This Article Abstract Full Text (PDF) All Versions of this Article: 91/6/2021    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nucera, C. Articles by Vermiglio, F. Search for Related Content PubMed PubMed Citation Articles by Nucera, C. Articles by Vermiglio, F. Related Collections Autoimmunity Calcium and Bone Metabolism Metabolism

Antiphospholipid Antibodies Syndrome Associated with Hyperhomocysteinemia Related to MTHFR Gene C677T and A1298C Heterozygous Mutations in a Young Man with Idiopathic Hypoparathyroidism (DiGeorge Syndrome)

Sezione di Endocrinologia (C.N., M.M., M.A.V., F.T., F.V.), Dipartimento Clinico-Sperimentale di Medicina e Farmacologia, Sezione di Dermatologia-Dipartimento di Medicina Sociale e del Territorio (M.V.), Sezione di Neuropsichiatria Infantile (G.T.), Dipartimento di Scienze Pediatriche Mediche e Chirurgiche, and Sezione di Biochimica e Biochimica Clinica (R.I.), Dipartimento di Biochimica, Fisiologia e Scienze della Nutrizione, University of Messina, 98100 Messina, Italy; Dana-Farber Cancer Institute (C.P., M.L.), Harvard Medical School, Boston, Massachusetts, 02115; Regina Elena Cancer Institute (C.P.), Medical Oncology, 00144 Roma, Italy; and Laboratorio di Citogenetica e Genetica Molecolare (A.A.), Ospedale Pediatrico Bambino Gesù, Istituto Di Ricovero e Cura a Carattere Scientifico, 00165 Roma, Italy

Address all correspondence and requests for reprints to: Francesco Vermiglio, M.D., Sezione di Endocrinologia quarto (IV) Piano Pad. H., Dipartimento Clinico-Sperimentale di Medicina e Farmacologia, University of Messina., A.O.U. Policlinico "G. Martino", Via Consolare Valeria 1, 98100 Messina, Italy. E-mail: francesco.vermiglio{at}unime.it.

	Abstract

Top Abstract Introduction Case Report Discussion References

 
Context: Antiphospholipid syndrome (APS, or Hughes’ syndrome) is a systemic autoimmune disorder characterized by antiphospholipid antibody positivity, which may lead to arterial and/or venous thrombosis. Hyperhomocysteinemia (HHcy), variously associated with 5,10-methylene tetrahydrofolate reductase (MTHFR) gene point mutations, is also implicated in thromboembolic events. The association of APS and HHcy has already been described but has never been reported in patients with DiGeorge syndrome (DGS), the most common contiguous-gene deletion syndrome (22q11.2) in humans, whose phenotype conversely includes bleeding disorders.

Data Acquisition: In this report, we present the case of a 19-yr-old patient with a past medical history of learning disability and obesity affected with idiopathic hypoparathyroidism, metabolic syndrome, and diffuse vasculitis disorders. He was referred to our endocrinology clinic for the management of severe hypocalcemia. At the time of presentation he had been taking antiepileptic drugs for 2 wk and displayed facial dysmorphism (short neck, micrognathia, a small mouth, hypoplastic nasal alae, eye hypertelorism, and low-set simple ears). DGS was suspected and confirmed by both fluorescence in situ hybridization analysis and single nucleotide polymorphism-array analysis, which revealed contiguous gene microdeletion of the chromosome 22q11.2 in the minimal DiGeorge critical region, specifically at the gene locus D22S75 (N25).

Conclusions: APS, revealed by anti-ß-2-glycoprotein and anti-prothrombin antibodies positivity, and moderate HHcy related to heterozygous C677T and A1298C point mutations of the MTHFR gene were identified as a possible cause of thrombotic disorder responsible for the widespread presence of cutaneous and cerebral lesions.

	Introduction

Top Abstract Introduction Case Report Discussion References

 
ANTIPHOSPHOLIPID SYNDROME (APS, or Hughes’ syndrome) is a systemic autoimmune disorder characterized by arterial and/or venous thrombosis and miscarriage. It is accompanied by mild to moderate thrombocytopenia and antiphospholipid antibodies (aPLs), mainly for lupus anticoagulant (LAC) and/or anticardiolipin antibody positivity. Vessel thromboses represent the most important clinical features, occurring in about 2.5% patients with APS (1). In particular, deep venous thrombosis of the legs and pulmonary emboli are more common than arterial thrombosis, which results in ischemic or infarctual events. Nonetheless, any vessel (vein or artery) can be affected in APS, regardless of its size or location. The clinical consequences therefore range from thrombotic microangiopathy to thrombosis of both large arteries and veins. APS patients can also display psychiatric and neurological (epilepsy, psychiatric disease, dementia, transverse myelitis, multiple sclerosis-like disease, migraine, Guillain-Barré syndrome, and sensorineural hearing loss) and dermatological disorders (livedo reticularis and skin ulcerations) (2).

Hyperhomocysteinemia (HHcy) is also implicated in venous and arterial thrombosis in addition to being a well- known risk factor for venous thromboembolism and stroke. Mild to moderate HHcy has been reported to be variously associated with C677T and A1298C mutations of the 5,10-methylene tetrahydrofolate reductase (MTHFR) gene with a prevalence ranging between 47–54 and 26–44%, respectively (3, 4).

The concurrence of APS and HHcy has already been described (5) but was never reported to be associated with hypoparathyroidism in the DiGeorge syndrome (DGS), which is the most common contiguous-gene deletion syndrome (22q11.2) in humans, mediated by homologous recombination between low-copy-number repeats. DGS is the result of an abnormal development of the third and fourth pharyngeal pouches. Its phenotype includes congenital heart defects, aplasia or hypoplasia of both thymus and parathyroid glands, facial dysmorphisms, endocrinopathies (6, 7), both cellular and humoral immunity disorders (8, 9, 10, 11), and bleeding disease such as Bernard-Soulier syndrome and idiopathic thrombocytopenic purpura (12, 13, 14). DGS prevalence in the Italian population, as well as in other European countries, has been estimated at one in 5000 live births (0.02%) (Rare Human Diseases Registry at www.orphanet.org).

Severe hypocalcemia in patients with 22q11.2 deletion syndrome frequently appears during the neonatal period (15) even if calcium homeostasis disorders ranging from mild hypocalcemic-hypoparathyroidism to normocalcemia, with normal serum PTH concentration, have also been reported (16, 17, 18).

This paper constitutes the first report of a case of DGS in a patient (a 19-yr-old boy) also affected with APS and HHcy related to heterozygous C677T and A1298C mutations of the MTHFR gene.

	Case Report

Top Abstract Introduction Case Report Discussion References

 
A 19-yr-old Italian male was referred to our endocrinology clinic for help with management of severe hypocalcemia despite a longstanding treatment with calcium supplements and 1,25-dihydroxyvitamin D₃ prescribed elsewhere for idiopathic neonatal hypocalcemia associated with seizures; parathyroid and thymus hypoplasia had also been misdiagnosed at birth. His past medical history was significant in that it included learning disability and prepubertal obesity. No seizure had been experienced since the neonatal period, and frequent serum calcium measurements proved normal. In more recent years, our patient had also suffered from dermatological manifestations characterized by multiple papulo-nodular-ulcero-necrotic lesions. A few weeks before presentation, the patient had experienced a seizure, which EEG focal discharge analysis enabled his doctor to diagnose as symptomatic focal epilepsy. The patient was consequently referred to the Child-Neuropsychiatry Clinic where serum calcium concentration was found to be 1.7 mmol/liter (normal values, 2.2–2.6) and serum intact PTH was undetectable. At the time of presentation at our clinic, the patient had been taking an antiepileptic drug (topiramate, 200 mg per day) for 2 wk.

Clinical, histological, biochemical, and instrumental findings

Clinical examination demonstrated facial dysmorphism consisting of short neck, micrognathia diagnosed by cranial x-rays, small mouth, hypoplastic nasal alae, eye hypertelorism, and low-set simple ears (Fig. 1, A and B). Further physical examination evidenced symptomatic hypocalcemia (Chvostek’s and Trousseau’s sign positivity), mitral valve insufficiency, which was confirmed by echocardiography, and class II obesity (height, 159 cm; weight, 96.6 kg; body mass index, 38 kg/m²; and waist circumference, >102 cm). He also had hypernasal speech and a flat nasal bridge. Funduscopic examination was negative. Mild bilateral sensorineural deafness (hearing loss of 10 dB at 8000 Hz) was also found. Standard tympanometry showed a normal curve (type A) in the left ear and abnormal curve (type C) in the right ear, the latter probably caused by Eustachian tube dysfunction. Acoustic reflexes were normal. Intelligence quotient (IQ) (Wechsler Intelligence Scale for Children) revealed moderate mental retardation (full IQ score, 40; performance IQ score, <45; verbal IQ score, 46). Noninflammatory thrombotic vasculopathy involving dermal arterioles and pigmented scars of the lower limbs (Fig. 2A) along with persistent violaceous livedo reticularis, with a large asymmetric open reticular pattern, were also present on the limbs and buttocks (Fig. 2B). Histological examination of a skin biopsy showed nonleukocytoclastic vasculitis features (Fig. 2, C–F). Nailfold videocapillaroscopy explained the complained recurrent episodes of acrocyanosis by demonstrating tortuous loops with homogeneously enlarged venous limbs, microbleeding, and capillary thrombosis (data not shown).

View larger version (62K): [in this window] [in a new window]   FIG. 1. A and B, Lateral (A) and frontal (B) profiles of our patient show clear dysmorphic features (short neck, micrognathia, small mouth, hypoplastic nasal alae, eye hypertelorism, and low-set simple ears). C, Fluorescence in situ hybridization analysis on lymphocyte metaphase spreads with dual-color probes specific for the N25 locus (red) and the ARSA subtelomeric region (green). Arrows indicate both chromosomes 22 showing two normal green signals but only one red signal, revealing the microdeletion of the DiGeorge critical region. D, SNP analysis, carried out on 100 K Affymetrix GeneChip set, demonstrates a deletion of the 22q11.2 DiGeorge critical region (black circle) in our patient’s peripheral blood DNA (car5). Four cell lines from the Affymetrix database were used to obtain a reference signal distribution, having a copy number of two at the specific SNP locus.

View larger version (76K): [in this window] [in a new window]   FIG. 2. Clinical appearance of cutaneous noninflammatory thrombotic vasculopathy. A, Pseudovasculitis skin lesion; B, livedo reticularis. C, Histological examination showed a slight increase in the thickness of the epidermis with fibrovascular hyperplasia in the mid-upper part of the dermis (white arrowhead), focal fibrinoid material accumulation in the papillary dermis (white arrow), and endothelial cells lining with vesicular and sometimes pyknotic nuclei. Perivascular focal eosinophilic material and mild lymphocytic infiltration were present in the papillary dermis. D, High magnification shows necrosis at the dermo-epidermal junction, with very mild perivascular lymphocytic infiltration (asterisk). E and F, Vascular hyperplastic reaction combined with mild lymphocytic inflammation was also present in the subcutaneous tissue. Adipose tissue presented hypertrophy and irregular lobulation, with a patchy vasculitis-like inflammation of fibrous septa (white arrow).

Immune system investigation by laser nephelometry showed normal values for serum IgA, IgM, and IgG, and flow cytometry revealed the following cellular immunity indices: CD4⁺ T-cell number, 38% (normal values, 32–60%); CD8⁺, 20% (normal, 16–40%); CD3⁺, 63% (normal, 56–85%); the component CD19⁺, 27% (normal, 3–17%); and CD4/CD8 ratio, 1.9 (normal, 1.25–2.4).

Hemocytometric analysis showed normal red, white, and differential cell counts but revealed thrombocytopenia (99,000/mm³) along with increased platelet size deviation width (18.2 fl; normal values, 9–17), mean platelet volume (12.7 fl; normal values, 7–10), platelet-to-large cell ratio (47%; normal values, 25–40%), and decreased platelet-CriT (0.18%; normal values, 0.19–0.38%); bone marrow megakaryoblastic hyperplasia was also observed. Finally, direct and indirect Coombs test, bleeding test, and spontaneous platelet aggregation proved normal; conversely, the ADP-inducted platelet aggregability was found to be at upper normal values (4 µmol/ml; normal values, 1–4) in two subsequent determinations. Impaired glucose tolerance, insulin resistance (homeostasis model assessment index, 5.7), hypertriglyceridemia, and low high-density lipoprotein cholesterol levels along with clinical features allowed us to make the diagnosis of metabolic syndrome according to the Adult Treatment Panel III criteria (19).

Neuroradiological signs of late cerebral thrombotic vasculopathy (Fig. 3) were associated with the presence of visual evoked potentials with a moderately increased latency period (O1-Cz with P1 latency = 116 msec and amplitude = 9.15 µV; Oz-Cz with P1 latency = 116 msec and amplitude = 15.6 µV; O2-Cz with P1 latency = 115 msec and amplitude = 16.1 µV).

View larger version (83K): [in this window] [in a new window]   FIG. 3. Axial and sagittal T2-weighted brain magnetic resonance imaging (MRI) showing multifocal hyperintense lesions of white matter. MRI reveals signs of cerebral vasculitis (multifocality, T2 hyperintensity, fluid-attenuated inversion recovery, and gadolinium enhancement). In detail, MRI showed partially confluent multifocal lesions between 3 mm and 2 cm located in the white subcortical area in both cerebral hemispheres (periventricular white area of the paratrigonal and semioval centers of the frontal cortex).

Additional immunological and genetic investigations

Standard chromosome analysis showed a normal male karyotype. Fluorescence in situ hybridization analysis revealed contiguous gene microdeletion of the chromosome 22q11.2 in the minimal DiGeorge critical region (Fig. 1C), specifically at the gene locus D22S75 (N25). The latter finding was also confirmed by single-nucleotide polymorphism array (SNP) analysis (hybridization on the 100 K Affymetrix GeneChip set; Affymetrix, Inc., Santa Clara, CA) (Fig. 1D). Furthermore, to explain the etiology of the cerebral and cutaneous vasculopathy lesions, which are not typical of DGS, we looked for both nuclear autoantibodies and aPLs once the causes of primary vasculitis, infectious, neoplastic processes, and connective tissue disorders had been ruled out, according to standardized criteria (20, 21). Our patient tested positive for, in particular, anti-ß2-glycoprotein (anti-ß2-GPI) and anti-prothrombin (anti-PT) aPLs, which were quantified by LAC (55 mg/dl; normal values, 0–44) on at least three occasions 6 wk apart (the patient did not complain of acute infections), according to current standard criteria (22).

Moderate HHcy (22.2 µmol/liter; normal values, <15), along with increased methionine (57 µmol/liter; normal values, 9.5–40), reduced folic acid values (2.04 ng/dl; normal values, 3–17), and normal vitamin B₁₂ levels, were also identified and attributed to heterozygous mutations (677 CT and 1298 AC substitutions) of the MTHFR gene (Fig. 4). MTHFR gene exons 4 and 7 were amplified by PCR analysis on 500 ng genomic DNA extracted from lymphocytes of freshly drawn peripheral blood samples by using Puregene DNA purification system (Gentra, Celbio, Italy). For the exon 4 C677T mutation, we used the forward primer GACCTGAAGCACTTGAAGGA and reverse primer CGAGCTTATGGGCTCTCCTG (94 C for 5 min, 94 C for 30 sec, 58 C for 30 sec, and 72 C for 30 sec for 30 cycles); for the exon 7 A1298C mutation, we used the forward primer TTTGGGGAGCTGAAGGACTA and reverse primer CTTTGTGACCATTCCGGTTT (94 C for 5 min, 94 C for 30 sec, 56 C for 30 sec, and 72 C for 30 sec for 30 cycles). The exon 4 (238-bp amplicon) and 7 (200-bp amplicon) PCR products were run on double-gradient gels (double-gradient denaturing gradient gel electrophoresis [DG-DGGE]) (6.5–12% polyacrylamide gel) by a DCode Universal Mutation Detection System (Bio-Rad, Milan, Italy). Finally, homo- and heteroduplexes were evaluated by direct sequencing analysis to confirm the above MTHFR point mutations that are responsible for the following amino acid substitutions: Ala-222Val (catalytic domain) for C677T and Glu-429Ala (regulatory domain) for A1298C.

View larger version (51K): [in this window] [in a new window]   FIG. 4. MTHFR gene C677T and A1298C point mutations detected by DG-DGGE. A, DG-DGGE analysis of C677T mutation: lane 1, wild-type reference sample (genotype CC); lane 2, C677T heterozygous point mutation; lane 3, homozygous reference sample (genotype TT). B, DG-DGGE analysis of A1298C mutation: lane 1, homozygous reference sample (genotype CC); lane 2, wild-type reference sample (genotype AA); lane 3, A1298C heterozygous point mutation (genotype AC).

	Discussion

Top Abstract Introduction Case Report Discussion References

 
This paper reports a case of DGS, chromosome 22q11.2 contiguous-gene deletion syndrome, in a 19-yr-old boy also affected by APS and HHcy related to heterozygous C677T and A1298C mutations of the MTHFR gene. This coexistence of syndromes has never been reported before, and it was the possibility that thrombotic factors other than those associated with metabolic syndrome might explain cerebral and cutaneous manifestations that encouraged our study.

A prothrombotic state has recently been described in patients with metabolic syndrome. The mechanisms that induce a prothrombotic state in insulin-resistant obese patients would seem to be multifactorial, characterized by endothelial activation (23) and associated with an inflammatory condition (24). In our patient, both cerebral and cutaneous late thrombotic vasculopathy presented, clinically, with the features of a vasculitis. It is worth remembering that vasculitis of the central nervous system (CNS) represents a sign of thrombotic vasculopathy (potentially devastating in children) and occurs as an isolated phenomenon of unknown cause (primary CNS vasculitis) or in conjunction with an identifiable systemic condition (secondary CNS vasculitis) (25).

Having ruled out primary vasculitis as well as other causes such as infectious, neoplastic processes and connective tissue disorders, we found our patient to be aPL positive. aPLs are a heterogeneous group of antibodies that attack serum phospholipid-binding proteins. The most common aPLs are the anti-ß2-GPI, anti-PT (both evaluated by LAC assay), anti-protein C, and anti-protein S. Anti-ß2-GPI, anti-PT, and/or anticardiolipin antibodies are frequently used as standard laboratory criteria for the diagnosis of APS, or Hughes’ syndrome, a systemic autoimmune disorder (26) characterized by a number of clinical features including deep vein thrombotic events, thrombocytopenia (<100,000 platelets/µl), epilepsy, livedo reticularis, skin ulcers, pseudovasculitic skin lesions, etc. (27). There is evidence that aPLs might represent an independent risk factor for ischemic stroke. CNS thrombotic lesions, in our patient, were diffuse and involved both the cerebral hemispheres (periventricular white area of the paratrigonal and semioval centers of the frontal cortex). These lesions probably caused neuronal connection injury in different cerebral areas, thus aggravating his cognitive functions.

Our patient also proved to have moderate HHcy, which leads to vascular events, inducing a prothrombotic state (28). Increased plasma levels of Hcy are independently associated with an increased risk of atherothrombotic events (coronary heart disease and stroke) and, to a lesser extent, deep venous thrombosis. HHcy occurs in various conditions including MTHFR gene alterations such as the heterozygous C677T and A1298C point mutations found in our patient. The occurrence of combined heterozygosity for both C677T and A1298C has been reported to result in similar clinical features as observed in homozygous C677T mutation, which is known to be associated with a higher risk for neural tube defects and vascular disease (3, 29).

Although we cannot make at present any speculation on a possible genetic link between DGS and MTHFR gene point mutations, what we actually know is that metabolic alterations of HHcy contributed to accelerate atherosclerosis and APS thromboembolic complications in our patient with DGS. The association of DGS and APS might, in turn, be explained by thymus hypoplasia, which, being part of the DGS phenotype, predisposes to autoimmune diseases (such as APS), including some autoimmune endocrinopathies.

Finally, the rare association of APS and HHCy (related to MTHFR gene C677T and A1298C mutations), along with the metabolic syndrome, might explain in our patient the unusual DGS presentation with widespread occurrence of thrombotic disorders actually contrasting with bleeding events mostly reported in DGS.

In conclusion, the interest of this report lies in the fact that this is the first observation of metabolic and autoimmune disorders synergically inducing microcirculatory thrombotic manifestations, which, therefore, might be also investigated in patients with DGS.

	Acknowledgments

 
We are grateful to Dr. Alessandro Porrello from the Institute for Genome Sciences and Policy, Duke University (Durham, NC) for his support in statistical analysis.

	Footnotes

 
This work was supported by grants from the University of Messina, Italy.

All authors have nothing to declare.

First Published Online April 4, 2006

Abbreviations: aPL, Antiphospholipid antibody; APS, antiphospholipid syndrome; CNS, central nervous system; DG-DGGE, double-gradient denaturing gradient gel electrophoresis; DGS, DiGeorge syndrome; ß2-GPI, ß2-glycoprotein; HHcy, hyperhomocysteinemia; IQ, intelligence quotient; LAC, lupus anticoagulant; MTHFR, 5,10-methylene tetrahydrofolate reductase; PT, prothrombin; SNP, single-nucleotide polymorphism array.

Received December 20, 2005.

Accepted March 14, 2006.

	References

Top Abstract Introduction Case Report Discussion References

 

1. Finazzi G 2001 The epidemiology of the antiphospholipid syndrome: who is at risk? Curr Rheumatol Rep 3:271–276[Medline]
2. Marai I, Zandman-Goddard G, Shoenfel Y 2004 The systemic nature of the antiphospholipid syndrome. Scand J Rheumatol 33:365–372[CrossRef][Medline]
3. van der Put NM, Gabreels F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes TK, van den Heuvel LP, Blom HJ 1998 A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural tube defects? Am J Hum Genet 62:1044–1051[CrossRef][Medline]
4. Caccamo D, Condello S, Gorgone G, Crisafulli G, Belcastro V, Gennaro S, Striano P, Pisani F, Ientile 2004 Screening for C677T and A1298C MTHFR polymorphisms in patients with epilepsy and risk of hyperhomocysteinemia. Neuromol Med 6:117–126
5. Lee RM, Brown MA, Ward K, Nelson L, Branch DW, Silver RM 2004 Homocysteine levels in women with antiphospholipid syndrome and normal fertile controls. J Reprod Immunol 64:23–30
6. Choi JH, Shin YL, Kim GH, Seo EJ, Kim Y, Park IS, Yoo HW 2005 Endocrine manifestations of chromosome 22q11.2 microdeletion syndrome. Horm Res 63:294–299[CrossRef][Medline]
7. Digilio MC, Marino B, Cappa M, Cambiaso P, Giannotti A, Dallapiccola B 2001 Auxological evaluation in patients with DiGeorge/velocardiofacial syndrome (deletion 22q11.2 syndrome). Genet Med 1:30–33
8. Jawad AF, McDonald-McGinn DM, Zackai E, Sullivan KE 2001 Immunologic features of chromosome 22q11.2 deletion syndrome (DiGeorge syndrome/velocardiofacial syndrome. J Pediatr 139:715–723[CrossRef][Medline]
9. Sullivan KE 2001 DiGeorge syndrome/chromosome 22q11.1 deletion syndrome. Curr Allergy Asthma Rep 1:438–444[Medline]
10. Ryan AK, Goodship JA, Wilson DI, Philip N, Levy A, Seidel H, Schuffenhauer S, Oechsler H, Belohradsky B, Prieur M, Aurias A, Raymond FL, Clayton-Smith J, Hatchwell E, McKeown C, Boemer FA, Dallapiccola B, Novelli G, Hurst JA, Ignatius J, Patton M, Peterson J, Scambler PJ 1997 Spectrum of clinical features associated with interstitial chromosome 22q11 deletions: a European collaborative study. J Med Genet 34:798–804[Abstract]
11. Shaikh TH, Kurahashi H, Saitta SC, O’Hare AM, Hu P, Roe BA, Driscoll DA, McDonald-McGinn M, Zackai EH, Budarf ML, Emanuel BS 2000 Chromosome 22-specific low copy repeats and the 22q11.2 deletion syndrome: genomic organization and deletion endpoint analysis. Hum Mol Genet 9:489–501[Abstract/Free Full Text]
12. Budarf ML, Konkle B, Michaud D, Ludlow LB, Michaud D, Mengrong L, Yamashiro DJ, McDonald-McGinn DM, Zackai E, Driscoll D 1995 Identification of a patient with Bernard-Soulier syndrome and a deletion in the DiGeorge/velo-cardio-facial chromosome region in 22q11. Hum Mol Genet 4:763–766[Free Full Text]
13. Lawrence S, McDonald-McGinn DM, Zackai E, Sullivan KE 2003 Thrombocytopenia in patients with chromosome 22q11.2 deletion syndrome. J Pediatr 143:277–278[Medline]
14. Levy A, Michel G, Lemerrer M, Philip N 1997 Idiopathic thrombocytopenic purpura in two mothers of children with DiGeorge sequence. Am J Med Genet 69:356–359[CrossRef][Medline]
15. Sullivan KE 2004 The clinical, immunological and molecular spectrum of chromosome 22q11.2 deletion syndrome and DiGeorge syndrome. Curr Opin Allergy Clin Immunol 4:505–512[Medline]
16. Cuneo BF, Driscoll DA, Gidding SS, Langman CB 1997 Evolution of latent hypoparathyroidism in familial 22q11 deletion syndrome. Am J Med Genet 69:50–55[CrossRef][Medline]
17. Weinzimer SA 2001 Endocrine aspects of the 22q11.2 deletion syndrome. Genet Med 3:19–22[Medline]
18. Taylor SC, Morris G, Wilson D, Davies SJ, Gregory JW 2003 Hypoparathyroidism and 22q11 deletion syndrome. Arch Dis Child 88:520–522[Abstract/Free Full Text]
19. Grundy SM 2004 Obesity, metabolic syndrome, and cardiovascular disease. J Clin Endocrinol Metab 6:2595–2600
20. The American College of Rheumatology 1990 Criteria for the classification of vasculitis. Arthritis Rheum 33:1065–1136[Medline]
21. Kelley RE 2004 CNS vasculitis. Front Biosci 9:946–955[Medline]
22. Brandt JT, Triplett DA, Alving B, Scharrer I 1995 Criteria for the diagnosis of lupus anticoagulants: an update. On behalf of the subcommittee on lupus anticoagulant/antiphospholipid antibody of the Scientific and Standardisation Committee of the ISTH. Thromb Haemost 74:1185–1190[Medline]
23. Juhan-Vague I, Morange PE, Alessi MC 2002 The insulin resistance syndrome: implications for thrombosis and cardiovascular disease. Pathophysiol Haemost Thromb 32:269–273[CrossRef][Medline]
24. Caballero AE 2004 Endothelial dysfunction, inflammation, and insulin resistance: a focus on subjects at risk for type 2 diabetes. Curr Diab Rep 4:237–246[Medline]
25. Benseler S, Schneider R 2004 Central systemic vasculitis in children. Curr Opin Rheumatol 16:43–50[Medline]
26. Galli M, Barbui T 2005 Antiphospholipid syndrome: clinical and diagnostic utility of laboratory tests. Semin Thromb Haemost 31:17–24[Medline]
27. Cervera R, Piette JC, Font J, Khamashta MA, Shoenfeld Y, Camps MT, Jacobsen S, Lakos G, Tincani A, Kontopoulou-Griva I, Galeazzi M, Meroni PR, Derksen RH, De Groot PG, Gromnica-Ihle E, Baleva M, Mosca M, Bombardieri S, Houssiau F, Gris JC, Querè I, Hachulla E, Vasconcelos C, Roch B, Fernandez-Nebro A, Boffa MC, Hughes GR, Ingelmo M 2002 Antiphospholipid syndrome. Arthritis Rheum 4:1019–1027
28. Cattaneo M 1999 Hyperhomocysteinemia, atherosclerosis and thrombosis. Thromb Haemost 81:165–176[Medline]
29. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJH, den Heiijer M, Kluijtmans LAJ, van den Heuvel LP, Rozen R 1995 A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 10:111–113[CrossRef][Medline]

This article has been cited by other articles:

				A. Sestak and K. O'Neil Review: Familial lupus and antiphospholipid syndrome Lupus, August 1, 2007; 16(8): 556 - 563. [Abstract] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 91/6/2021    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nucera, C. Articles by Vermiglio, F. Search for Related Content PubMed PubMed Citation Articles by Nucera, C. Articles by Vermiglio, F. Related Collections Autoimmunity Calcium and Bone Metabolism Metabolism