pathogenicity. The effects of the mutations were rationalized with the help of a three-dimensional molecular model. However, the in vitro enzyme activity for one mutation (P94L) was much lower than expected from the in silico structural changes, which exemplifies the limitations of in silico-based studies.


    Patient and Methods
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
Patient, clinical presentation, and hormonal analyses

The male patient (46, XY) was born at term (38th week of gestation) to healthy parents of North German origin with a birth weight of 3370 g and birth length of 52 cm. Shortly after birth, baby acne was noted and is reported to have persisted throughout the patient’s history. The psychomotor development was normal. He was first admitted to our endocrine clinic at age 1.8 yr with a length of 92.5 cm and weight of 17 kg. He showed signs of precocious pseudopuberty with a Prader genital stage G3, pubic hair stage P3, and descended testes with a volume of 1 ml each. His bone age was massively accelerated (bone age, 5 yr), and the ultrasound investigations showed enlarged adrenals and normal testes. Blood pressure was in the upper normal range. The multisteroid analysis (12) after a short ACTH test revealed the typical pattern for CAH caused by 11OHD (Table 1Go). Plasma dehydroepiandrosterone sulfate (3453 nmol/liter; normal range, 35–92 nmol/liter), testosterone (41.7 nmol/liter; normal range, 0.07–0.37 nmol/liter), and androstenedione (30.7 nmol/liter; normal range, 0.17–1.36 nmol/liter) were massively elevated. Treatment with hydrocortisone was initiated and at present the boy is doing well with normalized hormonal parameters, loss of pubertal signs, and normalized growth rate.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Results of multisteroid analysis at diagnosis and before treatment

 
Mutation analysis, construction of plasmids, and site-directed mutagenesis

Genomic DNA was prepared from peripheral blood leukocytes, using a standard protocol. The mutation analysis was performed after PCR amplification by direct DNA sequencing of the complete coding region of the CYP11B1 gene, including the intron-exon boundaries as described previously (11). The samples were electrophoresed on an automated ABI PRISM 310 Sequencer (Applied Biosystems Inc., Weiterstadt, Germany) and analyzed with the ABI SeqScape 1.1 software (Applied Biosystems Inc.). The CYP11B1 genomic DNA (gDNA) (GenBank NT_008127) numbering corresponds to +1 of the A of the ATG translation initiation codon. The mutations were designated using the recommendations of the Nomenclature Working Group (13, 14), whereupon the prefix g. indicates the genomic and c. the cDNA sequence position.

The human full-length CYP11B1 cDNA cloned into the pSVL expression vector (provided by Dr. Rita Bernhardt, Institute of Biochemistry, Universität des Saarlandes, Saarbrücken, Germany) (15) was amplified with the primers CYP11B-F-BamHI (GGGGGGATCCATGGCACTCAGGGCAAAGGC) and CYP11B1-R-XbaI (GGGCCTCTAGATTAGTTGATGGCTCTGAAGGTGAG). The sequences introducing the BamHI and XbaI restriction sites are underlined. The PCR products were digested with BamHI and XbaI and inserted by a ligation reaction into a BamHI/XbaI-linearized pcDNA3.1 expression vector. The mutagenesis was performed from the pcDNA3.1-CYP11B1 construct, using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, Amsterdam, The Netherlands). The introduction of the P94L and the A368D mutations was checked by sequencing the entire BamHI/XbaI insert. To ensure the integrity of the expression plasmid, the mutated CYP11B1-cDNA fragments were recloned into the BamHI/XbaI site of a newly restricted pcDNA3.1 expression vector, resulting in the pcDNA3.1-CYP11B1-P94L and pcDNA3.1-CYP11B1-A368D constructs.

In vitro expression and assays of enzyme activity

COS-7 cells were transiently cotransfected after growing to a density of approximately 2 x 106 cells, using lipofectamine (Invitrogen, Karlsruhe, Germany) with 1 µg of each pcDNA3.1-CYP11B1 construct, 0.5 µg adrenodoxin (pECE-Adx), and 0.5 µg adrenodoxin reductase (pECE-AR) expression vectors, kindly provided by Dr. W. L. Miller (Department of Pediatrics, University of California, San Francisco, CA), and 1 µg Renilla cDNA (Promega, Mannheim, Germany). The posttransfection treatment was performed following a standard protocol (Invitrogen) using DMEM supplemented with glutamine, antibiotics, and 10% fetal calf serum.

The activity assays were performed 48 h after transfection, measuring the 11-hydroxylase activity in intact COS-7 cells. The cells were incubated for 24 h at 37 C with 1 ml full DMEM containing 0.2 µCi 3H-labeled 11-deoxycortisol and 250 nmol/liter unlabeled 11-deoxycortisol. After incubation, steroids were extracted from the culture medium with ice-cold methylene chloride, evaporated to dryness, and dissolved in ethanol. The steroids were separated by thin layer chromatography (TLC) using methylene chloride:methanol:water (300:20:1, vol/vol/vol). The radioactivity was directly measured from the TLC plates using the Rita Star TLC-Scanner (Ray Test, Straubenhardt, Germany). The chromatographs were analyzed using the Rita TLC analysis software version 1.97. Cells were trypsinized and lysed in lysis buffer (Promega) followed by determination of protein content according to the manufacturer’s protocol.

The 11-hydroxylase activity of the mutants was expressed as a percentage of substrate conversion in nanomoles per milligram per minute, taking the activity of cells expressing the CYP11B1 wild-type protein as 100% after correction for total protein and for the activity of cells transfected with the empty pcDNA3.1 vector. The enzymatic activity was calculated using the GraphPad Prism software version 4.0.

To ensure the expression and translation of the intact CYP11B1 wild-type and CYP11B1 mutant proteins, a Western blot analysis using an antihuman-CYP11B rabbit antiserum kindly provided by Dr. H. Takemori (Department of Molecular Physiological Chemistry, Osaka University Medical School, Osaka, Japan) was used in a standard protocol.

Immunofluorescence studies

The immunofluorescence was performed using a standard protocol. The antihuman-CYP11B rabbit antiserum used for the Western blot was used as primary antibody in combination with a mouse anti-Grp75 antibody (BIOMOL, Hamburg, Germany). Each antibody was used in a 1:200 dilution. The antibodies antirabbit-ALEXA Fluor 488 and antimouse- ALEXA Fluor 594 (Molecular Probes, Leiden, The Netherlands) were used as secondary antibodies in 1:500 dilutions. The slides were mounted with Vectorshield mounting medium (Vector Laboratories, Burlingame, CA) allowing for nuclear 4',6-diamidino-2-phenylindole staining.

Molecular modeling

To substantiate the relatedness of the human CYP11B1 protein to the overall fold of the cytochrome P450 family revealed by homology analyses, we used a fold recognition algorithm to show that the human CYP11B1 sequence is compatible with the architecture of this family (ProHit package; ProCeryon Biosciences GmbH, Salzburg, Austria). The template structure with the highest score of the pair potential was the x-ray structure of the mammalian cytochrome CYP2C5 (PDB accession code 1DT6), which served as the template for the three-dimensional model of CYP11B1. According to the alignment obtained by the fold recognition procedure, amino acid residues were exchanged in the template. Insertions and deletions in CYP11B1 were modeled using a database-search approach included in the software package WHATIF (16). Finally, these model structures were energy minimized using the steepest descent algorithm implemented in the GROMOS program package (van Gunsteren, W. F., BIOMOS Biomolecular Software BV, Laboratory of Physical Chemistry, University of Groningen, Groningen, The Netherlands). The structural representations were generated using the programs Deep View/Swiss-PDB Viewer (http://www.expasy.org/spdbv/) (17) and POVRAY (The Persistence of Vision Raytracer; http://www.povray.org).


    Results
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
The patient’s hormonal profile was typical for an 11OHD, and tests of the parents’ hormonal constellation proved their heterozygosity for 11OHD (Table 1Go).

Confirmation analysis by complete DNA sequencing of the CYP11B1 gene revealed two missense mutations in compound heterozygous state in the patient (Fig. 1Go). He carried a heterozygous C to T substitution at bp 668 (g.668C>T, corresponding to c.281C>T) in exon 2 on the maternal allele. This mutation results in a substitution of leucine for proline at amino acid position 94 (P94L) of the CYP11B1 protein, which has been recently described (18). A heterozygous change from C to A at bp 4084 (g.4084C>A, corresponding to c.1103C>A) in exon 6 was detected on the paternal allele. The g.4084C>A missense mutation leads to a change from alanine to aspartic acid at amino acid position 368 (A368D) of the 11-hydroxylase protein.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1. Mutation analysis by direct DNA sequencing. A, CYP11B1 gene and the localization of the novel mutations are shown schematically. The g.668C>T mutation is localized in exon 2 and the g.4084C>A mutation in exon 6 of the CYP11B1 gene. The corresponding change on cDNA and protein levels is also given. B, Pedigree illustrating the segregation of the mutant alleles to the index patient (II.1). C, The left panel shows the substitution T for C at position bp 668 (corresponding to c.281G>C), which results in the substitution of leucine for proline at amino acid position 94 (P94L). The mother (I.2) and the patient (II.1) are heterozygous for g.668C>T mutation, whereas the father shows the wild-type sequence at this position. The C at position bp 4084 is changed to A (corresponding to c.1103C>A), leading to an amino acid substitution from alanine to aspartic acid at amino acid position 368 (A368D). The mutation was found in the heterozygous state in the patient (II.1) and the father (I.1). The mother carries the homozygous wild-type allele at this position.

 
Because both novel mutations are missense mutations, an additional functional in vitro analysis was performed. This confirmed that the mutations were the underlying cause of the phenotypical expression of CAH caused by 11OHD in our patient.

Analyzing the CYP11B1 mutants in the in vitro expression system revealed that the P94L mutation leads to an almost complete absence of 11-hydroxylase activity [0.05 ± 1.9% (SD)] for the conversion of 11-deoxycortisol to cortisol. The A354D mutant also resulted in severe reduction of CYP11B1 enzyme activity (1.17 ± 1.9%) (Fig. 2Go).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Measurement of the mutants’ residual CYP11B1 activity in transiently transfected intact COS-7 cells. The CYP11B1 activity of the mutants is expressed in percentage of wild-type (WT) activity. The wild-type activity is defined as 100%. Values are depicted for the conversion of 11-deoxycortisol to cortisol at a substrate concentration of 250 nmol/liter of unlabeled steroid (time of incubation, 24 h). The bars represent the mean ± 1 SD for a number (n) of determinations from different transfections.

 
The wild-type and mutant proteins expressed in vitro were translated and synthesized with similar efficiency, which was controlled by Western blot analysis (data not shown). The immunofluorescence studies of transiently transfected COS-7 cells showed a mitochondrial localization of the CYP11B1 wild-type and the mutant proteins. This was proven by the colocalization of CYP11B1 with the mitochondrial marker protein Grp75. These data demonstrate that the expression, translation, and the correct intracellular localization were not affected by the mutations (Fig. 3Go).


Figure 3
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. In the left panel, the mitochondrial localization of the human 11-hydroxylase is shown by using antihuman-CYP11B rabbit polyclonal antiserum as primary and the antirabbit-ALEXA Fluor 488 antibody as secondary antibody. In the second panel, the mitochondrial Grp75 protein was marked by using a mouse anti-Grp75 antibody as primary and stained by the antimouse-ALEXA Fluor 594 (Molecular Probes). The third panel shows the nucleus stained with 4',6-diamidino-2-phenylindole (DAPI). The correct intracellular colocalization of the CYP11B1 protein and the Grp75 protein in COS-7 cells is depicted in the right panel.

 

    Discussion
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
In the present study, we describe the characterization of two missense mutations (P94L and A368D) within the CYP11B1 gene, detected in a patient suffering from classical 11OHD. The residual enzyme activity of the mutations analyzed in the in vitro expression studies are concordant with the clinical phenotype of classical 11OHD and comparable to the mutations causing classical 11OHD (10, 11, 19, 20, 21). As pointed out in the Lawson Wilkins Pediatric Endocrine Society/European Society for Paediatric Endocrinology Consensus Statement on 21OHD, molecular genetic analysis is not essential for the diagnosis of 21OHD but may be helpful to confirm the basis of the hormonal defect. Moreover, it supports the genetic counseling and the diagnosis in uncertain cases (22, 23). This also holds true for the less frequent disorder 11OHD, which is not included in the statement. As demonstrated in our case, the disease-causing effect of mutations must be proven by testing the functional consequences.

This will provide more exact information for the physician and result in better patient counseling. A cluster of mutations in exons 6, 7, and 8 has been described (10), and a mutational hot spot has been proposed in exon 5 (20). Although the novel mutation described in this report (A368D) is also located in exon 6, many other mutations spread all over the CYP11B1 gene have been reported (8). Thus, there is no hotspot that can be used for a comprehensive genetic screening strategy so that complete sequencing at least of the coding region and intron-exon boundaries is necessary. The rapid and comprehensive elucidation of novel mutations in CYP11B1 and in particular the detailed analysis of their structural, enzymatic, and clinical consequences is becoming increasingly important in modern pediatric endocrinology.

For analyzing the putative effect of the CYP11B1 mutations, the structural model of the human CYP11B1 protein was built by using the x-ray structure of the mammalian CYP2C5 as a template. The proline at amino acid residue 94 (P94) of the CYP11B1 protein is located at the N terminus of the B helix (Fig. 4Go, A and B1). This amino acid is highly conserved in the CYP11B1 and CYP11B2 proteins of human, mouse (GenBank B41552; P15539), and rat (GenBank NP_036669; AAB60457). It is not found at the corresponding position in human steroid hydroxylases CYP21 (GenBank P08686), CYP17 (GenBank AAH63388), and CYP19A1 (GenBank P11511), in human CYP4B1 (GenBank AAH17758), and in the crystallized mammalian P450 cytochrome enzymes such as CYP2C5 (PDB code 1DT6) (24), CYP2C8 (PDB code 1PQ2) (25), and CYP2C9 (PDB code 1OG2) (26). The P94 residue is located in close proximity to the L410 and G411 residues (Fig. 4BGo1) in the loop that connects helices K and L containing the highly conserved motifs of CYP450s: the meander region and the Cys pocket (27). Moreover, the B-C loop, which in several cytochrome P450 enzymes contains an additional small B' helix, is part of different helices sliding over the surface of the I helix allowing substrate access to the active side (28). We speculate that a mutation of P94 will change the orientation of the B helix relative to the enzyme and consecutively change the access-channel configuration. The other possibility might be a change of the K-L loop orientation involving highly conserved functional motifs of the CYP11B1 enzyme. Although these explanations are plausible, changing the residue P94 to leucine did not result in a dramatic change of the protein structure in the model (Fig. 4BGo2). Thus, the severe decrease of the P94L mutation in the in vitro function is unexpected from the protein structure. However, this proves the functional importance of the proline residue at position 94 in the CYP11B1 protein.


Figure 4
View larger version (53K):
[in this window]
[in a new window]
 
FIG. 4. Three-dimensional molecular model of the CYP11B1 protein. A, Total view of the three-dimensional model structure of CYP11B1. Amino acid residues are depicted for P94, A368, and C450. The I helix is colored in red, the K helix in blue, and a part of the K-L loop in light green. B1, The P94 is located at the N terminus of the B helix, in close proximity to the L410 and G411 residues. B2, Mutating this residue to leucine (L94) does not lead to a dramatic change in the protein structure in the model. C1, The interaction of the hydrophobic residues’ A368, V336, and L340 side chains is depicted. The A368 is located in a hydrophobic surrounding. C2, The introduction of an aspartic acid at residue 368 (A368D) of the CYP11B1 protein will result in a disorientation of the J helix and the I helix. This change in the position of the I helix relative to the heme group and to other parts of CYP11B1 results in a severe decrease in the 11-hydroxylase activity measured in vitro.

 
The alanine residue 368 (Fig. 4Go, A and C1) is located in the putative K helix of the CYP11B1 model, which is not close to the heme group but neighbored by the J helix. The latter contains two highly conserved residues involved in forming the ERR triad (E371 and R374) of the CYP11B1 protein. The ERR triad is a fundamental motif in all cytochrome P450 enzymes (27), and its importance in the 11-hydroxylase protein has been stressed by naturally occurring mutations of these residues: E371G (11) and R374Q (10). These mutations lead to an abolished CYP11B1 activity and consecutively to severe 11OHD. The A368 is conserved in human, mouse, and rat CYP11B1 and CYP11B2 proteins. Hydrophobic residues are also found in CYP21 and CYP17 (corresponding residue, threonine) and in CYP2C5, CYP2C8, and CYP2C9 (corresponding residue, valine). The alanine 368 is located in a hydrophobic environment and interacts with the hydrophobic side chains of the amino acid residues V336 and L340 located in the J helix (Fig. 4CGo1). The introduction of a charged amino acid side chain, as an aspartic acid (D368) (Fig. 4CGo2), into a hydrophobic environment will result in a disorientation of the J helix and the I helix. The I helix is part of the substrate-binding pocket in the x-ray structures of CYP2C5 (24), CYP2C8 (25), and CYP2C9 (26). The substantial role of the I helix for substrate specificity has been demonstrated by chimeric CYP11B2/CYP11B1 molecules: a glucocorticoid-synthesizing CYP11B2 protein and a mineralocorticoid-synthesizing CYP11B1 protein (29, 30). Recently, it has been shown that putative slight changes in the I helix orientation by natural occurring mutations (L299P) of the CYP11B1 have severe effects on the CYP11B1 function (21). Another mechanism might be the resulting disorientation of the K-L loop containing the meander region and C450 coordinating the heme iron. Changing this structure’s orientation will result in substantial changes of both the protein conformation and the heme group orientation relative to the enzyme. Thus, we speculate that the loss of the in vitro 11-hydroxylase activity of the A368D mutation is caused by a steric disarrangement of regions involved in substrate specificity and heme coordination.

Analyzing the functional and structural consequences of CYP11B1 gene mutations leading to 11OHD is an important requisite for assessing a patient’s clinical phenotype. Although combining in vitro expression studies with protein structure analysis is a powerful tool to provide new insights in the understanding of structural-functional relationships, one should be aware of the limitations of in silico-based methods as has been exemplified by the P94L mutation.


    Acknowledgments
 
We are grateful to Dr. Rita Bernhardt (Institute of Biochemistry, Universität des Saarlandes, Saarbrücken, Germany) for providing the CYP11B1 cDNA, Dr. Walter L. Miller (Department of Pediatrics, University of California, San Francisco, CA) for providing the Adx and AR cDNA, and Dr. Hiroshi Takemori (Department of Molecular Physiological Chemistry, Osaka University Medical School, Osaka, Japan) for providing the antihuman-CYP11B rabbit antiserum. We appreciate the expert technical assistance of Gisela Hohmann, Brigitte Andresen, and Tanja Dahm and thank Joanna Voerste for linguistic editing of the manuscript. We also thank Dr. Wiebke Arlt (Institute of Biomedical Research, University of Birmingham, Birmingham, UK) for helpful comments.


    Footnotes
 
This work was supported in part by a Visiting Scholarship from the European Society for Pediatric Endocrinology (to Y.G.).

First Published Online May 2, 2006

Abbreviations: CAH, Congenital adrenal hyperplasia; CYP11B1, 11-hydroxylase; 11OHD, 11-hydroxylase deficiency; TLC, thin layer chromatography.

Received January 31, 2006.

Accepted April 21, 2006.


    References
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 

  1. White PC, Speiser PW 2000 Congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Endocr Rev 21:245–291[Abstract/Free Full Text]
  2. Speiser PW, White PC 2003 Congenital adrenal hyperplasia. N Engl J Med 349:776–788[Free Full Text]
  3. Merke DP, Bornstein SR 2005 Congenital adrenal hyperplasia. Lancet 365:2125–2136[CrossRef][Medline]
  4. Zachmann M, Tassinari D, Prader A 1983 Clinical and biochemical variability of congenital adrenal hyperplasia due to 11ß-hydroxylase deficiency: a study of 25 patients. J Clin Endocrinol Metab 56:222–229[Abstract/Free Full Text]
  5. White PC, Tusie-Luna MT, New MI, Speiser PW 1994 Mutations in steroid 21-hydroxylase (CYP21). Hum Mutat 3:373–378[CrossRef][Medline]
  6. Peter M 2002 Congenital adrenal hyperplasia: 11ß-hydroxylase deficiency. Semin Reprod Med 20:249–254[CrossRef][Medline]
  7. White P, Curnow K, Pascoe L 1994 Disorders of steroid 11ß-hydroxylase isozymes. Endocr Rev 15:421–438[Abstract/Free Full Text]
  8. Peter M, Dubuis JM, Sippell WG 1999 Disorders of the aldosterone synthase and steroid 11ß-hydroxylase deficiencies. Horm Res 51:211–222[CrossRef][Medline]
  9. Mornet E, Dupont J, Vitek A, White P 1989 Characterization of two genes encoding human steroid 11ß-hydroxylase (P-450(11)ß). J Biol Chem 264:20961–20967[Abstract/Free Full Text]
  10. Curnow K, Slutsker L, Vitek J, Cole T, Speiser PW, New MI, White PC, Pascoe L 1993 Mutations in the CYP11B1 gene causing congenital adrenal hyperplasia and hypertension cluster in exons 6, 7, and 8. Proc Natl Acad Sci USA 90:4552–4556[Abstract/Free Full Text]
  11. Geley S, Kapelari K, Johrer K, Peter M, Glatzl J, Vierhapper H, Schwarz S, Helmberg A, Sippell WG, White PC, Kofler R 1996 CYP11B1 mutations causing congenital adrenal hyperplasia due to 11ß-hydroxylase deficiency. J Clin Endocrinol Metab 81:2896–2901[Abstract/Free Full Text]
  12. Sippell WG, Bidlingmaier F, Becker H, Brunig T, Dorr H, Hahn H, Golder W, Hollmann G, Knorr D 1978 Simultaneous radioimmunoassay of plasma aldosterone, corticosterone, 11-deoxycorticosterone, progesterone, 17-hydroxyprogesterone, 11-deoxycortisol, cortisol and cortisone. J Steroid Biochem 9:63–74[CrossRef][Medline]
  13. Antonarakis SE 1998 Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum Mutat 11:1–3[CrossRef][Medline]
  14. den Dunnen JT, Antonarakis SE 2000 Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 15:7–12[CrossRef][Medline]
  15. Bechtel S, Belkina N, Bernhardt R 2002 The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme. Eur J Biochem 269:1118–1127[Medline]
  16. Vriend G 1990 WHAT IF: a molecular modeling and drug design program. J Mol Graph 8:52–56, 29[CrossRef][Medline]
  17. Guex N, Peitsch MC 1997 SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714–2723[CrossRef][Medline]
  18. Grigorescu Sido A, Weber MM, Grigorescu Sido P, Clausmeyer S, Heinrich U, Schulze E 2005 21-Hydroxylase and 11ß-hydroxylase mutations in Romanian patients with classic congenital adrenal hyperplasia. J Clin Endocrinol Metab 90:5769–5773[Abstract/Free Full Text]
  19. Yang LX, Toda K, Miyahara K, Kinoshita E, Baba T, Yoshimoto M, Araki K, Kurashige T, Hashimoto K, Ohnishi S, Shizuta Y 1995 Classic steroid 11ß-hydroxylase deficiency caused by a C->G transversion in exon 7 of CYP11B1. Biochem Biophys Res Commun 216:723–728[CrossRef][Medline]
  20. Merke DP, Tajima T, Chhabra A, Barnes K, Mancilla E, Baron J, Cutler Jr GB 1998 Novel CYP11B1 mutations in congenital adrenal hyperplasia due to steroid 11ß-hydroxylase deficiency. J Clin Endocrinol Metab 83:270–273[Abstract/Free Full Text]
  21. Krone N, Riepe FG, Gotze D, Korsch E, Rister M, Commentz J, Partsch CJ, Grotzinger J, Peter M, Sippell WG 2005 Congenital adrenal hyperplasia due to 11-hydroxylase deficiency: functional characterization of two novel point mutations and a three-base pair deletion in the CYP11B1 gene. J Clin Endocrinol Metab 90:3724–3730[Abstract/Free Full Text]
  22. Joint LWPES/ESPE CAH Working Group 2002 Consensus statement on 21-hydroxylase deficiency from the Lawson Wilkins Pediatric Endocrine Society and the European Society for Paediatric Endocrinology. J Clin Endocrinol Metab 87:4048–4053[Free Full Text]
  23. Clayton PE, Miller WL, Oberfield SE, Ritzen EM, Sippell WG, Speiser PW 2002 Consensus statement on 21-hydroxylase deficiency from the European Society for Paediatric Endocrinology and the Lawson Wilkins Pediatric Endocrine Society. Horm Res 58:188–195[CrossRef][Medline]
  24. Wester MR, Johnson EF, Marques-Soares C, Dansette PM, Mansuy D, Stout CD 2003 Structure of a substrate complex of mammalian cytochrome P450 2C5 at 2.3 A resolution: evidence for multiple substrate binding modes. Biochemistry 42:6370–6379[CrossRef][Medline]
  25. Schoch GA, Yano JK, Wester MR, Griffin KJ, Stout CD, Johnson EF 2003 Structure of human microsomal cytochrome P450 2C8: evidence for a peripheral fatty acid binding site. J Biol Chem 279:9497–9503
  26. Williams PA, Cosme J, Ward A, Angove HC, Matak Vinkovic D, Jhoti H 2003 Crystal structure of human cytochrome P450 2C9 with bound warfarin. Nature 424:464–468[CrossRef][Medline]
  27. Hasemann CA, Kurumbail RG, Boddupalli SS, Peterson JA, Deisenhofer J 1995 Structure and function of cytochromes P450: a comparative analysis of three crystal structures. Structure 3:41–62[Medline]
  28. Poulos TL 2003 Cytochrome P450 flexibility. Proc Natl Acad Sci USA 100:13121–13122[Free Full Text]
  29. Bottner B, Schrauber H, Bernhardt R 1996 Engineering a mineralocorticoid- to a glucocorticoid-synthesizing cytochrome P450. J Biol Chem 271:8028–8033[Abstract/Free Full Text]
  30. Bottner B, Denner K, Bernhardt R 1998 Conferring aldosterone synthesis to human CYP11B1 by replacing key amino acid residues with CYP11B2-specific ones. Eur J Biochem 252:458–466[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krone, N.
Right arrow Articles by Riepe, F. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krone, N.
Right arrow Articles by Riepe, F. G.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HYDROCORTISONE
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Pediatric Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals