| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Section on Endocrinology and Genetics (A.R.-W., E.M., S.S., A.H., S.B., I.B., C.A.S.) and Pediatric Endocrinology Training Program (C.A.S.), Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Constantine A. Stratakis, M.D., D(Med)Sc., Chief, Section on Endocrinology and Genetics, and Director, Pediatric Endocrinology Training Program, Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Building 10, Clinical Research Center, Room 1-3330, 10 Center Drive, MSC1103, Bethesda, Maryland 20892. E-mail: stratakc{at}mail.nih.gov.
| Abstract |
|---|
|
|
|---|
(RI
) of cAMP-dependent protein kinase (PKA). PRKAR1A inactivation is associated with dysregulated PKA activity that is thought to result in tumorigenesis. mt-PRKAR1A-bearing lymphocytes from Carney complex patients exhibit enhanced cell proliferation associated with increased expression of the MAPK ERK1/2 pathway. Objective: The objective of the study was to determine how PKA and its subunits and ERK1/2 and their molecular partners change in the presence of PRKAR1A mutations in adrenocortical tissue.
Design: PKA activity and subunit expression, ERK1/2, other immunoassays, and immunohistochemistry on adrenocortical samples from patients with germline normal or mt-PRKAR1A were analyzed.
Results: Increased cAMP-stimulated total kinase activity was associated with mt-PRKAR1A. PKA subunit expression analysis in mt-PRKAR1A tissues, by quantitative mRNA assay and immunoblotting, showed a 2.4-fold (P = 0.02) and 1.8-fold (P = 0.09) decrease in RI
s message and protein, respectively, and increases in other PKA subunits. Immunoassays showed 2-fold (P = 0.03) and 6-fold (P = 0.03) decreases in baseline ERK1/2, with corresponding increases in phosphorylated (p) ERK1/2 in mt-PRKAR1A samples. B-raf kinase, p-MEK1/2, and p-c-Myc, but not p-Akt/protein kinase B, were significantly increased. Immunohistochemistry studies supported these data.
Conclusions: mt-PRKAR1A causes increased total cAMP-stimulated kinase activity, likely the result of up-regulation of other PKA subunits caused by down-regulation of RI
, as seen in human lymphocytes and mouse animal models. These changes, associated with enhanced MAPK activity, may be, in part, responsible for the proliferative signals that result in primary pigmented nodular adrenocortical disease.
| Introduction |
|---|
|
|
|---|
regulatory subunit (RI
) of the cAMP-dependent protein kinase A (PKA). Absence or deficiency of RI
and tumor-specific loss of heterozygosity within the chromosomal regions harboring PRKAR1A have been associated with dysregulated PKA activity and tumorigenicity in CNC-affected tissues and mouse models of PRKAR1A down-regulation (6, 7, 8, 9).
PKA is a holoenzyme that consists of two homo- (and rarely hetero-) dimers of two regulatory (R) subunits (RI
and RII
) and two catalytic (C) subunits (C
, Cß, or C
) (10). Activation of PKA by the binding of two molecules of cAMP to each R subunit leads to disassociation of the R molecules from the PKA tetramer and release of the C subunits (10). The C subunits are serine-threonine kinases that phosphorylate a series of targets, including components of the MAPK cell signaling system (11, 12, 13). MAPKs mediate a diverse number of cellular processes (e.g. proliferation, differentiation, survival, and apoptosis) and consist of separate and interacting cascades, composed of three core-member modules. The ERK1/2 cascade core members include the Raf kinases (A, B, and c-Raf-1), MEK1/2, and the final MAPK ERK1/2 (13). Upon receptor activation (usually a receptor tyrosine kinase), the small G protein Ras is stimulated to phosphorylate and activate the three core-member cascade. Each core member phosphorylates and activates the succeeding member until the final core member, ERK1/2, activates downstream kinases and transcription factors (e.g. c-Fos, c-Jun, c-Myc) for a cell response (13, 14). The PKA pathway is known to interact with a number of other signal transduction pathways (14). In most tissues, PKA appears to inhibit the ERK1/2 cascade of the MAPK pathway at the level of c-Raf-1, causing a cell type-specific inhibition of MAPK activity and cell proliferation (15, 16).
Our studies (16) in Epstein-Barr virus-transformed B lymphocytes bearing mutated (mt)-PRKAR1A showed that RI
deficiency may lead to reversal of PKA-mediated inhibition of MAPK signaling. We proposed that this was due to dysregulated PKA activity in response to cAMP, an observation that was further supported by an increase in type II PKA subunits, as has been shown in other in vivo and in vitro models of RI
deficiency (7, 8, 9, 17, 18, 19). In the present study, we examined adrenoglandular tissues from patients with and without PRKAR1A mutations for the expression of the PKA subunits at the mRNA and protein level, PKA enzymatic activity, and the expression and phosphorylation status of ERK1/2 and other molecular partners of the MAPK signaling system. Because in many cell types (20, 21), Akt/protein kinase B (PKB) inhibits both B and c-Raf-1 kinase activity of MAPK, we also included Akt/PKB in these studies. The data confirm observations in other human tissues and mouse models with RI
deficiency and are consistent with the notion that tumorigenicity of mt-PRKAR1A in the adrenal cortex is associated with the perturbation of PKA activity, tissue-specific up-regulation of other PKA subunits, and activation of MAPK signaling.
| Patients and Methods |
|---|
|
|
|---|
Adrenal tissue was collected from 21 patients during surgery (Table 1
). Human studies were approved by the National Institute of Child Health and Human Development Institutional Review Board under protocols 95CH0059 and 00CH0160. Tissue was immediately snap frozen in liquid nitrogen after careful dissection of periadrenal fat and fibrous tissue by the investigators and kept at 70 C. DNA extracted from tissue was screened for the presence of mutations in the PRKAR1A gene by standard methods published elsewhere (22). Tissue samples included one from a patient with multiple cortisol-producing adenomas, two from patients with single cortisol-producing adenomas, four from patients with micronodular hyperplasia, 11 from patients with PPNAD and CNC, and three from patients with isolated PPNAD. The patients, their mutation status, and clinical profiles are shown in Table 1
.
|
Materials were from the following sources: phenylmethaneosulfonyl fluoride from Sigma-Aldrich (St. Louis, MO); leupeptin, aprotinin and 4-nitrophenylphosphate, superscript RNase II reverse transcriptase, Light Cycler apparatus from Roche Molecular Biochem (Indianapolis, IN); phospho-anti-ERK1/2, anti-ERK1/2, anti-MEK1/2, and anti-Akt/PKB, from Cell Signaling (Beverly, MA); phospho-anti-MEK1/2 and phospho-anti-c-Myc from Santa Cruz Biotechnology (Santa Cruz, CA); phospho-c-Raf-1 from BD Biosciences (San Jose, CA); antimouse IgG from Oncogene Research Products (Darmstadt, Germany); B-raf kinase cascade assay kit from U.S. Biologicals (Swampscott, MA); BCA protein assay kit from Pierce (Rockford, IL); BSA fraction V from ICN Biochemicals (Irvine, CA); 10 x Tris/glycine/sodium dodecyl sulfate (SDS) buffer, 10 x Tris/glycine buffer, blotting grade nonfat dried milk, and Tween 20 from Bio-Rad (Hercules, CA); Protran nitrocellulose membranes from Schleicher and Schuell (Keene, NH); Novex 10% Tris/glycine gels, TRIZol reagent from Invitrogen (Carlsbad, CA); enhanced chemiluminescence blotting detection reagent and deoxyadenosine 5'-[
-32P]triphosphate from Amersham Pharmacia (Piscataway, NJ); and RNeasy minikit from QIAGEN (Valencia, CA).
PKA activity determinations
PKA activity was measured as described previously (6, 16), using [
-32P] deoxy-ATP in cell extracts that had been snap frozen in liquid nitrogen. Total kinase activity represents enzymatic activity after stimulation with cAMP. Total PKA-specific activity represents the difference between PKA activity before and after the addition of protein kinase inhibitor (PKI). A ratio was calculated after the determination of free PKA activity, according to the following formula: PKA activity ratio = free PKA activity (bound PKA, in units/milligram protein content)/total PKA activity (unbound PKA, in units/milligram protein content).
All determinations of PKA activity were performed twice per sample, corrected for protein content (per milligram of total protein), and an average value was calculated for each experiment.
mRNA quantitation
Total tissue RNA was extracted using TRIzol reagent and purified using the RNeasy minikit. The quality and quantity of the extracted total RNA were assessed by formaldehyde agarose gel electrophoresis and spectrophotometric UV absorbance at 260/280 nm, respectively. The specimens that were used are listed in Table 1
. One microgram of total RNA was reverse transcribed to cDNA by Superscript II RNase H-reverse transcriptase with Oligo dT primer according to the manufacturers instructions. The quantitative real-time reaction was carried out and analyzed using ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City, CA). The primers and probes for the PRKAR1A, PRKAR1B, PRKAR2A, PRKAR2B, and PRKACA (BioServe Biotechnologies, Laurel, MD), were: PRKAR1A forward primer, TGAATCGTCCTCGTGCTGC; PRKAR1A reverse primer, TCGGTCCAGCTTAACGCACT; PRKAR1A probe (TET), ACAGTTGTTGCTCGTGGCCCCTTG; PRKAR1B forward primer, GGCGCATCCTTATGGGC; PRKAR1B reverse primer, ATGGAGACCTTGCTGAGGAACTC; PRKAR1B probe (TET), CACGCTGAGGAAACGCAAGATGTACG; PRKAR2A forward primer, TACACGGTGGAGGTGCTGC; PRKAR2A reverse primer, AGGCGGGTGAAGTACTCCACT; PRKAR2A probe (TET), AGCAGCCGCCTGACCTCGTCG; PRKAR2B forward primer, CCTTGGGTTTCCGTTCTTTCT; PRKAR2B reverse primer, CCCATATTGGCTGCTGATCA; PRKAR2B probe (TET), AGGATGGTTGCCAACCCACAATCTCA; PRKACA forward primer, GACCTGAAGCCGGAGAATCTG; PRKACA reverse primer, TGGCGAAACCGAAGTCTGTC; PRKACA probe (TET), TCATTGACCAGCAGGGCTACATTCAGG.
All probes were TET labeled. The method of relative quantitation using a standard curve was applied. Normal adrenal RNA was used as a calibrator. In brief, the total reaction volume per sample was 20 µl and contained 2 µl from the cDNA synthesis reaction, 10 pmol of each primer and the probe in 1x TaqMan Universal Master Mix. Cycling was as follows: 2 min at 50 C, 10 min at 95 C, and 40 cycles at 95 C for 15 sec, 1 min at 60 C. Results were normalized against the expression of the housekeeping gene, GAPDH. Points for the standard curves and samples were performed in quadruplicate.
Electrophoretic separation and immunoblotting
The following procedure was performed as previously described (16). Tissues were lysed in lysis buffer [20 mM HEPES, 10% glycerol, 1% Triton X-100, 50 mM NaF, 1 mM NaVo4, 0.02 mg/ml aprotinin, 0.02 mg/ml leupeptin, 1 mM phenylmethaneosulfonyl fluoride, and 2.5 mM 4-nitrophenylphosphate (pH 7.3)] and sonicated for 45 sec at 4 C. Protein assays were performed on the complete cell lysate. The lysate was diluted to 1.52.5 µg/ml protein with lysis buffer. Samples were mixed 1:3, sample to 1 M Tris/SDS buffer [0.01% Bromophenol Blue, 30% glycerol and 8% B-mercaptoethanol, 6.8% SDS (pH 6.8)], boiled for 4 min, and run on 10% Tris/glycine gels. Protein was transferred to 0.2 µM nitrocellulose membranes. Membranes were blocked (1 h, room temperature) with 7% nonfat dried milk in Tris-buffered saline [with 1% Tween 20(TBST)]. ERK1/2 and phosphorylated proteins were detected using primary antibodies, diluted in 5% BSA in TBST, and horseradish peroxidase-conjugated secondary antibodies against mouse or rabbit IgG, diluted in 7% nonfat dried milk in TBST. Bands were detected by enhanced chemiluminescence reagent and densitometer scanning (Molecular Dynamics, Sunnyvale, CA).
B-Raf kinase assay
B-Raf kinase activity was measured using a B-raf kinase cascade assay kit. Briefly, tissue lysates, in ice-cold lysis buffer A (as in the above), were clarified at 10,000 rpm for 20 min at 4 C. Supernatants were incubated with Mg2+/ATP, unactive glutathione-S-transferase (GST)-tagged MAPK kinase (MEK)1 fusion protein, and dilution buffer, shaking for 30 min at 30 C, according to the manufacturers directions. Samples were mixed 1:2 with a 1 M Tris buffer (pH 6.8), containing 4% SDS, 0.010% Bromophenol Blue, 20% glycerol, and 5% B-mercaptoethanol. Phosphorylated GST-tagged MEK1, released by the reaction of tissue B-raf kinase and unactive GST-tagged MEK1, was detected using phospho-anti-GST-tagged MEK1/2 by gel electrophoresis and immunoblotting assays as stated in the above.
Immunohistochemistry
Sections from paraffin-embedded samples from all patients were hybridized with the commercially available antibodies specific for p-ERK1/2, RI
, and the other main PKA subunits (RII
, RIIß, and C
) (BD Biosciences, San Jose, CA) and Akt as described previously (22). Two blinded readers graded specimens carrying normal PRKAR1A sequence with those that had mutations. Staining was assigned one of four grades: 0 for nonstaining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining.
Statistics
Data were analyzed using the SAS Institute general linear model procedure (SAS Institute, Cary, NC). All experiments were performed at least twice. In most cases, log-transformed data were used to remedy for nonhomogeneity of variance. Tukeys test was used to compare differences between treatments. Differences were considered significant at P
0.05. P < 0.1 was interpreted as showing a tendency toward significance.
| Results |
|---|
|
|
|---|
Basal PKA activity measurements indicated a 1.5-fold increase in PKA activity in mt-PRKAR1A PPNAD tissues over those with normal sequence, which, however, was not statistically significant (499 ± 25 cpm/mg protein vs. 333 ± 26 cpm/mg protein; P = 0.39). After exposure to cAMP, total PKA activity was increased in mt-PRKAR1A tissues: there was a more than 2.5-fold greater increase in tissues with mutations (1218 ± 252 cpm/mg protein) vs. those with normal PRKAR1A sequence (454 ± 30 cpm/mg protein). Free kinase activity in both normal and mt-PRKAR1A tissues was reduced to equal levels in both groups (up to 51% of original values) by the PKA-specific inhibitor, PKI (Fig. 1A
). Thus, total PKA activity was significantly higher in mt-PRKAR1A samples (10.6 ± 2.4 U/mg) vs. that in tissues with normal PRKAR1A sequence (2.92 ± 0.22 U/mg; P = 0.05), and accordingly, the PKA ratio, a measure of R1
activity (6), was higher in tissues that did not have PRKAR1A-inactivating mutations: (0.56 ± 0.20) vs. mt-PRKAR1A-bearing tissues (0.15 ± 0.041) (Fig. 1B
, P < 0.01).
|
Quantitative real-time PCR demonstrated variable but detectable levels of the four mRNA regulatory subunits (RI
, RIß, RII
, and RIIß) of PKA as well as the catalytic subunit C
. There was a 2.4-fold (0.34 ± 0.04 vs. 0.14 ± 0.06) decrease (P = 0.02) in the levels of the RI
subunit mRNA in mt-PRKAR1A tissues (Fig. 1C
). Conversely, in mutant tissues, there was a significant increase in the ratio of mRNAs for the type II over those for type I PKA subunits (P = 0.02) (Fig. 1D
), although the most significant individual subunit increase was that of RIß.
Western blot analysis of the PKA subunits (Fig. 1E
) indicated the presence of all four PKA regulatory subunits (RI
, RIß, RII
, and RIIß), as well as the catalytic subunit C
, in both normal and mt-PRKAR1A tissues. Levels of RI
were decreased in mt-PRKAR1A tissues by 1.8-fold (2.21 ± 0.2 vs. 1.17 ± 0.15), a difference that had a tendency toward significance (P = 0.09); accordingly, the ratio (Fig. 1F
) of RI
to all other PKA subunits was lower in mt-PRKAR1A tissues (0.53 ± 0.26) vs. than in tissues with normal PRKAR1A sequence (0.73 ± 0.3) (P = 0.04). As in the mRNA studies, there was an overall significant increase in type II (RIß and RIIß) over type I PKA subunits in mt-PRKAR1A tissues, although again the most significant single increase was that of RIß (0.32 ± 0.002 vs. 0.1 ± 0.001, P = 0.005) (Fig. 1E
).
ERK1/2 and other MAPK components, c-Myc and Akt/PKB
The ratio of phosphorylated (p) ERK1/2 to baseline (unphosphorylated) ERK1/2 was 1.3 ± 0.16 vs. 0.45 ± 0.01 and 0.73 ± 0.1 vs. 0.6 ± 0.05, respectively, both significantly greater in mt-PRKAR1A tissues (Fig. 2
). Specifically, levels of ERK1 and ERK2 were 2-fold (0.43 ± 0.25 vs. 0.22 ± 0.001) and 6-fold (1.09 ± 0.25 vs. 0.19 ± 0.05; P = 0.03) greater in normal than in mt-PRKAR1A tissues, respectively (Fig. 2A
). The levels of pERK1/2, however, were changed to the opposite direction: there was a 3-fold (0.33 ± 0.04 vs. 0.1 ± 0.02) and 7-fold (0.8 ± 0.14 vs. 0.12 ± 0.05) increase in mt-PRKAR1A-containing tissues for pERK1 and pERK2, respectively (Fig. 2B
).
|
|
Immunohistochemistry
Immunostaining of mt-PRKAR1A tissues and other specimens for the various PKA subunits, ERK1/2 and Akt/PKB, confirmed the message and protein data presented above: R1
immunostaining was decreased in tissues with mt-PRKAR1A sequence, especially within the nodules. Relative up-regulation of the other PKA subunits was seen in these tissues (Fig. 4A
), as has been suggested elsewhere (7, 22). Consistent with the immunoassays presented above, pERK immunostaining was present in nodular tissue in PPNAD (Fig. 4B
, panels 13), whereas very little pERK was present in normal adrenocortical tissue (Fig. 4B
, panel 4). On the other hand, Akt/PKBs staining of PPNAD samples with mt-PRKAR1A was inconsistent, with some nodules showing intense staining and others being devoid of any expression (Fig. 4
, panel 5); staining of the former was almost exclusively cytoplasmic (Fig. 4
, panel 6).
|
| Discussion |
|---|
|
|
|---|
down-regulation and the previously identified high total kinase activity in mt-PRKAR1A PPNAD tissues (6) are associated with an increase in the overall presence of type II PKA subunits. This is consistent with findings in sporadic human adrenocortical tumors (22) and animal models of PKA dysfunction (7, 8, 9, 17). How these abnormalities lead to increased proliferation of mt-PRKAR1A adrenocortical cells remains unknown. In mouse Y1 adrenocortical tumor cells, growth and proliferation are overseen by several opposing and highly complex regulatory mechanisms (23, 24, 25, 26). Y1 cells appear to possess an amplified and constitutively expressed c-Ki-Ras that elicits an increased mitogenic response triggered by fibroblast growth factor (FGF) type 2 signaling at a receptor tyrosine kinase. The ERK1/2 cascade of MAPK is then rapidly activated, leading to induction of c-Fos and c-Jun, activation and stabilization of c-Myc by phosphorylation at Ser62 (23, 27, 28, 29), expression of cyclins D1 and E, and phosphorylation of the retinoblastoma protein, which leads to activation of the cell cycle and stimulation of DNA synthesis (23, 30). Y1 cells also contain relatively high amounts of constitutively activated Akt/PKB that is dependent on c-Ki-Ras and phosphatidylinositol-3 kinase (PI3K) activities (23, 24). Activated Akt/PKB can enhance the mitogenic response to FGF2 by phosphorylating and inactivating glycogen synthase kinase (GSK) 3 that normally targets c-Myc for degradation by the ubiquitin proteasome system (UPS) (23, 31, 32, 33) and also in many cancer cell systems can inactivate p27kip-1 to promote cell survival (26, 34). Akt/PKB has also been shown to inhibit B-raf kinase activity by phosphorylation at multiple residues and inhibit c-Raf-1 kinase in many mammalian cell types (20, 21), whereas basal B-raf activity is normally 15- to 20-fold higher than c-Raf-1 (35). ACTH may act, through cAMP and independently of FGF2, to induce some of the same key players in adrenocortical cells, such as the c-fos and c-jun proteins at a point upstream of MEK1/2 and ERK1/2, to trigger a mitogenic response. Overall, however, proliferative responses to ACTH are up to 10-fold less significant than those of FGF2 (25, 27, 28, 30, 36, 37, 38), and ACTH levels in adrenal disorders associated with Cushing syndrome are low to undetectable. Furthermore, under certain conditions, ACTH has also been shown to have a strong antimitogenic effect, exerted via the PKA pathway (23, 24, 30); this effect may be through dephosphorylation of Akt/PKB, which releases its inhibitory effect on GSK3. GSK3, in turn, phosphorylates c-Myc (at Thr58), which leads to the latters degradation by UPS (23, 31). Thus, FGF2-induced S-phase entry can be blocked by a cAMP/PKA-dependent process; this potential ACTH-induced antimitotic effect is also not restricted by the presence of oncogenic c-Ki-Ras (39, 40).
In this study, using adrenocortical tissue from individuals with and without PRKAR1A mutations, we have shown that cAMP/PKA may have a similar effect on the ERK1/2 cascade of MAPK and c-Myc stabilization as seen in Y1 adrenocortical tumor cells and other cancer types (Fig. 5
). As was shown in our previous studies in Epstein-Barr virus-transformed normal and mt-PRKAR1A B lymphocytes (16) and in the studies of others (11, 12, 13), PKA may alter the ERK1/2 cascade of MAPK in normal tissue by an effect on c-Raf-1 kinase, with a subsequent decrease in phosphorylated MEK1/2 (Fig. 3A
), ERK1/2 (Fig. 2B
), and c-Myc (Fig. 3B
), which may lead to a decrease in cell proliferation (16). Although in the present study, there was no significant difference seen in phosphorylated c-Raf-1 (Fig. 2D
) in normal and mutant tissues, this may reflect a balance between a stimulation of c-Raf-1 by FGF2 signals (26, 27, 28, 29, 30), perhaps some ACTH effects as discussed above (20, 24, 26, 29, 33), and the inhibition of c-Raf-1 by Akt/PKB, as seen in other cell types (21) with a normal PKA tetramer (16) (Fig. 5A
).
|
subunit. In addition, these data may also reflect a balance of actions of opposing signaling pathways on B-raf kinase in both normal and mt-PRKAR1A tissues (Fig. 5B
In summary, we present a hypothetical cell proliferation pathway for normal and mt-PRKAR1A tissues based mainly on the present study and data obtained by other investigators (primarily from studies on the Y1 adrenocortical tumor cell line). We suggest that cell proliferation in normal and mt-PRKAR1A tissues is the result of the convergence of several cell signaling systems on strategic points (i.e. B- and c-Raf-1, and c-Myc) in the ERK1/2 cascade of the MAPK cell signaling system. In normal (Fig. 5A
) and mt-PRKAR1A tissues (Fig. 5B
), stimulation of the ERK1/2 cascade of MAPK by FGF2 leads to cell proliferation; these effects are inhibited by Akt/PKB at the B-raf and c-Raf-1 kinase levels. In normal PRKAR1A-containing tissue, cAMP/PKA deactivates Akt/PKB to a lesser degree than in mtPRKAR1A-containing tissues, allowing activated Akt/PKB to inhibit B- and c-Raf-1 kinase activities. In mt-PRKAR1A-containing tissues, any inhibition conferred by Akt/PKB is absent or decreased due to inactivation by a PKA complex with greater catalytic activity, which also stimulates (rather than inhibits) B-raf kinase activity. The net effect of these changes is an increase in proliferation evident in PPNAD nodular tissue.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online March 28, 2006
Abbreviations: C, Catalytic; CNC, Carney complex; FGF, fibroblast growth factor; GSK, glutathione synthetase kinase; GST, glutathione-S-transferase; MEK, MAPK kinase; mt-PRKAR1A, mutations in PRKAR1A; p, phosphorylated; PI3K, phosphatidylinositol-3 kinase; PKA, protein kinase A; PKB, protein kinase B; PKI, protein kinase inhibitor; PPNAD, primary pigmented nodular adrenocortical disease; R, regulatory; RTK, receptor tyrosine kinase; SDS, sodium dodecyl sulfate; TBST, Tris-buffered saline and Tween 20; UPS, ubiquitin proteasome system.
Received January 27, 2006.
Accepted March 20, 2006.
| References |
|---|
|
|
|---|
regulatory subunit of the protein kinase A (PRKAR1A) in patients with Carney complex. Nat Genet 26:8992[CrossRef][Medline]
protein levels in protein kinase A mutant mice. J Biol Chem 272:39933998
in the maintenance of regulated PKA activity. Ann NY Acad Sci 968:7595[Medline]This article has been cited by other articles:
![]() |
T. Kuo The influence of methylmercury on the nitric oxide production of alveolar macrophages Toxicology and Industrial Health, September 1, 2008; 24(8): 531 - 538. [Abstract] [PDF] |
||||
![]() |
E. Meoli, I. Bossis, L. Cazabat, M. Mavrakis, A. Horvath, S. Stergiopoulos, M. L. Shiferaw, G. Fumey, K. Perlemoine, M. Muchow, et al. Protein Kinase A Effects of an Expressed PRKAR1A Mutation Associated with Aggressive Tumors Cancer Res., May 1, 2008; 68(9): 3133 - 3141. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pavel, K. Nadella, W. H. Towns II, and L. S. Kirschner Mutation of Prkar1a Causes Osteoblast Neoplasia Driven by Dysregulation of Protein Kinase A Mol. Endocrinol., February 1, 2008; 22(2): 430 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nesterova, I. Bossis, F. Wen, A. Horvath, L. Matyakhina, and C. A. Stratakis An Immortalized Human Cell Line Bearing a PRKAR1A-Inactivating Mutation: Effects of Overexpression of the Wild-Type Allele and Other Protein Kinase A Subunits J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 565 - 571. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Horvath, I. Bossis, C. Giatzakis, E. Levine, F. Weinberg, E. Meoli, A. Robinson-White, J. Siegel, P. Soni, L. Groussin, et al. Large Deletions of the PRKAR1A Gene in Carney Complex Clin. Cancer Res., January 15, 2008; 14(2): 388 - 395. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |