help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-0188
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robinson-White, A.
Right arrow Articles by Stratakis, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson-White, A.
Right arrow Articles by Stratakis, C. A.
Related Collections
Right arrow Adrenal and Hypertension
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 6 2380-2388
Copyright © 2006 by The Endocrine Society

PRKAR1AMutations and Protein Kinase A Interactions with Other Signaling Pathways in the Adrenal Cortex

Audrey Robinson-White, Elise Meoli, Sotirios Stergiopoulos, Anelia Horvath, Sosipatros Boikos, Ioannis Bossis and Constantine A. Stratakis

Section on Endocrinology and Genetics (A.R.-W., E.M., S.S., A.H., S.B., I.B., C.A.S.) and Pediatric Endocrinology Training Program (C.A.S.), Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Constantine A. Stratakis, M.D., D(Med)Sc., Chief, Section on Endocrinology and Genetics, and Director, Pediatric Endocrinology Training Program, Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Building 10, Clinical Research Center, Room 1-3330, 10 Center Drive, MSC1103, Bethesda, Maryland 20892. E-mail: stratakc{at}mail.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Context: Primary pigmented nodular adrenocortical disease, associated with Carney complex, is caused by mutations in PRKAR1A (mt-PRKAR1A), a gene that codes for the regulatory subunit type 1{alpha} (RI{alpha}) of cAMP-dependent protein kinase (PKA). PRKAR1A inactivation is associated with dysregulated PKA activity that is thought to result in tumorigenesis. mt-PRKAR1A-bearing lymphocytes from Carney complex patients exhibit enhanced cell proliferation associated with increased expression of the MAPK ERK1/2 pathway.

Objective: The objective of the study was to determine how PKA and its subunits and ERK1/2 and their molecular partners change in the presence of PRKAR1A mutations in adrenocortical tissue.

Design: PKA activity and subunit expression, ERK1/2, other immunoassays, and immunohistochemistry on adrenocortical samples from patients with germline normal or mt-PRKAR1A were analyzed.

Results: Increased cAMP-stimulated total kinase activity was associated with mt-PRKAR1A. PKA subunit expression analysis in mt-PRKAR1A tissues, by quantitative mRNA assay and immunoblotting, showed a 2.4-fold (P = 0.02) and 1.8-fold (P = 0.09) decrease in RI{alpha}’s message and protein, respectively, and increases in other PKA subunits. Immunoassays showed 2-fold (P = 0.03) and 6-fold (P = 0.03) decreases in baseline ERK1/2, with corresponding increases in phosphorylated (p) ERK1/2 in mt-PRKAR1A samples. B-raf kinase, p-MEK1/2, and p-c-Myc, but not p-Akt/protein kinase B, were significantly increased. Immunohistochemistry studies supported these data.

Conclusions: mt-PRKAR1A causes increased total cAMP-stimulated kinase activity, likely the result of up-regulation of other PKA subunits caused by down-regulation of RI{alpha}, as seen in human lymphocytes and mouse animal models. These changes, associated with enhanced MAPK activity, may be, in part, responsible for the proliferative signals that result in primary pigmented nodular adrenocortical disease.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
PRIMARY PIGMENTED NODULAR adrenocortical disease (PPNAD) is a rare form of bilateral hyperplasia of the adrenal glands that leads to pituitary-independent hypercortisolism and Cushing syndrome. It is characterized by small pigmented nodules, surrounded by an atrophic cortex in an often normal-sized gland (1). PPNAD may be isolated or associated with Carney complex (CNC), a multiple neoplasia syndrome inherited in an autosomal dominant manner (2, 3). Both CNC and isolated PPNAD are most often caused by PRKAR1A mutations (4, 5), a gene that encodes for the type 1{alpha} regulatory subunit (RI{alpha}) of the cAMP-dependent protein kinase A (PKA). Absence or deficiency of RI{alpha} and tumor-specific loss of heterozygosity within the chromosomal regions harboring PRKAR1A have been associated with dysregulated PKA activity and tumorigenicity in CNC-affected tissues and mouse models of PRKAR1A down-regulation (6, 7, 8, 9).

PKA is a holoenzyme that consists of two homo- (and rarely hetero-) dimers of two regulatory (R) subunits (RI{alpha} and RII{alpha}) and two catalytic (C) subunits (C{alpha}, Cß, or C{gamma}) (10). Activation of PKA by the binding of two molecules of cAMP to each R subunit leads to disassociation of the R molecules from the PKA tetramer and release of the C subunits (10). The C subunits are serine-threonine kinases that phosphorylate a series of targets, including components of the MAPK cell signaling system (11, 12, 13). MAPKs mediate a diverse number of cellular processes (e.g. proliferation, differentiation, survival, and apoptosis) and consist of separate and interacting cascades, composed of three core-member modules. The ERK1/2 cascade core members include the Raf kinases (A, B, and c-Raf-1), MEK1/2, and the final MAPK ERK1/2 (13). Upon receptor activation (usually a receptor tyrosine kinase), the small G protein Ras is stimulated to phosphorylate and activate the three core-member cascade. Each core member phosphorylates and activates the succeeding member until the final core member, ERK1/2, activates downstream kinases and transcription factors (e.g. c-Fos, c-Jun, c-Myc) for a cell response (13, 14). The PKA pathway is known to interact with a number of other signal transduction pathways (14). In most tissues, PKA appears to inhibit the ERK1/2 cascade of the MAPK pathway at the level of c-Raf-1, causing a cell type-specific inhibition of MAPK activity and cell proliferation (15, 16).

Our studies (16) in Epstein-Barr virus-transformed B lymphocytes bearing mutated (mt)-PRKAR1A showed that RI{alpha} deficiency may lead to reversal of PKA-mediated inhibition of MAPK signaling. We proposed that this was due to dysregulated PKA activity in response to cAMP, an observation that was further supported by an increase in type II PKA subunits, as has been shown in other in vivo and in vitro models of RI{alpha} deficiency (7, 8, 9, 17, 18, 19). In the present study, we examined adrenoglandular tissues from patients with and without PRKAR1A mutations for the expression of the PKA subunits at the mRNA and protein level, PKA enzymatic activity, and the expression and phosphorylation status of ERK1/2 and other molecular partners of the MAPK signaling system. Because in many cell types (20, 21), Akt/protein kinase B (PKB) inhibits both B and c-Raf-1 kinase activity of MAPK, we also included Akt/PKB in these studies. The data confirm observations in other human tissues and mouse models with RI{alpha} deficiency and are consistent with the notion that tumorigenicity of mt-PRKAR1A in the adrenal cortex is associated with the perturbation of PKA activity, tissue-specific up-regulation of other PKA subunits, and activation of MAPK signaling.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Patients and tissue collection

Adrenal tissue was collected from 21 patients during surgery (Table 1Go). Human studies were approved by the National Institute of Child Health and Human Development Institutional Review Board under protocols 95CH0059 and 00CH0160. Tissue was immediately snap frozen in liquid nitrogen after careful dissection of periadrenal fat and fibrous tissue by the investigators and kept at –70 C. DNA extracted from tissue was screened for the presence of mutations in the PRKAR1A gene by standard methods published elsewhere (22). Tissue samples included one from a patient with multiple cortisol-producing adenomas, two from patients with single cortisol-producing adenomas, four from patients with micronodular hyperplasia, 11 from patients with PPNAD and CNC, and three from patients with isolated PPNAD. The patients, their mutation status, and clinical profiles are shown in Table 1Go.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Patient diagnoses and PRKAR1A mutation status

 
Materials

Materials were from the following sources: phenylmethaneosulfonyl fluoride from Sigma-Aldrich (St. Louis, MO); leupeptin, aprotinin and 4-nitrophenylphosphate, superscript RNase II reverse transcriptase, Light Cycler apparatus from Roche Molecular Biochem (Indianapolis, IN); phospho-anti-ERK1/2, anti-ERK1/2, anti-MEK1/2, and anti-Akt/PKB, from Cell Signaling (Beverly, MA); phospho-anti-MEK1/2 and phospho-anti-c-Myc from Santa Cruz Biotechnology (Santa Cruz, CA); phospho-c-Raf-1 from BD Biosciences (San Jose, CA); antimouse IgG from Oncogene Research Products (Darmstadt, Germany); B-raf kinase cascade assay kit from U.S. Biologicals (Swampscott, MA); BCA protein assay kit from Pierce (Rockford, IL); BSA fraction V from ICN Biochemicals (Irvine, CA); 10 x Tris/glycine/sodium dodecyl sulfate (SDS) buffer, 10 x Tris/glycine buffer, blotting grade nonfat dried milk, and Tween 20 from Bio-Rad (Hercules, CA); Protran nitrocellulose membranes from Schleicher and Schuell (Keene, NH); Novex 10% Tris/glycine gels, TRIZol reagent from Invitrogen (Carlsbad, CA); enhanced chemiluminescence blotting detection reagent and deoxyadenosine 5'-[{gamma}-32P]triphosphate from Amersham Pharmacia (Piscataway, NJ); and RNeasy minikit from QIAGEN (Valencia, CA).

PKA activity determinations

PKA activity was measured as described previously (6, 16), using [{gamma}-32P] deoxy-ATP in cell extracts that had been snap frozen in liquid nitrogen. Total kinase activity represents enzymatic activity after stimulation with cAMP. Total PKA-specific activity represents the difference between PKA activity before and after the addition of protein kinase inhibitor (PKI). A ratio was calculated after the determination of free PKA activity, according to the following formula: PKA activity ratio = free PKA activity (bound PKA, in units/milligram protein content)/total PKA activity (unbound PKA, in units/milligram protein content).

All determinations of PKA activity were performed twice per sample, corrected for protein content (per milligram of total protein), and an average value was calculated for each experiment.

mRNA quantitation

Total tissue RNA was extracted using TRIzol reagent and purified using the RNeasy minikit. The quality and quantity of the extracted total RNA were assessed by formaldehyde agarose gel electrophoresis and spectrophotometric UV absorbance at 260/280 nm, respectively. The specimens that were used are listed in Table 1Go. One microgram of total RNA was reverse transcribed to cDNA by Superscript II RNase H-reverse transcriptase with Oligo dT primer according to the manufacturers’ instructions. The quantitative real-time reaction was carried out and analyzed using ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City, CA). The primers and probes for the PRKAR1A, PRKAR1B, PRKAR2A, PRKAR2B, and PRKACA (BioServe Biotechnologies, Laurel, MD), were: PRKAR1A forward primer, TGAATCGTCCTCGTGCTGC; PRKAR1A reverse primer, TCGGTCCAGCTTAACGCACT; PRKAR1A probe (TET), ACAGTTGTTGCTCGTGGCCCCTTG; PRKAR1B forward primer, GGCGCATCCTTATGGGC; PRKAR1B reverse primer, ATGGAGACCTTGCTGAGGAACTC; PRKAR1B probe (TET), CACGCTGAGGAAACGCAAGATGTACG; PRKAR2A forward primer, TACACGGTGGAGGTGCTGC; PRKAR2A reverse primer, AGGCGGGTGAAGTACTCCACT; PRKAR2A probe (TET), AGCAGCCGCCTGACCTCGTCG; PRKAR2B forward primer, CCTTGGGTTTCCGTTCTTTCT; PRKAR2B reverse primer, CCCATATTGGCTGCTGATCA; PRKAR2B probe (TET), AGGATGGTTGCCAACCCACAATCTCA; PRKACA forward primer, GACCTGAAGCCGGAGAATCTG; PRKACA reverse primer, TGGCGAAACCGAAGTCTGTC; PRKACA probe (TET), TCATTGACCAGCAGGGCTACATTCAGG.

All probes were TET labeled. The method of relative quantitation using a standard curve was applied. Normal adrenal RNA was used as a calibrator. In brief, the total reaction volume per sample was 20 µl and contained 2 µl from the cDNA synthesis reaction, 10 pmol of each primer and the probe in 1x TaqMan Universal Master Mix. Cycling was as follows: 2 min at 50 C, 10 min at 95 C, and 40 cycles at 95 C for 15 sec, 1 min at 60 C. Results were normalized against the expression of the housekeeping gene, GAPDH. Points for the standard curves and samples were performed in quadruplicate.

Electrophoretic separation and immunoblotting

The following procedure was performed as previously described (16). Tissues were lysed in lysis buffer [20 mM HEPES, 10% glycerol, 1% Triton X-100, 50 mM NaF, 1 mM NaVo4, 0.02 mg/ml aprotinin, 0.02 mg/ml leupeptin, 1 mM phenylmethaneosulfonyl fluoride, and 2.5 mM 4-nitrophenylphosphate (pH 7.3)] and sonicated for 45 sec at 4 C. Protein assays were performed on the complete cell lysate. The lysate was diluted to 1.5–2.5 µg/ml protein with lysis buffer. Samples were mixed 1:3, sample to 1 M Tris/SDS buffer [0.01% Bromophenol Blue, 30% glycerol and 8% B-mercaptoethanol, 6.8% SDS (pH 6.8)], boiled for 4 min, and run on 10% Tris/glycine gels. Protein was transferred to 0.2 µM nitrocellulose membranes. Membranes were blocked (1 h, room temperature) with 7% nonfat dried milk in Tris-buffered saline [with 1% Tween 20(TBST)]. ERK1/2 and phosphorylated proteins were detected using primary antibodies, diluted in 5% BSA in TBST, and horseradish peroxidase-conjugated secondary antibodies against mouse or rabbit IgG, diluted in 7% nonfat dried milk in TBST. Bands were detected by enhanced chemiluminescence reagent and densitometer scanning (Molecular Dynamics, Sunnyvale, CA).

B-Raf kinase assay

B-Raf kinase activity was measured using a B-raf kinase cascade assay kit. Briefly, tissue lysates, in ice-cold lysis buffer A (as in the above), were clarified at 10,000 rpm for 20 min at 4 C. Supernatants were incubated with Mg2+/ATP, unactive glutathione-S-transferase (GST)-tagged MAPK kinase (MEK)1 fusion protein, and dilution buffer, shaking for 30 min at 30 C, according to the manufacturer’s directions. Samples were mixed 1:2 with a 1 M Tris buffer (pH 6.8), containing 4% SDS, 0.010% Bromophenol Blue, 20% glycerol, and 5% B-mercaptoethanol. Phosphorylated GST-tagged MEK1, released by the reaction of tissue B-raf kinase and unactive GST-tagged MEK1, was detected using phospho-anti-GST-tagged MEK1/2 by gel electrophoresis and immunoblotting assays as stated in the above.

Immunohistochemistry

Sections from paraffin-embedded samples from all patients were hybridized with the commercially available antibodies specific for p-ERK1/2, RI{alpha}, and the other main PKA subunits (RII{alpha}, RIIß, and C{alpha}) (BD Biosciences, San Jose, CA) and Akt as described previously (22). Two blinded readers graded specimens carrying normal PRKAR1A sequence with those that had mutations. Staining was assigned one of four grades: 0 for nonstaining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining.

Statistics

Data were analyzed using the SAS Institute general linear model procedure (SAS Institute, Cary, NC). All experiments were performed at least twice. In most cases, log-transformed data were used to remedy for nonhomogeneity of variance. Tukeys’ test was used to compare differences between treatments. Differences were considered significant at P ≤ 0.05. P < 0.1 was interpreted as showing a tendency toward significance.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Analysis of basal and cAMP-stimulated PKA activity

Basal PKA activity measurements indicated a 1.5-fold increase in PKA activity in mt-PRKAR1A PPNAD tissues over those with normal sequence, which, however, was not statistically significant (499 ± 25 cpm/mg protein vs. 333 ± 26 cpm/mg protein; P = 0.39). After exposure to cAMP, total PKA activity was increased in mt-PRKAR1A tissues: there was a more than 2.5-fold greater increase in tissues with mutations (1218 ± 252 cpm/mg protein) vs. those with normal PRKAR1A sequence (454 ± 30 cpm/mg protein). Free kinase activity in both normal and mt-PRKAR1A tissues was reduced to equal levels in both groups (up to 51% of original values) by the PKA-specific inhibitor, PKI (Fig. 1AGo). Thus, total PKA activity was significantly higher in mt-PRKAR1A samples (10.6 ± 2.4 U/mg) vs. that in tissues with normal PRKAR1A sequence (2.92 ± 0.22 U/mg; P = 0.05), and accordingly, the PKA ratio, a measure of R1{alpha} activity (6), was higher in tissues that did not have PRKAR1A-inactivating mutations: (0.56 ± 0.20) vs. mt-PRKAR1A-bearing tissues (0.15 ± 0.041) (Fig. 1BGo, P < 0.01).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1. PKA activity ratio in normal (n = 10) and mt-PRKAR1A sequence adrenal tissues (n = 10), PKA subunit mRNA, and protein expression levels. A, PKA activity levels are given at baseline and after exposure to cAMP and cAMP and the PKA-specific inhibitor, PKI. B, PKA activity ratio is calculated as the ratio between free (basal) and total PKA activity. Values are given as PKA activity (counts per minute x 102) and the ratio of free to total PKA activity for A and B, respectively. Values are mean ± SEM. C, Relative expression of mRNA for all PKA subunits (RI{alpha}, RII{alpha}, RIß, RIIß, and C{alpha}) in normal (n = 5) and mt-PRKAR1A (n = 10) adrenocortical tissues corrected for glyceraldehyde-3-phosphate dehydrogenase and their expression in normal tissue. D, RI{alpha} to other PKA subunits ratio (mean ± SEM) confirms the significant decrease of RI{alpha} in mt-PRKAR1A tissues. E, PKA subunit protein levels are given as relative band OD/B-actin in arbitrary units. F, Ratio of RI{alpha} protein to other PKA subunit protein (mean ± SEM) confirms the significant decrease of RI{alpha} protein in mt-PRKAR1A tissues. *, P < 0.05.

 
Analysis of mRNA and protein levels for PKA subunits

Quantitative real-time PCR demonstrated variable but detectable levels of the four mRNA regulatory subunits (RI{alpha}, RIß, RII{alpha}, and RIIß) of PKA as well as the catalytic subunit C{alpha}. There was a 2.4-fold (0.34 ± 0.04 vs. 0.14 ± 0.06) decrease (P = 0.02) in the levels of the RI{alpha} subunit mRNA in mt-PRKAR1A tissues (Fig. 1CGo). Conversely, in mutant tissues, there was a significant increase in the ratio of mRNAs for the type II over those for type I PKA subunits (P = 0.02) (Fig. 1DGo), although the most significant individual subunit increase was that of RIß.

Western blot analysis of the PKA subunits (Fig. 1EGo) indicated the presence of all four PKA regulatory subunits (RI{alpha}, RIß, RII{alpha}, and RIIß), as well as the catalytic subunit C{alpha}, in both normal and mt-PRKAR1A tissues. Levels of RI{alpha} were decreased in mt-PRKAR1A tissues by 1.8-fold (2.21 ± 0.2 vs. 1.17 ± 0.15), a difference that had a tendency toward significance (P = 0.09); accordingly, the ratio (Fig. 1FGo) of RI{alpha} to all other PKA subunits was lower in mt-PRKAR1A tissues (0.53 ± 0.26) vs. than in tissues with normal PRKAR1A sequence (0.73 ± 0.3) (P = 0.04). As in the mRNA studies, there was an overall significant increase in type II (RIß and RIIß) over type I PKA subunits in mt-PRKAR1A tissues, although again the most significant single increase was that of RIß (0.32 ± 0.002 vs. 0.1 ± 0.001, P = 0.005) (Fig. 1EGo).

ERK1/2 and other MAPK components, c-Myc and Akt/PKB

The ratio of phosphorylated (p) ERK1/2 to baseline (unphosphorylated) ERK1/2 was 1.3 ± 0.16 vs. 0.45 ± 0.01 and 0.73 ± 0.1 vs. 0.6 ± 0.05, respectively, both significantly greater in mt-PRKAR1A tissues (Fig. 2Go). Specifically, levels of ERK1 and ERK2 were 2-fold (0.43 ± 0.25 vs. 0.22 ± 0.001) and 6-fold (1.09 ± 0.25 vs. 0.19 ± 0.05; P = 0.03) greater in normal than in mt-PRKAR1A tissues, respectively (Fig. 2AGo). The levels of pERK1/2, however, were changed to the opposite direction: there was a 3-fold (0.33 ± 0.04 vs. 0.1 ± 0.02) and 7-fold (0.8 ± 0.14 vs. 0.12 ± 0.05) increase in mt-PRKAR1A-containing tissues for pERK1 and pERK2, respectively (Fig. 2BGo).


Figure 2
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. Basal ERK1/2 and pERK1/2, ERK1/2 pathway components, basal levels of B-raf kinase, and phosphorylated c-Raf-1 (p-c-Raf-1) in normal and mt-PRKAR1A tissues: basal ERK1/2 (A) and pERK1/2 (B) were assayed; values are mean ± SEM of four and seven experiments for ERK1/2 and pERK1/2, respectively, for a total of nine normal PRKAR1A and nine mt-PRKAR1A samples. The bands are representative of one experiment for both mt-PRKAR1A (M) and normal sequence (N) tissues. B-raf kinase activity was measured using a B-raf kinase assay kit with Mg2+/ATP, unactive GST-tagged MEK1/2, and assay dilution buffer for 30 min at 30 C, according to the manufacturers’ instructions (see Patients and Methods). GST-tagged pMEK1/2, released in the reaction by tissue B-Raf kinase and unactive GST-tagged MEK1/2 (C). p-c-Raf-1 was detected by gel electrophoresis and immunoblotting. Values are mean ± SEM of four experiments for a total of six samples with normal sequence (N) and six samples with a mt-PRKAR1A (M) sequence. The bands under each graph are representative of one experiment for both M and N tissues (D). All blots were reprobed with B-actin for experimental normalization. Values represent relative band density/B-actin in arbitrary units. *, P < 0.05.

 
Basal levels of other ERK1/2 cascade phosphorylated components (i.e. c-Raf-1 and MEK1/2) and B-raf kinase activity were also determined by immunoassay. B-Raf kinase activity (Fig. 2CGo) and phosphorylated MEK1/2 (Fig. 3AGo) were found to be 3.5-fold (0.63 ± 0.08 vs. 0.18 ± 0.02, P = 0.05) and 2.3-fold higher (0.17 ± 0.7 vs. 0.075 ± 0.020, P = 0.008), respectively, in mt-PRKAR1A vs. those in tissues with normal sequence. Phosphorylated c-Raf-1 was not different in the two groups of samples (Fig. 2DGo).


Figure 3
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Basal levels of pMEK1/2 (A), p-c-Myc (B), and pAkt/PKB (C). Levels were detected by gel electrophoresis and immunoblotting. Values represent relative band density/B-actin in arbitrary units, mean ± SEM, for a total of six samples with normal sequence (N) and six samples with a mt-PRKAR1A (M) sequence. *, P < 0.05.

 
Levels of the phosphorylated transcription factor c-Myc (p-c-Myc; Fig. 3BGo) were increased in mt-PRKAR1A tissues by 3.4 (0.14 ± 0.03 vs. 0.041 ± 0.017, P = 0.03). There was a moderate increase of the cell signaling protein kinase Akt/PKB (p-c-Akt/PKB; Fig. 3CGo) by 1.6-fold (0.96 ± 0.1 vs. 0.6 ± 0.1), which, however, was not statistically significant (P = 0.4). No significant differences were detected in levels of the whole proteins B-raf and MEK1/2 (data not shown).

Immunohistochemistry

Immunostaining of mt-PRKAR1A tissues and other specimens for the various PKA subunits, ERK1/2 and Akt/PKB, confirmed the message and protein data presented above: R1{alpha} immunostaining was decreased in tissues with mt-PRKAR1A sequence, especially within the nodules. Relative up-regulation of the other PKA subunits was seen in these tissues (Fig. 4AGo), as has been suggested elsewhere (7, 22). Consistent with the immunoassays presented above, pERK immunostaining was present in nodular tissue in PPNAD (Fig. 4BGo, panels 1–3), whereas very little pERK was present in normal adrenocortical tissue (Fig. 4BGo, panel 4). On the other hand, Akt/PKB’s staining of PPNAD samples with mt-PRKAR1A was inconsistent, with some nodules showing intense staining and others being devoid of any expression (Fig. 4Go, panel 5); staining of the former was almost exclusively cytoplasmic (Fig. 4Go, panel 6).


Figure 4
View larger version (116K):
[in this window]
[in a new window]
 
FIG. 4. A, Immunostaining for R1{alpha}, RII{alpha}, and RIIß in adrenocortical hyperplasia with a normal PRKAR1A sequence (panels 1–3) (CAR509.01, Table 1Go) and PPNAD with mt-PRKAR1A sequence (panels 4–6) (sample CAR01.02, Table 1Go). There is decreased staining for R1{alpha}, especially within the nodules (panel 4), whereas the other two PKA subunits are increased. B, Immunostaining for pERK1/2 and Akt/PKB; pERK1/2 antibodies stain intensely in PPNAD with mt-PRKAR1A sequence (panels 1–3) (sample CAR01.02, Table 1Go) but not normal adrenal cortex (panel 4). The staining is both cytoplasmic and nuclear (panels 2 and 3, magnification x20 and x60, respectively). An antibody for Akt/PKB stains inconsistently nodular cells (arrow) within the same PPNAD sample (panel 5, x10); staining is mainly cytoplasmic (panel 6, x40).

 

    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
The present study showed that RI{alpha} down-regulation and the previously identified high total kinase activity in mt-PRKAR1A PPNAD tissues (6) are associated with an increase in the overall presence of type II PKA subunits. This is consistent with findings in sporadic human adrenocortical tumors (22) and animal models of PKA dysfunction (7, 8, 9, 17). How these abnormalities lead to increased proliferation of mt-PRKAR1A adrenocortical cells remains unknown. In mouse Y1 adrenocortical tumor cells, growth and proliferation are overseen by several opposing and highly complex regulatory mechanisms (23, 24, 25, 26). Y1 cells appear to possess an amplified and constitutively expressed c-Ki-Ras that elicits an increased mitogenic response triggered by fibroblast growth factor (FGF) type 2 signaling at a receptor tyrosine kinase. The ERK1/2 cascade of MAPK is then rapidly activated, leading to induction of c-Fos and c-Jun, activation and stabilization of c-Myc by phosphorylation at Ser62 (23, 27, 28, 29), expression of cyclins D1 and E, and phosphorylation of the retinoblastoma protein, which leads to activation of the cell cycle and stimulation of DNA synthesis (23, 30). Y1 cells also contain relatively high amounts of constitutively activated Akt/PKB that is dependent on c-Ki-Ras and phosphatidylinositol-3 kinase (PI3K) activities (23, 24). Activated Akt/PKB can enhance the mitogenic response to FGF2 by phosphorylating and inactivating glycogen synthase kinase (GSK) 3 that normally targets c-Myc for degradation by the ubiquitin proteasome system (UPS) (23, 31, 32, 33) and also in many cancer cell systems can inactivate p27kip-1 to promote cell survival (26, 34). Akt/PKB has also been shown to inhibit B-raf kinase activity by phosphorylation at multiple residues and inhibit c-Raf-1 kinase in many mammalian cell types (20, 21), whereas basal B-raf activity is normally 15- to 20-fold higher than c-Raf-1 (35).

ACTH may act, through cAMP and independently of FGF2, to induce some of the same key players in adrenocortical cells, such as the c-fos and c-jun proteins at a point upstream of MEK1/2 and ERK1/2, to trigger a mitogenic response. Overall, however, proliferative responses to ACTH are up to 10-fold less significant than those of FGF2 (25, 27, 28, 30, 36, 37, 38), and ACTH levels in adrenal disorders associated with Cushing syndrome are low to undetectable. Furthermore, under certain conditions, ACTH has also been shown to have a strong antimitogenic effect, exerted via the PKA pathway (23, 24, 30); this effect may be through dephosphorylation of Akt/PKB, which releases its inhibitory effect on GSK3. GSK3, in turn, phosphorylates c-Myc (at Thr58), which leads to the latter’s degradation by UPS (23, 31). Thus, FGF2-induced S-phase entry can be blocked by a cAMP/PKA-dependent process; this potential ACTH-induced antimitotic effect is also not restricted by the presence of oncogenic c-Ki-Ras (39, 40).

In this study, using adrenocortical tissue from individuals with and without PRKAR1A mutations, we have shown that cAMP/PKA may have a similar effect on the ERK1/2 cascade of MAPK and c-Myc stabilization as seen in Y1 adrenocortical tumor cells and other cancer types (Fig. 5Go). As was shown in our previous studies in Epstein-Barr virus-transformed normal and mt-PRKAR1A B lymphocytes (16) and in the studies of others (11, 12, 13), PKA may alter the ERK1/2 cascade of MAPK in normal tissue by an effect on c-Raf-1 kinase, with a subsequent decrease in phosphorylated MEK1/2 (Fig. 3AGo), ERK1/2 (Fig. 2BGo), and c-Myc (Fig. 3BGo), which may lead to a decrease in cell proliferation (16). Although in the present study, there was no significant difference seen in phosphorylated c-Raf-1 (Fig. 2DGo) in normal and mutant tissues, this may reflect a balance between a stimulation of c-Raf-1 by FGF2 signals (26, 27, 28, 29, 30), perhaps some ACTH effects as discussed above (20, 24, 26, 29, 33), and the inhibition of c-Raf-1 by Akt/PKB, as seen in other cell types (21) with a normal PKA tetramer (16) (Fig. 5AGo).


Figure 5
View larger version (12K):
[in this window]
[in a new window]
 
FIG. 5. Suggested cross-talk between PKA and the MAPK signaling pathway in the adrenal cortex with normal PRKAR1A sequence (A): 1) FGF2 stimulates the ERK1/2 cascade of MAPK at a receptor tyrosine kinase that stimulates Ras for the sequential phosphorylation and activation of B- and c-Raf-1, MEK1/2, and ERK1/2. Phosphorylated ERK1/2 then phosphorylates and activates c-Fos, c-Jun, and c-Myc, leading to cell proliferation. This pathway is augmented by the activation of the ERK1/2 cascade by ACTH, acting through a G protein-coupled receptor (GPCR), at a point upstream of MEK1/2, leading to the phosphorylation of c-Fos and c-Jun only; 2) Ras stimulates PI3K to activate Akt/PKA that inhibits both B- and c-Raf-1. In addition, ACTH activates a GPCR to stimulate the production of cAMP from adenyl cyclase and ATP. cAMP binds to and activates PKA. cAMP/PKA, to a small extent, phosphorylates and deactivates Akt/PKB. Akt/PKB, most of which is active, can inhibit B- and c-Raf-1, and 3) Akt/PKB can also phosphorylate and inactivate GSK3 (to a greater extent than in mt-PRKAR1A tissue), decreasing the amount of c-Myc that is degraded by the UPS. B, mt-PRKAR1A sequence: 1) FGF2 stimulates the ERK1/2 cascade of MAPK at a receptor tyrosine kinase that stimulates Ras for the sequential phosphorylation and activation of B- and c-Raf-1, MEK1/2, and ERK1/2. Phosphorylated ERK1/2 then activates c-Fos, c-Jun, and c-Myc, leading to cell proliferation. This pathway is augmented by the activation of the ERK1/2 cascade by ACTH, acting through a GPCR, at a point upstream of MEK1/2, leading to the phosphorylation of c-Fos and c-Jun only; 2) Ras also stimulates PI3K to activate Akt/PKA that inhibits both B- and c-Raf-1. In addition, ACTH activates a GPCR to stimulate the production of cAMP from adenyl cyclase and ATP that binds to and activates PKA. cAMP/PKA phosphorylates and deactivates Akt/PKB to a greater extent than in normal tissue, stimulating B-raf and relieving the inhibitory effect of Akt/PKB on B-raf and c-Raf-1; and 3) the phosphorylation/deactivation of GSK3 by Akt/PKB is reduced due to a less active Akt/PKB; GSK3 can target more c-Myc than in normal tissue for degradation by the UPS. Line thickness indicates degree of activity.

 
In mt-PRKAR1A B lymphocytes, cAMP/PKA appeared to act at the level of rap-1 in the ERK1/2 cascade of MAPK to increase phosphorylated B-raf, MEK1/2, ERK1/2, and c-Myc and to subsequently increase cell proliferation (16). In the present study, levels of B-raf kinase activity were increased in mt-PRKAR1A-harboring tissues by 3.5-fold over normal tissues (Fig. 2CGo). This difference suggests an activation of rap-1/B-raf by an altered PKA, which appears to contain mostly type II or R1ß subunits (Fig. 1Go), given the decrease in available RI{alpha} subunit. In addition, these data may also reflect a balance of actions of opposing signaling pathways on B-raf kinase in both normal and mt-PRKAR1A tissues (Fig. 5BGo): in normal tissue, an inhibition of B-raf activity may occur when normal PKA enzyme activity is augmented by Akt/PKB. In mtPRKAR1A tissue, the opposite may occur, with a stimulation of B-raf by an altered PKA and an inhibition by Akt/PKB (20). Our data (Fig. 3CGo) show a statistically nonsignificant 1.6-fold increase in phosphorylated/deactivated Akt/PKB in mt-PRKAR1A tissues vs. that in normal tissues. Most likely, the variability of the samples did not allow statistical significance in these samples; immunostaining pointed to the greater content of Akt/PKB in PPNAD nodules, albeit in particular cellular subpopulations (Fig. 4BGo). If this is true, we speculate that greater PKA activity results in decreased Akt/PKB activity that would allow more uninhibited GSK3 to cause degradation of c-Myc by UPS. In normal PRKAR1A-containing tissues, Akt/PKB is phosphorylated/deactivated to a lesser degree by cAMP/PKA and thus may maintain a greater ability to inhibit GSK3. The resultant phosphorylation of ERK1/2, obtained through the interaction of FGF2, PKA, and PKB, may override the degradation of c-Myc by GSK3 in mutant cells.

In summary, we present a hypothetical cell proliferation pathway for normal and mt-PRKAR1A tissues based mainly on the present study and data obtained by other investigators (primarily from studies on the Y1 adrenocortical tumor cell line). We suggest that cell proliferation in normal and mt-PRKAR1A tissues is the result of the convergence of several cell signaling systems on strategic points (i.e. B- and c-Raf-1, and c-Myc) in the ERK1/2 cascade of the MAPK cell signaling system. In normal (Fig. 5AGo) and mt-PRKAR1A tissues (Fig. 5BGo), stimulation of the ERK1/2 cascade of MAPK by FGF2 leads to cell proliferation; these effects are inhibited by Akt/PKB at the B-raf and c-Raf-1 kinase levels. In normal PRKAR1A-containing tissue, cAMP/PKA deactivates Akt/PKB to a lesser degree than in mtPRKAR1A-containing tissues, allowing activated Akt/PKB to inhibit B- and c-Raf-1 kinase activities. In mt-PRKAR1A-containing tissues, any inhibition conferred by Akt/PKB is absent or decreased due to inactivation by a PKA complex with greater catalytic activity, which also stimulates (rather than inhibits) B-raf kinase activity. The net effect of these changes is an increase in proliferation evident in PPNAD nodular tissue.


    Acknowledgments
 
We thank Dr. Fabiano Sandrini (University of Curitiba, Parana, Brazil), who assisted in the original determinations of PRKAR1A sequence and PKA activity alterations in the samples used in this study.


    Footnotes
 
This work was supported by National Institutes of Health intramural project Z01-HD-000642-04.

First Published Online March 28, 2006

Abbreviations: C, Catalytic; CNC, Carney complex; FGF, fibroblast growth factor; GSK, glutathione synthetase kinase; GST, glutathione-S-transferase; MEK, MAPK kinase; mt-PRKAR1A, mutations in PRKAR1A; p, phosphorylated; PI3K, phosphatidylinositol-3 kinase; PKA, protein kinase A; PKB, protein kinase B; PKI, protein kinase inhibitor; PPNAD, primary pigmented nodular adrenocortical disease; R, regulatory; RTK, receptor tyrosine kinase; SDS, sodium dodecyl sulfate; TBST, Tris-buffered saline and Tween 20; UPS, ubiquitin proteasome system.

Received January 27, 2006.

Accepted March 20, 2006.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Stratakis CA, Kirschner LS 1998 Clinical and genetic analysis of primary bilateral adrenal diseases (micro- and macronodular disease) leading to Cushing syndrome. Horm Metab Res 30:456–463[Medline]
  2. Stratakis CA, Kirschner LS, Carney JA 2001 Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 86:4041–4046[Abstract/Free Full Text]
  3. Stergiopoulos SG, Stratakis CA 2003 Human tumors associated with Carney complex and germline. PRKAR1A mutations: a protein kinase A disease! FEBS Lett 546:59–64[CrossRef][Medline]
  4. Kirschner LS, Sandrini F, Monbo J, Jing-Ping L, Carney JA, Stratakis CA 2000 Genetic heterogeneity and spectrum of mutations of the PRKAR1A gene in patients with the Carney complex. Hum Mol Genet 9:3037–3046[Abstract/Free Full Text]
  5. Groussin L, Jullian E, Perlemoine K, Louvel A, Leheup B, Luton JP, Bertagna X, Bertherat J 2002 Mutations of the PRKAR1A gene in Cushing’s syndrome due to sporadic primary pigmented nodular adrenocortical disease. J Clin Endocrinol Metab 87:4324–4329[Abstract/Free Full Text]
  6. Kirschner LS, Carney JA, Pack S, Tayman SE, Cho YS, Cho-Chung Y, Stratakis CA 2000 Mutations in the gene encoding the type 1{alpha} regulatory subunit of the protein kinase A (PRKAR1A) in patients with Carney complex. Nat Genet 26:89–92[CrossRef][Medline]
  7. Griffin KJ, Kirschner LS, Matyakhina L, Stergiopoulos SG, Robinson-White A, Lenherr SM, Weinberg FD, Claflin ES, Batista D, Bourdeau I, Voutetakis A, Sandrini F, Meoli EM, Bauer AJ, Cho-Chung YS, Bornstein SR, Carney JA, Stratakis CA 2004 A transgenic mouse bearing an antisense construct of regulatory subunit type 1A of protein kinase A develops endocrine and other tumors: comparison with Carney complex and other PRKAR1A induced lesions. J Med Genet 41:923–931[Abstract/Free Full Text]
  8. Griffin KJ, Kirschner LS, Matyakhina L, Stergiopoulos S, Robinson-White A, Lenherr S, Weinberg FD, Claflin E, Meoli E, Cho-Chung YS, Stratakis CA 2004 Down-regulation of regulatory subunit type 1A of protein kinase A leads to endocrine and other tumors. Cancer Res 64:8811–8815[Abstract/Free Full Text]
  9. Kirschner LS, Kusewitt DF, Matyakhina L, Towns 2nd WH, Carney JA, Westphal H, Stratakis CA 2005 A mouse model for the Carney complex tumor syndrome develops neoplasia in cyclic AMP-responsive tissues. Cancer Res 65:4506–4514[Abstract/Free Full Text]
  10. Tasken K, Shalhegg BS, Tasken KA, Solberg R, Knutsen HK, Levy FO, Sandberg M, Orstavik S, Larsen T, Johansen AK, Vang T, Schrader HP, Reinton NT, Torgersen KM, Hansson V, Jahnsen T 1997 Structure, function and regulation of human cAMP-dependent protein kinase. Signal transduction in health and disease. In: Corbin J, Frances S, eds. Advances in second messenger and phosphoprotein research. Philadelphia: Lippencott-Raven; 191–204
  11. Sidovar MF, Kozlowski P, Lee JW, Collins MA, He Y, Graves LM 2000 Phosphorylation of serine 43 is not required for inhibition of c-Raf kinase by the cAMP-dependent protein kinase. J Biol Chem 275:28688–28694[Abstract/Free Full Text]
  12. Houslay MD, Kolch W 2000 Cell-type specific integration of cross-talk between extracellular signal-regulated kinase and cAMP signaling. Mol Pharmacol 58:659–668[Free Full Text]
  13. Pearson G, Robinson F, Beers GT, Xu BE, Karandikar M, Berman K, Cobb MH 2001 Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 22:153–183[Abstract/Free Full Text]
  14. Robinson-White A, Stratakis CA 2002 Protein kinase A signaling: "cross talk" with other pathways in endocrine cells. Ann NY Acad Sci 968:256–270[Medline]
  15. Erhardt P, Troppmair J, Rapp UR, Cooper GM 1995 Differential regulation of Raf-1 and B-raf and Ras-dependent activation of mitogen-activated protein kinase by cyclic AMP in PC12 cells. Mol Cell Biol 15:5524–5530[Abstract]
  16. Robinson-White A, Hundley TR, Shiferaw M, Bertherat J, Sandrini F, Stratakis CA 2003 Protein kinase-A activity in PRKAR1A-mutant cells, and regulation of mitogen-activated protein kinases ERK1/2. Hum Mol Genet 12:1475–1484[Abstract/Free Full Text]
  17. Amieux PS, Cummings DE, Motamed K, Brandon EP, Wailes LA, Le K Idzerda RL, McKnight GS 1997 Compensatory regulation of RI{alpha} protein levels in protein kinase A mutant mice. J Biol Chem 272:3993–3998[Abstract/Free Full Text]
  18. Amieux PS, McKnight GS 2002 The essential role of RI{alpha} in the maintenance of regulated PKA activity. Ann NY Acad Sci 968:75–95[Medline]
  19. McKnight GS, Cummings DE, Amieux PS, Sikorski MA, Brandon EP, Planas JV, Motamed K, Idzerda RL 1998 Cyclic AMP, PKA, and the physiological regulation of adiposity. Recent Prog Horm Res 53:139–159[Medline]
  20. Guan K-L, Figueroa C, Brtva TR, Zhu T, Taylor J, Barber TD, Vojtek AB 2000 Negative regulation of the serine/threonine kinase B-raf by Akt. J Biol Chem 275:27354–27359[Abstract/Free Full Text]
  21. Jun T, Gjoerup O, Roberts TM 1999 Tangled webs: evidence of cross-talk between c-Raf-1 and Akt. Perspective 13:1–4
  22. Bertherat J, Groussin L, Sandrini F, Matyakhina L, Bei T, Stergiopoulos S, Papageorgiou T, Bourdeau I, Kirschner LS, Vincent-Dejean C, Perlemoine K, Gicquel C, Bertagna X, Stratakis CA 2003 Molecular and functional analysis of PRKAR1A and its locus (17q22–24) in sporadic adrenocortical tumors:17q losses, somatic mutations, and protein kinase A expression and activity. Cancer Res 63:5308–5319[Abstract/Free Full Text]
  23. Lepique AP, Moraes MS, Rocha KM, Eichler CB, Hajj GNM, Schwindt TT, Armelin HA 2004 c-Myc protein is stabilized by fibroblast growth factor 2 and destabilized by ACTH to control cell cycle in mouse Y1 adrenocortical cells. J Mol Endocrinol 33:623–638[Abstract/Free Full Text]
  24. Costa ET, Forti FL Rocha KM, Moraes MS, Armelin, HA 2004 Molecular mechanisms of cell cycle control in the mouse Y1 adrenal cell line. Endocr Res 30:503–509[CrossRef][Medline]
  25. Lotfi CFP, Armelin HA 2001 cfos and cjun antisense oligonucleotides block mitogenesis triggered by fibroblast growth factor-2 and ACTH in mouse Y1 adrenocortical cells. J Endocrinol 168:381–389[Abstract]
  26. Forti FL, Schwindt TT, Moraes MS, Eichler CB, Armelin HA 2002 ACTH promotion of p27kip1 induction in mouse Y1 adrenocortical tumor cells is dependent on both PKA activation and Akt/PKB inactivation. Biochem 41:10133–10140[CrossRef][Medline]
  27. Lotfi CFP, Todoronvic Z, Armelin HA, Schimmer BP 1997 Unmasking a growth-promoting effect of the adrenocorticotropic hormone in Y1 mouse adrenocortical tumor cells. J Biol Chem 272:29886–29891[Abstract/Free Full Text]
  28. Lotfi CFP, Lepique AP, Forti FL, Schwindt TT, Eichler CB, Santos MO, Rebustini IT, Hajj GNM, Juliano L, Armelin HA 2000 Proliferative signaling initiated in ACTH receptors. Braz J Med Biol Res 33:1133–1140[Medline]
  29. Lepique AP, Forti FL, Moraes MS, Armelin HA 2000 Signal transduction inG0/G1-arrested mouse Y1 adrenocortical cells stimulated by ACTH and FGF2. Endocrinol Res 26:825–832[Medline]
  30. Rocha KM, Forti FL, Lepique AP, Armelin HA 2003 Deconstructing the molecular mechanisms of cell cycle control in a mouse adrenocortical cell line: roles of ACTH. Microsc Res Tech 61:268–274[Medline]
  31. Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, Nevins JR 2000 Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev 14:2501–2514[Abstract/Free Full Text]
  32. Liang J, Slingerland JM 2003 Multiple roles of the PI3K/PKB (Akt) pathway in cell cycle progression. Cell Cycle 2:339–345[Medline]
  33. Salghetti SE, Kim SY, Tansey WP 1999 Destruction of Myc by ubiquitin-mediated proteolysis: cancer-associated and transforming mutations stabilize Myc. EMBO J 18:717–726[CrossRef][Medline]
  34. Kops GJPL, Burgering MT 1999 Forkhead transcription factors: new insights into protein kinase B (c-act) signaling. J Mol Med 77:656–665[CrossRef][Medline]
  35. Mercer KE, Pritchard CA 2003 Raf proteins and cancer:B-raf is identified as a mutational target. Biochim Biophysics Acta 1653:25–40
  36. Ferreira JG, Cruz C, Vinson G, Panatela D 2004 ACTH modulates ERK phosphorylation in the adrenal gland in a time-dependent manner. Endocr Res 30:661–666[CrossRef][Medline]
  37. Fassnacht M, Hahner S, Hansen IA, Kreutzberger T, Zink M, Adermann K, Jakob F, Troppmair J, Allolio B 2003 N-terminal proopiomelanocortin acts as a mitogen in adrenocortical tumor cells and decreases adrenal steroidogenesis. J Clin Endocrinol Metab 88:2171–2179[Abstract/Free Full Text]
  38. Lotfi CFP, Costa ET, Schwindt TT, Armelin HA 2000 Role of ERK/MAP kinase in mitogenic interaction between ACTH and FDGF2 in mouse Y1 adrenocortical tumor cells. Endocrinol Res 26:873–877[Medline]
  39. Xaus J, Valledor AF, Cardo M, Marques L, Beleta J, Palacios JM, Celada A 1999 Adenosine inhibits macrophage colony-stimulating factor-dependent proliferation of macrophages through the induction of p27kip-1 expression. J Immunol 163:4140–4149[Abstract/Free Full Text]
  40. van Oirschot BA, Stahl M, Lens SMA, Medema RH 2001 Protein kinase A regulates expression of p27kip1 and cyclin D3 to suppress proliferation of leukemic T cell lines. J Biol Chem 276:33854–33860[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Toxicol Ind HealthHome page
T. Kuo
The influence of methylmercury on the nitric oxide production of alveolar macrophages
Toxicology and Industrial Health, September 1, 2008; 24(8): 531 - 538.
[Abstract] [PDF]


Home page
Cancer Res.Home page
E. Meoli, I. Bossis, L. Cazabat, M. Mavrakis, A. Horvath, S. Stergiopoulos, M. L. Shiferaw, G. Fumey, K. Perlemoine, M. Muchow, et al.
Protein Kinase A Effects of an Expressed PRKAR1A Mutation Associated with Aggressive Tumors
Cancer Res., May 1, 2008; 68(9): 3133 - 3141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. Pavel, K. Nadella, W. H. Towns II, and L. S. Kirschner
Mutation of Prkar1a Causes Osteoblast Neoplasia Driven by Dysregulation of Protein Kinase A
Mol. Endocrinol., February 1, 2008; 22(2): 430 - 440.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Nesterova, I. Bossis, F. Wen, A. Horvath, L. Matyakhina, and C. A. Stratakis
An Immortalized Human Cell Line Bearing a PRKAR1A-Inactivating Mutation: Effects of Overexpression of the Wild-Type Allele and Other Protein Kinase A Subunits
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 565 - 571.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Horvath, I. Bossis, C. Giatzakis, E. Levine, F. Weinberg, E. Meoli, A. Robinson-White, J. Siegel, P. Soni, L. Groussin, et al.
Large Deletions of the PRKAR1A Gene in Carney Complex
Clin. Cancer Res., January 15, 2008; 14(2): 388 - 395.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robinson-White, A.
Right arrow Articles by Stratakis, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson-White, A.
Right arrow Articles by Stratakis, C. A.
Related Collections
Right arrow Adrenal and Hypertension


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals