| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Pediatric Endocrinology (N.K., Y.G., M.M., R.E.V., P.-M.H., W.G.S., F.G.R.), Department of Pediatrics, Christian-Albrechts-Universität zu Kiel, Universitätsklinikum Schleswig-Holstein (Campus Kiel), D-24105 Kiel, Germany; Engelhardt Institute of Molecular Biology (Y.G.), Russian Academy of Sciences, Moscow 119991, Russian Federation; and Biochemisches Institut (J.G.), Christian-Albrechts-Universität zu Kiel, D-24098 Kiel, Germany
Address all correspondence and requests for reprints to: Nils Krone, M.D., Division of Pediatric Endocrinology, Department of Pediatrics, Christian-Albrechts-Universität zu Kiel, Universitätsklinikum Schleswig-Holstein (Campus Kiel), Schwanenweg 20, D-24105 Kiel, Germany. E-mail: krone{at}pediatrics.uni-kiel.de.
| Abstract |
|---|
|
|
|---|
Objective: We studied the functional and structural consequences of two CYP11B1 missense mutations, which were detected in a 1.8-yr-old boy with acne and precocious pseudopuberty, to prove their clinical relevance and study their impact on CYP11B1 function.
Results: The in vitro expression studies in COS-7 cells revealed an almost complete absence of CYP11B1 activity for the P94L mutant to 0.05% for the conversion of 11-deoxycortisol to cortisol. The A368D mutant severely reduced the CYP11B1 enzymatic activity to 1.17%. Intracellular localization studies by immunofluorescence revealed that the mutants were correctly localized. Introducing these mutations in a three-dimensional model structure of the CYP11B1 protein provides a possible explanation for the effects measured in vitro. We hypothesize that the A368D mutation interferes with structures important for substrate specificity and heme iron binding, thus explaining its major functional impact. However, according to structural analysis, we would expect only a minor effect of the P94L mutant on 11-hydroxylase activity, which contrasts with the observed major effect of this mutation both in vitro and in vivo.
Conclusion: Analyzing the in vitro enzyme function is a complementary procedure to genotyping and a valuable tool for understanding the clinical phenotype of 11-hydroxylase deficiency. This is the basis for accurate genetic counseling, prenatal diagnosis, and treatment. Moreover, the combination of in vitro enzyme function and molecular modeling provides valuable insights in cytochrome P450 structural-functional relationships, although one must be aware of the limitations of in silico-based methods.
| Introduction |
|---|
|
|
|---|
CYP11B1 deficiency causes a decrease of cortisol synthesis, a subsequent elevation of plasma ACTH level, and accumulation of steroid precursors. The androgen synthesis pathway is flooded by these steroid precursors, resulting in hyperandrogenism. In about two thirds of patients, hypertension can be diagnosed because of an accumulation of 11-deoxycorticosterone and its metabolites. The reactive androgen overproduction in classic 11OHD leads to severe virilization of external genitalia in newborn females and to precocious pseudopuberty combined with rapid somatic growth and bone age acceleration in both sexes (7, 8).
The gene encoding for the 11-hydroxylase (CYP11B1) is located on chromosome 8q21, approximately 40 kb from the highly homologous aldosterone synthase gene (CYP11B2) (9). Although a cluster of mutations has been reported in exons 2, 6, 7, and 8 (10, 11), CYP11B1-inactivating mutations have been shown to be distributed over the entire coding region (8).
In this study, we performed the molecular genetic analysis of the CYP11B1 gene in a patient with 11OHD. The functional analysis of the two missense mutations (P94L and A368D) proved their pathogenicity. The effects of the mutations were rationalized with the help of a three-dimensional molecular model. However, the in vitro enzyme activity for one mutation (P94L) was much lower than expected from the in silico structural changes, which exemplifies the limitations of in silico-based studies.
| Patient and Methods |
|---|
|
|
|---|
The male patient (46, XY) was born at term (38th week of gestation) to healthy parents of North German origin with a birth weight of 3370 g and birth length of 52 cm. Shortly after birth, baby acne was noted and is reported to have persisted throughout the patients history. The psychomotor development was normal. He was first admitted to our endocrine clinic at age 1.8 yr with a length of 92.5 cm and weight of 17 kg. He showed signs of precocious pseudopuberty with a Prader genital stage G3, pubic hair stage P3, and descended testes with a volume of 1 ml each. His bone age was massively accelerated (bone age, 5 yr), and the ultrasound investigations showed enlarged adrenals and normal testes. Blood pressure was in the upper normal range. The multisteroid analysis (12) after a short ACTH test revealed the typical pattern for CAH caused by 11OHD (Table 1
). Plasma dehydroepiandrosterone sulfate (3453 nmol/liter; normal range, 3592 nmol/liter), testosterone (41.7 nmol/liter; normal range, 0.070.37 nmol/liter), and androstenedione (30.7 nmol/liter; normal range, 0.171.36 nmol/liter) were massively elevated. Treatment with hydrocortisone was initiated and at present the boy is doing well with normalized hormonal parameters, loss of pubertal signs, and normalized growth rate.
|
Genomic DNA was prepared from peripheral blood leukocytes, using a standard protocol. The mutation analysis was performed after PCR amplification by direct DNA sequencing of the complete coding region of the CYP11B1 gene, including the intron-exon boundaries as described previously (11). The samples were electrophoresed on an automated ABI PRISM 310 Sequencer (Applied Biosystems Inc., Weiterstadt, Germany) and analyzed with the ABI SeqScape 1.1 software (Applied Biosystems Inc.). The CYP11B1 genomic DNA (gDNA) (GenBank NT_008127) numbering corresponds to +1 of the A of the ATG translation initiation codon. The mutations were designated using the recommendations of the Nomenclature Working Group (13, 14), whereupon the prefix g. indicates the genomic and c. the cDNA sequence position.
The human full-length CYP11B1 cDNA cloned into the pSVL expression vector (provided by Dr. Rita Bernhardt, Institute of Biochemistry, Universität des Saarlandes, Saarbrücken, Germany) (15) was amplified with the primers CYP11B-F-BamHI (GGGGGGATCCATGGCACTCAGGGCAAAGGC) and CYP11B1-R-XbaI (GGGCCTCTAGATTAGTTGATGGCTCTGAAGGTGAG). The sequences introducing the BamHI and XbaI restriction sites are underlined. The PCR products were digested with BamHI and XbaI and inserted by a ligation reaction into a BamHI/XbaI-linearized pcDNA3.1 expression vector. The mutagenesis was performed from the pcDNA3.1-CYP11B1 construct, using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, Amsterdam, The Netherlands). The introduction of the P94L and the A368D mutations was checked by sequencing the entire BamHI/XbaI insert. To ensure the integrity of the expression plasmid, the mutated CYP11B1-cDNA fragments were recloned into the BamHI/XbaI site of a newly restricted pcDNA3.1 expression vector, resulting in the pcDNA3.1-CYP11B1-P94L and pcDNA3.1-CYP11B1-A368D constructs.
In vitro expression and assays of enzyme activity
COS-7 cells were transiently cotransfected after growing to a density of approximately 2 x 106 cells, using lipofectamine (Invitrogen, Karlsruhe, Germany) with 1 µg of each pcDNA3.1-CYP11B1 construct, 0.5 µg adrenodoxin (pECE-Adx), and 0.5 µg adrenodoxin reductase (pECE-AR) expression vectors, kindly provided by Dr. W. L. Miller (Department of Pediatrics, University of California, San Francisco, CA), and 1 µg Renilla cDNA (Promega, Mannheim, Germany). The posttransfection treatment was performed following a standard protocol (Invitrogen) using DMEM supplemented with glutamine, antibiotics, and 10% fetal calf serum.
The activity assays were performed 48 h after transfection, measuring the 11-hydroxylase activity in intact COS-7 cells. The cells were incubated for 24 h at 37 C with 1 ml full DMEM containing 0.2 µCi 3H-labeled 11-deoxycortisol and 250 nmol/liter unlabeled 11-deoxycortisol. After incubation, steroids were extracted from the culture medium with ice-cold methylene chloride, evaporated to dryness, and dissolved in ethanol. The steroids were separated by thin layer chromatography (TLC) using methylene chloride:methanol:water (300:20:1, vol/vol/vol). The radioactivity was directly measured from the TLC plates using the Rita Star TLC-Scanner (Ray Test, Straubenhardt, Germany). The chromatographs were analyzed using the Rita TLC analysis software version 1.97. Cells were trypsinized and lysed in lysis buffer (Promega) followed by determination of protein content according to the manufacturers protocol.
The 11-hydroxylase activity of the mutants was expressed as a percentage of substrate conversion in nanomoles per milligram per minute, taking the activity of cells expressing the CYP11B1 wild-type protein as 100% after correction for total protein and for the activity of cells transfected with the empty pcDNA3.1 vector. The enzymatic activity was calculated using the GraphPad Prism software version 4.0.
To ensure the expression and translation of the intact CYP11B1 wild-type and CYP11B1 mutant proteins, a Western blot analysis using an antihuman-CYP11B rabbit antiserum kindly provided by Dr. H. Takemori (Department of Molecular Physiological Chemistry, Osaka University Medical School, Osaka, Japan) was used in a standard protocol.
Immunofluorescence studies
The immunofluorescence was performed using a standard protocol. The antihuman-CYP11B rabbit antiserum used for the Western blot was used as primary antibody in combination with a mouse anti-Grp75 antibody (BIOMOL, Hamburg, Germany). Each antibody was used in a 1:200 dilution. The antibodies antirabbit-ALEXA Fluor 488 and antimouse- ALEXA Fluor 594 (Molecular Probes, Leiden, The Netherlands) were used as secondary antibodies in 1:500 dilutions. The slides were mounted with Vectorshield mounting medium (Vector Laboratories, Burlingame, CA) allowing for nuclear 4',6-diamidino-2-phenylindole staining.
Molecular modeling
To substantiate the relatedness of the human CYP11B1 protein to the overall fold of the cytochrome P450 family revealed by homology analyses, we used a fold recognition algorithm to show that the human CYP11B1 sequence is compatible with the architecture of this family (ProHit package; ProCeryon Biosciences GmbH, Salzburg, Austria). The template structure with the highest score of the pair potential was the x-ray structure of the mammalian cytochrome CYP2C5 (PDB accession code 1DT6), which served as the template for the three-dimensional model of CYP11B1. According to the alignment obtained by the fold recognition procedure, amino acid residues were exchanged in the template. Insertions and deletions in CYP11B1 were modeled using a database-search approach included in the software package WHATIF (16). Finally, these model structures were energy minimized using the steepest descent algorithm implemented in the GROMOS program package (van Gunsteren, W. F., BIOMOS Biomolecular Software BV, Laboratory of Physical Chemistry, University of Groningen, Groningen, The Netherlands). The structural representations were generated using the programs Deep View/Swiss-PDB Viewer (http://www.expasy.org/spdbv/) (17) and POVRAY (The Persistence of Vision Raytracer; http://www.povray.org).
| Results |
|---|
|
|
|---|
Confirmation analysis by complete DNA sequencing of the CYP11B1 gene revealed two missense mutations in compound heterozygous state in the patient (Fig. 1
). He carried a heterozygous C to T substitution at bp 668 (g.668C>T, corresponding to c.281C>T) in exon 2 on the maternal allele. This mutation results in a substitution of leucine for proline at amino acid position 94 (P94L) of the CYP11B1 protein, which has been recently described (18). A heterozygous change from C to A at bp 4084 (g.4084C>A, corresponding to c.1103C>A) in exon 6 was detected on the paternal allele. The g.4084C>A missense mutation leads to a change from alanine to aspartic acid at amino acid position 368 (A368D) of the 11-hydroxylase protein.
|
Analyzing the CYP11B1 mutants in the in vitro expression system revealed that the P94L mutation leads to an almost complete absence of 11-hydroxylase activity [0.05 ± 1.9% (SD)] for the conversion of 11-deoxycortisol to cortisol. The A354D mutant also resulted in severe reduction of CYP11B1 enzyme activity (1.17 ± 1.9%) (Fig. 2
).
|
|
| Discussion |
|---|
|
|
|---|
This will provide more exact information for the physician and result in better patient counseling. A cluster of mutations in exons 6, 7, and 8 has been described (10), and a mutational hot spot has been proposed in exon 5 (20). Although the novel mutation described in this report (A368D) is also located in exon 6, many other mutations spread all over the CYP11B1 gene have been reported (8). Thus, there is no hotspot that can be used for a comprehensive genetic screening strategy so that complete sequencing at least of the coding region and intron-exon boundaries is necessary. The rapid and comprehensive elucidation of novel mutations in CYP11B1 and in particular the detailed analysis of their structural, enzymatic, and clinical consequences is becoming increasingly important in modern pediatric endocrinology.
For analyzing the putative effect of the CYP11B1 mutations, the structural model of the human CYP11B1 protein was built by using the x-ray structure of the mammalian CYP2C5 as a template. The proline at amino acid residue 94 (P94) of the CYP11B1 protein is located at the N terminus of the B helix (Fig. 4
, A and B1). This amino acid is highly conserved in the CYP11B1 and CYP11B2 proteins of human, mouse (GenBank B41552; P15539), and rat (GenBank NP_036669; AAB60457). It is not found at the corresponding position in human steroid hydroxylases CYP21 (GenBank P08686), CYP17 (GenBank AAH63388), and CYP19A1 (GenBank P11511), in human CYP4B1 (GenBank AAH17758), and in the crystallized mammalian P450 cytochrome enzymes such as CYP2C5 (PDB code 1DT6) (24), CYP2C8 (PDB code 1PQ2) (25), and CYP2C9 (PDB code 1OG2) (26). The P94 residue is located in close proximity to the L410 and G411 residues (Fig. 4B
1) in the loop that connects helices K and L containing the highly conserved motifs of CYP450s: the meander region and the Cys pocket (27). Moreover, the B-C loop, which in several cytochrome P450 enzymes contains an additional small B' helix, is part of different helices sliding over the surface of the I helix allowing substrate access to the active side (28). We speculate that a mutation of P94 will change the orientation of the B helix relative to the enzyme and consecutively change the access-channel configuration. The other possibility might be a change of the K-L loop orientation involving highly conserved functional motifs of the CYP11B1 enzyme. Although these explanations are plausible, changing the residue P94 to leucine did not result in a dramatic change of the protein structure in the model (Fig. 4B
2). Thus, the severe decrease of the P94L mutation in the in vitro function is unexpected from the protein structure. However, this proves the functional importance of the proline residue at position 94 in the CYP11B1 protein.
|
Analyzing the functional and structural consequences of CYP11B1 gene mutations leading to 11OHD is an important requisite for assessing a patients clinical phenotype. Although combining in vitro expression studies with protein structure analysis is a powerful tool to provide new insights in the understanding of structural-functional relationships, one should be aware of the limitations of in silico-based methods as has been exemplified by the P94L mutation.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online May 2, 2006
Abbreviations: CAH, Congenital adrenal hyperplasia; CYP11B1, 11-hydroxylase; 11OHD, 11-hydroxylase deficiency; TLC, thin layer chromatography.
Received January 31, 2006.
Accepted April 21, 2006.
| References |
|---|
|
|
|---|
G transversion in exon 7 of CYP11B1. Biochem Biophys Res Commun 216:723728[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |