| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
B and CCAAT/Enhancer-Binding Protein-ß
Imperial College London (V.T., Y.L., T.L., M.J., P.R.B.), Parturition Research Group, Institute of Reproductive and Developmental Biology, London W12 ONN, United Kingdom; and Department of Biological Sciences and Leicester Warwick Medical School (S.T.), University of Warwick, Coventry CV4 7AL, United Kingdom
Address all correspondence and requests for reprints to: Dr. V. Terzidou, Parturition Research Group, Institute of Reproductive and Developmental Biology, Hammersmith Hospital Campus, Du Cane Road, East Acton, London W12 ONN, United Kingdom. E-mail: v.terzidou{at}imperial.ac.uk.
| Abstract |
|---|
|
|
|---|
B (NF-
B), which may be activated by IL-1ß, whose concentrations increase with labor.
Objective: The objective of this study was to examine the effect of IL-1ß on OTR expression and the roles of AP-1, C/EBP, and NF-
B in OTR promoter function.
Results: IL-1ß induces an increase in OTR mRNA concentrations and OTR ligand binding in myometrial cells, which is maximal at 4 h and decreased after 20 h. IL-1ß activates the transcription factors AP-1 C/EBPß, and NF-
B. Using computer-based analysis and EMSA studies, we have identified three AP-1, nine C/EBP, and three NF-
B DNA-binding sites in the OTR promoter. In transient transfection studies, OTR promoter activity was increased by C/EBPß and NF-
B, but not by AP-1. C/EBPß and NF-
B together had a synergistic action in the induction of OTR promoter activity. Site-directed mutagenesis of each individual C/EBP and NF-
B site had no effect on the ability of C/EBPß, NF-
B, or their combination to activate OTR promoter. However, mutation of both NF-
B sites inhibited promoter activation by NF-
B alone, but not that by the combination of C/EBPß and NF-
B. Deletion studies showed that a region between 851 and 656 of the OTR confers responsiveness to the combination of C/EBPß and NF-
B.
Conclusion: IL-1ß has a biphasic effect on OTR expression in myometrial cells, and C/EBP and NF-
B play synergistic roles in OTR promoter activation.
| Introduction |
|---|
|
|
|---|
The oxytocin/oxytocin receptor (OT/OTR) system plays a role in the regulation of parturition. Concentrations of OTR increase before parturition, OT concentrations increase in gestational tissues in association with labor (5), infusions of OT stimulate myometrial contractions indistinguishable from those of normal labor, and antagonists to OTR can disrupt the normal pattern of labor and are currently used as tocolytic agents (6, 7).
The increased myometrial sensitivity to OT at term is mediated through increased OTR expression. There is a greater than 300-fold increase in the human OTR mRNA within the myometrium of the term uterus compared with the nonpregnant uterus (8, 9). The mechanisms controlling the expression or function of OTR in human pregnancy remain largely undefined. Within the uterus, OTR is present in myometrial, endometrial, and amnion cells, where it mediates contractions and prostaglandin release (10, 11, 12).
OTR is a cell surface membrane receptor with seven transmembrane domains that belongs to the class I G protein-coupled receptor family. The OTR gene encodes 389 amino acids and is present as a single copy in the human genome mapped to the gene locus 3p253p26.2. The gene spans 17 kb and contains three introns and four exons. Deletion experiments show that approximately 1000 bp upstream of the coding region are needed for expression of the OTR (13). In other species, OTR is up-regulated by estrogen and down-regulated by progesterone (14, 15, 16). The human OTR promoter does not, however, contain any full consensus estrogen or progesterone response elements, and there is no evidence of direct action of steroids on the OTR gene promoter.
The OTR promoter contains putative transcription factor-binding sites for C/EBP and NF-
B. These transcription factors are frequently associated with inflammation and activation of acute phase response genes. IL-1ß expression increases with labor. However, data on the effect of cytokines on OTR activity are conflicting. Schmidt et al. (17) and Helmer et al. (18) reported a decrease in OTR mRNA in an immortalized human myometrial cell line after treatment with IL-1ß. Rauk et al. (19, 20) reported down-regulation of OTR mRNA after treatment with IL-1ß and up-regulation after treatment with IL-6 in primary human uterine smooth muscle cells.
Nuclear factor-
B (NF-
B) is a cytokine-inducible transcription factor that plays a key role in the expression of a variety of genes involved in inflammatory responses and cell survival (21, 22). NF-
B is composed of homo- or heterodimeric complexes of members of the Rel family of proteins. The most abundant of these complexes is the p65-p50 heterodimer (23). NF-
B activity increases in the human amnion at the time of labor, and studies in rodents suggest that there may also be an increase in myometrium (24). The CCAAT/enhancer-binding protein (C/EBP) family of transcription regulators is composed of six functionally related, basic leucine zipper binding proteins (C/EBP
, -ß, -
,-
, -
, and -
). C/EBPß was originally identified as a mediator of IL-6 signaling and is therefore also known as NF-IL-6. It regulates a variety of genes, including genes for acute phase response proteins (25).
In this study we investigate the effect of IL-1ß on OTR mRNA expression and ligand binding in pregnant human myometrium, and we explore the roles of the transcription factors AP-1, C/EBP, and NF-
B in the transcriptional regulation of OTR promoter.
| Materials and Methods |
|---|
|
|
|---|
Ethics committee approval was obtained for this study. Myometrial cells were extracted from biopsies taken at the time of elective cesarean section at term. None of the patients was in labor or had received uterotonics. Tissue was minced and digested for 45 min in DMEM containing 1 mg/ml collagenase type IA and IX (Sigma-Aldrich Corp., St. Louis, MO). Cells were centrifuged at 400 x g for 10 min and grown in DMEM with 10% fetal calf serum, L-glutamine, and penicillin-streptomycin (37 C and 5% CO2). Myometrial cells produced by this method were demonstrated by immunocytochemistry to be OTR positive. Cells were serum starved for 16 h before treatment with IL-1ß (R&D Systems, Inc., Minneapolis, MN).
Quantitative RT-PCR
Total RNA was isolated using RNA STAT-60 (Tel-Test, Inc., Friendswood, TX). RNA (1 µg) was used as a template for RT. Random hexanucleotide primers and mouse myeloma leukemia virus reverse transcriptase (Promega Corp., Southampton, UK) were used. The expressions of OTR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were verified by real-time RT-PCR using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). TaqMan primers and probes were designed using the primer Express program (Applied Biosystems). The sequences used were as follows: OTR forward, GATGGGAAGGGTGGT (22062225 bp; from NM_000916); OTR reverse, CAAGGACCCCAGCATTTGTT (22632282 bp); OTR TaqMan probe, CCTCCTGACCTCAAAGTGTATTTGCCTTTAAGC (22292261 bp); GAPDH forward, GAAGGTGAAGGTCGGAGT (594611 bp; from XM_068376); GAPDH reverse, GAAGATGGTGATGGGATTTC (800819 bp); and GAPDH TaqMan probe, ATTTGGTCGTATTGGGCGCCTGGTCACC (618646 bp). The data were analyzed using Sequence Detector version 1.7 software (Applied Biosystems) and were normalized to GAPDH. Statistical significance was determined by ANOVA.
Plasmid construction
The OTR promoter construct was prepared from genomic DNA by PCR using selected sense/antisense primers (sense, GCGCGGTACCAAAGAAGGGGAGGC TTGGT; antisense, GGCCAAGCTTGGTCCCAGAGCCTTAACAAA). The purified PCR product (1.1 kb) was cloned into pGEM-Teasy (Promega Corp.) using restriction enzyme sites for KpnI (at the 5' end) and HindIII (at the 3' end). The product was then purified and double digested with KpnI/HindIII and inserted into the KpnI/HindIII polylinker restriction site upstream of the luciferase reporter gene in the promoterless pGL3-basic vector (Promega Corp.). Shorter promoter constructs 656 bp from transcription start site (TSS) and 350 bp were similarly prepared with PCR amplification and cloning into the pGL3-basic vector. Deletion from 1048 to 851 was performed by introducing two SacI sites with site-directed mutagenesis and then digesting the 197 bp from the OTR promoter. For site-directed mutagenesis, the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used. The mutagenic oligonucleotide primers were designed individually, and the introduced mutations were verified with EMSAs to ensure that the oligonucleotides did not result in specific DNA binding. Constructs were confirmed by restriction digests and DNA sequencing (Table 1
).
|
Myocytes were grown in 24-well plates to 80% confluence. Transient transfections were carried out using a liposome-mediated method with FuGene 6 transfection reagent (Roche, Indianapolis, IN). Cytomegalovirus-Renilla vector (1/10th of reporter) was used to control for transfection efficiency and cell number. Expression constructs for C/EBPß, NF-
Bp65, and AP-1 c-Fos and c-Jun were all cotransfected at 0.2 µg/well. The empty expression vector pSG5 was included as a filler construct when required so that the total amount of transfected DNA per well was constant. In preliminary experiments, higher and lower concentrations of expression vectors showed similar data, but for all subsequent experiments, concentrations of 0.2 µg/well were used.
Cells were cultured for a total of 48 h, followed by harvesting and analysis with a dual firefly/Renilla luciferase assay (Luclite, Packard Bell, Wijchen, The Netherlands; and Coelentrerazin CNBiosciences).
Protein extraction, SDS-PAGE, Western blot, and immunodetection
Monolayer myometrial cells were lysed in buffer containing 10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM dithiothreitol, 1% Nonidet P-40, and a Roche Complete protease inhibitor tablet. Cytosolic protein extracts were obtained in the supernatant after centrifugation of the cell lysate for 30 sec at 12,000 x g at 4 C. The pellet was resuspended in buffer and shaken vigorously for 15 min on ice. Nuclear protein extracts were obtained in the supernatant after centrifugation for 5 min at 12,000 x g at 4 C. Protein samples were separated by electrophoresis on a 10% SDS-polyacrylamide gel for 80 min at 150 V. Transfer from gel to polyvinylidene difluoride membrane (Anachem, Luton, UK) took place in a semidry chamber with three buffer systems (manufacturers instructions). Blocking of membrane was carried out with 0.5% (wt/vol) I-Block (Tropix, Bedford, UK) in PBS-Tween for 2 h at room temperature. Primary antibody (dilution 1:1000 in PBS-Tween) was applied for 1 h at room temperature, followed by incubation with horseradish peroxidase-conjugated antirabbit antibodies (Sigma-Aldrich Corp., St. Louis, MO; dilution 1:2000 in PBS-Tween) for 1 h at room temperature. Signal detection was carried out using ECL Plus (Amersham Biosciences, Arlington Heights, IL).
Coimmunoprecipitation
Coimmunoprecipitation was carried using an initial antibody to NF-
Bp65 (SC-8008). After protein A-Sepharose bead separation, proteins bound to p65 antibodies were separated on an SDS-PAGE gel and probed with an antibody to C/EBPß (SC-7962). To confirm the interaction, the experiment was repeated using anti-C/EBPß to initially immunoprecipitate the protein and anti-p65 to identify proteins on the SDS-PAGE gel (see Fig. 3D
).
|
Nuclear protein extract (5 µg) was incubated on ice for 1 h with nonradiolabeled (cold) specific competitive and nonspecific competitive (Oct-1) oligonucleotide (1.75 pmol) in binding buffer with polydeoxyinosinic-polydeoxycytidylic acid to minimize nonspecific binding (26) (4% glycerol, 1 mM MgCl2, 0.4 mM EDTA, 10 mM Tris-HCl, 50 mM NaCl, and 0.4 mM dithiothreitol), then incubated for 45 min on ice with [
-32P]ATP end-labeled oligonucleotide probe. Nonradiolabeled oligonucleotides were at 200-fold excess to the 32P-labeled probes for specific and nonspecific competitions for DNA binding. The resulting protein/DNA complexes were separated in a 4% acrylamide gel run at 250 V for 1 h. The gel was dried under vacuum for 1 h at 80 C and exposed to x-ray film. For supershift analysis, samples were preincubated with antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 30 min before the addition of oligonucleotides.
OTR binding assays
OTR binding was measured in a competitive-binding assay using the OT analog, ornithine vasotocin (OVT). Primary myocytes were plated in six-well plates and studied in confluence. The cells were incubated with 6 pM 125I-labeled OVT (Perkin-Elmer NEX254) and 5500 nM unlabeled OT (Sigma-Aldrich Corp.) in serum-free medium at 37 C for 1 h. After incubation, myocytes were washed with cold 5 C serum-free DMEM, then lysed with 1 M NaOH. The lysate was counted on a
-counter. Statistical significance was determined by ANOVA.
| Results |
|---|
|
|
|---|
An increase in OTR mRNA expression (compared with GAPDH) occurred on application of 1 ng/ml IL-1ß to myocytes in culture (Fig. 1A
). IL-1ß had no effect on GAPDH expression (data not shown). The effect of IL-1ß was significant at 2 h and maximal at 4 h, at which time there was a 3-fold increase in OTR mRNA expression (n = 5; P < 0.001, by ANOVA). The effect of IL-1ß treatment was biphasic; mRNA concentrations returned to control values after 8 h of treatment, followed by a significant reduction at 24 h. IL-1ß (10 ng/ml) produced a similar time-dependent effect, with a transient increase in OTR mRNA at 2 and 4 h, followed by a reduction at 24 h (data not shown).
|
IL-1ß results in increased nuclear protein-DNA binding to consensus AP-1, NF-
B, and C/EBPß DNA sequences
Western analysis of whole-cell lysate of myometrial biopsies showed the presence of C/EBPß-liver-activating protein (LAP). Two isoforms of C/EBPß were identified with molecular masses of 35 and 38 kDa. These represent the activating isoforms of C/EBPßLAP. The presence of NF-
B subunits p65 and p50 and AP-1 subunits c-Jun and c-Fos was also demonstrated (Fig. 2A
).
|
B subunits p65, c-Jun, and C/EBPßLAP, as demonstrated by Western analysis using nuclear protein extracts (Fig. 2B
B, each of which was increased by incubation of the cells with IL-1ß (1 ng/ml). Two specific protein-DNA complexes (designated A and B) were identified by EMSA using NF-
B-specific oligonucleotides. Antibody to p50 supershifted both complexes A and B (band C). Antibody to p65 (RelA) supershifted complex A (band D; Fig. 2C
C/EBPß and NF-
Bp65 potentiate OTR promoter activity and act synergistically
The OTR promoter contains putative AP-1, C/EBP, and NF-
B transcription factor-binding sites (Fig. 3A
). To investigate whether these transcription factors play a role in the regulation of OTR promoter, primary myocytes were transiently transfected with a construct of the OTR promoter (1.1 kb from the transcription start site) linked to a luciferase reporter gene (pGL3OTR1.1) together with expression vectors for c-Jun/c-Fos (i.e. AP-1), C/EBPßLAP, and NF-
Bp65. Cytomegalovirus-Renilla expression was used to control for transfection efficiency.
AP-1 had no effect on OTR promoter activity. C/EBPß (pSG5-LAP) and NF-
Bp65 (pSG5-p65) caused approximately 6- and 7-fold inductions of OTR promoter-induced luciferase activity, respectively (n = 6; P < 0.001, by ANOVA; Fig. 3B
). When C/EBPßLAP and NF-
Bp65 concentrations were increased simultaneously, there was an approximately 55-fold induction of OTR promoter activity (n = 6; P < 0.01, by ANOVA), demonstrating cooperation between C/EBPß and NF-
B, leading to synergistic transactivation of the OTR promoter (Fig. 3C
). No similar synergy was seen between AP-1 and NF-
Bp65. Coimmunoprecipitation with either anti-NF-
Bp65 or anti-C/EBPß showed interaction between these two transcription factors (Fig. 3D
).
Roles of NF-
B and C/EBP sites in OTR promoter function
Using online computer-based sequence analysis (Transcription Factor search www.cbrc.jp/research/db/TFSEARCH.html), we identified three putative NF-
B-binding sites and 11 putative C/EBP-binding sites (Fig. 4A
). These were designated NF
B-13 and C/EBP-111 (Table 1
). Five putative AP-1-binding sites were identified, but were not studied further, because AP-1 overexpression did not drive the OTR promoter. Oligonucleotides designed from each of the three putative NF-
B sites were used in EMSA studies. Specific NF-
B binding was seen to the putative NF-
B-1 sequence, which was confirmed by competition using nonlabeled oligonucleotide and supershift by antibodies to p65 and p50, but not p52. The NF-
B-2 sequence did not bind any protein. The NF-
B-3 sequence demonstrated specific DNA binding and resulted in supershift by p52 antibody. All putative C/EBPß sites, except C/EBPß-2 and -3, showed specific C/EBPß binding, which was confirmed by competition using nonlabeled oligonucleotide and supershift by antibodies to C/EBPß (Fig. 4B
).
|
B sites found to bind DNA was performed in the 1.1-kb OTR promoter luciferase construct (pGL3OTR1.1; Table 1
B alone or the combination of the two. A double mutation of the two NF-
B sites, NF-
B-1 and NF-
B-3, led to inhibition of the effect of NF-
B, but not of C/EBPß or of the combination of NF-
B and C/EBP, on OTR promoter activity. The NF-
B-1- and C/EBP-1-binding sites overlapped at 961 to 945 and therefore represented a possible site for the synergistic action of NF-
B and C/EBPß. However, neither double mutation of NF
B-1 and C/EBP-1 nor complete deletion of this site had any effect on activation of the OTR promoter by NF-
Bp65 and C/EBPß, either alone or in combination (Fig. 4
Synergistic effect of C/EBPß and NF-
Bp65 on OTR promoter activity is mediated by a DNA region between 851 and 656
Because no single transcription factor-binding site was found to be responsible for the synergistic effect of C/EBPß and NF-
Bp65 on OTR promoter activity, deletion constructs of the 1.1-kb OTR promoter luciferase construct (pGL3OTR1.1) were performed to identify the responsible promoter region. Deletion from 1048 to 851 was not associated with any change in response of the OTR promoter to C/EBPß and NF-
Bp65 (Fig. 5B
). Deletion from 1062 to 656 eliminated the synergistic effect of C/EBPß and NF-
Bp65, but the effects of C/EBPß and NF-
Bp65 alone were retained (Fig. 5C
). Deletion from 1062 to 350 eliminated the responses to C/EBPß and NF-
Bp65 alone and their synergistic effect (Fig. 5D
). A construct consisting of the region 1062 to 656 attached to the TATA box (with the region 655 to 96 deleted) had a response to C/EBPß and NF-
Bp65 alone and in combination that was similar to the response of the full-length promoter (Fig. 5E
).
|
| Discussion |
|---|
|
|
|---|
We have shown that treatment of primary human myocytes with IL-1ß results in a rapid transient up-regulation of OTR mRNA expression and that this is associated with increased OTR binding. The IL-1ß concentration required to up-regulate the OTR is within the physiological range (31). Both Rauk and Friebe-Hoffmann (19) and Mitchell and Schmid (32) reported that IL-1ß down-regulates OTR mRNA. This conflict may be explained by differences in experimental design. Rauk and Friebe-Hoffmann (19) measured RNA only by Southern blotting of agarose gels. However, they found an increase in OTR expression stimulated by IL-1ß at time points earlier than 25 h. Mitchell and Schmid (32) used an immortalized nonpregnant uterine cell line that may not be a good model for human pregnant myometrium. There results were expressed as a percentage of the RNA concentration at time zero, with no individual incubation time point controls. This approach does not take into account mRNA stability in the unstimulated cells, which represents a potential flaw in the data. This seems to us to be counterintuitive. It is well established that IL-1ß concentrations within the uterus increase at the time of both term and preterm labor (33), as does the expression of several labor-associated proteins, such as cyclooxygenase-2 (COX-2) and IL-8, each of which is up-regulated by IL-1ß (34, 35, 36, 37, 38). OTR expression is also up-regulated at term, when IL-1ß concentrations are high and COX-2 and IL-8 expression increases. Our data suggest that IL-1ß increases OTR expression.
The transient effect of IL-1ß on OTR expression in this in vitro model suggests that IL-1ß and/or NF-
B may play a physiological role in OTR expression. The effect of IL-1ß on COX-2 or IL-8 shows a similar pattern of up-regulation in various cell culture models (34, 39). The expression of both COX-2 and IL-8 increases within the uterus at term and is dependent upon NF-
B binding (40, 41, 42). C/EBPß has also been shown to play an important role in the expression of COX-2 within the uterus (43, 44).
IL-1ß is known to act through activation of NF-
B in a variety of cells types. Belt et al. (45) showed that stimulation of COX-2 expression in human myocytes is mediated through NF-
B. Our data show that IL-1ß leads to nuclear translocation and to the potential for increased DNA binding of NF-
Bp65 and p50. IL-1ß has previously been shown to increase C/EBPß expression at the mRNA level (46). In this study we show that it increases C/EBPß nuclear concentrations. This may be relevant to parturition and to inflammatory processes in general, because a number of inflammatory mediators, including COX-2, IL-8, and IL-1ß itself are regulated by both NF-
B and C/EBPß.
We did not find synergy between AP-1 and NF-
B, and overexpression of AP-1 alone did not increase OTR promoter activity. This suggests that the AP-1 DNA-binding sequences are not important in the regulation of OTR expression. However, this interpretation should be made with caution, because AP-1 may interact with other transcription factors that were not examined in this study. Alone, C/EBPß and NF-
B had a modest effect on OTR promoter activity. Together, C/EBPß and NF-
B caused a dramatic increase in OTR promoter activity. Studies in which either transcription factor-binding site for NF-
B in the OTR promoter was mutated demonstrate that neither of the two NF-
B DNA-binding sites is essential for a response to NF-
B. The region between 656 and 850 and the region between 350 and 656 were each sufficient for activation of the promoter by NF-
B alone, and simultaneous mutation of both sites eliminated the response to NF-
B. This suggests that either of the NF-
B sites is able to mediate the response to NF-
B. Similarly, each of these two regions was also sufficient for activation of the promoter by C/EBPß alone, and no single C/EBP DNA-binding site was essential for the response to C/EBP. This suggests that there are probably several potentially functional C/EBP DNA-binding sites. The synergistic effect of the combination of C/EBPß and NF-
B on OTR promoter activity probably plays a more important role in the regulation of OTR than either alone. This effect is mediated by a 195-bp region of the OTR promoter that lies between 656 and 850, but does not appear to be a classical C/EBP or NF-
B DNA-binding site.
The synergistic actions of C/EBPß and NF-
B therefore occur through different mechanisms to exert their individual effects. Cross-talk between transcription factors of distinct families is an important phenomenon in regulating gene transcription. As a potent transcriptional activator, NF-
B often does not act alone to regulate its target gene promoters. Instead, NF-
B functions cooperatively with other DNA-binding factors to induce gene transcription. This functional cooperation usually involves physical interactions between these transcription factors. We have demonstrated with coimmunoprecipitation experiments that there is a physical interaction between NF-
Bp65 and C/EBPß. Transcription factors that have been shown to physically interact with NF-
B include AP-1 (47), specificity protein-1 (48, 49), C/EBP (50, 51, 52), and signal transducer and activator of transcription-6 (53). Synergy between C/EBPß and NF-
B has been shown to play a role in the expression of the serum-amyloid
gene (52, 54) and the IL-6 and IL-8 genes (47, 55, 56). C/EBPß and NF-
B can physically bind together. This involves the basic leucine zipper region of C/EBPß (47) and regions in the Rel homology and activation domains of p65 (57).
Preterm labor is associated with increased synthesis of IL-1ß and TNF-
within the uterus, each of which will activate the NF-
B and C/EBP transcription factor systems. This clearly suggests a mechanism by which OTR may be up-regulated in the etiology of preterm labor. We have previously shown that in the amnion there is up-regulation of NF-
B with the onset of labor (41). OTR is expressed in the amnion, where it regulates prostaglandin synthesis. NF-
B is likely to play a role in OTR expression in the amnion at term. Whether NF-
B and/or C/EBP are activated in myometrium at the time of term labor in the absence of inflammation is not yet known. Our data suggest that OTR may be considered a member of the family of acute phase response genes, activated by cytokines and regulated by inflammatory transcription factors, that are involved in the process of parturition.
| Acknowledgments |
|---|
B and AP-1 as well as for their support, help, and advice. | Footnotes |
|---|
First Published Online March 28, 2006
Abbreviations: AP-1, Activating protein-1; C/EBP, CCAAT/enhancer-binding protein; COX-2, cyclooxygenase-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LAP, liver-activating protein; NF-
B, nuclear factor-
B; OT, oxytocin; OTR, OT receptor; OVT, ornithine vasotocin; TSS, transcription start site.
Received December 7, 2005.
Accepted March 20, 2006.
| References |
|---|
|
|
|---|
B: ten years after. Cell 87:1320[CrossRef][Medline]
B and I
B proteins: new discoveries and insights. Annu Rev Immunol 14:649683[CrossRef][Medline]
B requires multiple coactivators. Mol Cell Biol 19:63676378
) release from cultured human fetal membranes in response to endotoxic lipopolysaccharide mirrors amniotic fluid concentrations. Am J Obstet Gynecol 174:18551862[CrossRef][Medline]
and interleukin-1ß in preterm and term human parturition. Am J Reprod Immunol 27:117123[Medline]
B and AP-1 are required for cyclo-oxygenase 2 gene expression in amnion epithelial cell line (WISH). Mol Hum Reprod 6:561565
B activity which mediates cyclo-oxygenase-2 expression and is involved with the functional progesterone withdrawal. Mol Hum Reprod 7:581586
B is essential for up-regulation of interleukin-8 expression in human amnion and cervical epithelial cells. Mol Hum Reprod 7:787790
regulation of prostaglandin H synthase-2 transcription is not through nuclear factor-
B in amnion-derived AV-3 cells. Placenta 21:789798[CrossRef][Medline]
B mediates interleukin-1ß-induced expression of cyclooxygenase-2 in human myometrial cells. Am J Obstet Gynecol 181:359366[CrossRef][Medline]
B and C/EBP family members: a Rel domain-bZIP interaction. Mol Cell Biol 13:39643974
B and Sp1 is required for HIV-1 enhancer activation. EMBO J 12:35513558[Medline]
B/Rel transcription factors. J Biol Chem 271:2247922486
B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J 12:38793891[Medline]
B and C/EBP heteromer in lipopolysaccharide induction of serum amyloid A gene expression in liver. J Biol Chem 270:73657374
B: direct association and synergistic activation of interleukin-4-induced transcription. Mol Cell Biol 18:33953404
B-like binding sites on rat serum amyloid A1 gene expression in liver cells. Nucleic Acids Res 20:47654772
B. Mol Cell Biol 13:71917198
B and C/EBP in the transcriptional regulation of genes. Int J Biochem Cell Biol 29:15251539[CrossRef][Medline]This article has been cited by other articles:
![]() |
B. F. Mitchell and M. J. Taggart Are animal models relevant to key aspects of human parturition? Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R525 - R545. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Challis, C. J. Lockwood, L. Myatt, J. E. Norman, J. F. Strauss III, and F. Petraglia Inflammation and Pregnancy Reproductive Sciences, February 1, 2009; 16(2): 206 - 215. [Abstract] [PDF] |
||||
![]() |
Z. Liang, S.R. Sooranna, N. Engineer, M. Tattersall, S. Khanjani, P.R. Bennett, L. Myatt, and M.R. Johnson Prostaglandin F2-alpha receptor regulation in human uterine myocytes Mol. Hum. Reprod., April 1, 2008; 14(4): 215 - 223. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |