| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Center for Reproductive Sciences, Department of Obstetrics, Gynecology, and Reproductive Sciences (H.I., R.B.J.), and Genomic Analysis Core Facility, Comprehensive Cancer Center (D.G.G.), University of California, San Francisco, San Francisco, California 94143
Address all correspondence and requests for reprints to: Robert B. Jaffe, M.D., Center for Reproductive Sciences, 1450 Health Science West, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Objective: The objective of this study was to investigate expression and ACTH regulation of Angs and their receptor Tie2 in the HFA.
Design, Setting, and Patients: Studies were conducted involving RNA, frozen sections, and primary cell cultures from HFAs (14–24 wk) and human adult adrenal RNA.
Main Outcome Measures: Angs and Tie2 mRNA levels were determined by real-time quantitative RT-PCR, Ang2 and Tie2 were localized by immunostaining, and ACTH regulation of Angs was investigated by real-time quantitative RT-PCR, Western blot, and ELISA.
Results: Mean HFA Ang2 to Ang1 mRNA ratio was 6.3-fold higher than adult adrenals (P < 0.001). Ang2 was localized predominantly in the HFA periphery, whereas Tie2 demonstrated endothelial localization. In isolated HFA cortical cells, ACTH up-regulated Ang mRNA levels in a time- and dose-dependent manner, with the balance favoring Ang2. Ang2 protein levels were elevated in ACTH-stimulated HFA cortical cells and conditioned medium. 8-Bromoadenosine cAMP and forskolin mimicked ACTH effects on the Angs.
Conclusions: Higher HFA Ang2 to Ang1 ratios may reflect greater vascular remodeling than in the adult. Angs, particularly Ang2, in concert with vascular endothelial growth factor, may mediate ACTH tropic action, ensuring coordination of HFA growth, steroidogenesis, and angiogenesis.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Angiogenesis, the process of formation of new capillaries from preexisting blood vessels, is essential for embryonic and fetal organ development as well as the support of normal metabolic demands. Among a variety of factors implicated in the regulation of angiogenesis, vascular endothelial growth factor (VEGF) family members and the angiopoietins (Angs) are believed to act almost exclusively on vascular endothelial cells (3). The VEGF family members regulate endothelial cell proliferation, migration, and survival, essential components of angiogenesis (4). Among the Ang family, Ang1 and Ang2 have been the most extensively studied to date (3, 5). Both Ang1 and Ang2 act as ligands of the endothelial cell-specific tyrosine kinase receptor, Tie2. Through binding to Tie2, Ang1 supports endothelial cell survival, promotes vascular integrity, and stabilizes the established vasculature. In contrast, Ang2 promotes vessel destabilization by antagonizing the effects of Ang1 (6). Indeed, Ang2 expression is restricted to sites of vascular remodeling. It has been proposed that Ang2 renders endothelial cells responsive to angiogenic stimuli, such as VEGF. However, in the absence of such stimuli, the expression of Ang2 produces vascular regression (3, 7).
Although the adrenal gland is one of the most highly vascularized organs in the human fetus, little is known about the factors and mechanisms responsible for regulating its vascular development. The development of an extensive vasculature in the organ is essential for delivery of tropic hormones and steroid hormone precursors to the gland and secretion of hormone products into the peripheral circulation. Furthermore, the establishment of an adequate vascular supply is an absolute requirement for normal organ growth. It is evident, therefore, that regulation of the vasculature must be coordinated with tropic regulation of the HFA so that blood vessel formation and adrenal growth are synchronized. The central drive for growth and function of the HFA is provided by ACTH (1, 8, 9). The growth-stimulatory actions of ACTH are mediated, at least in part, by locally produced growth factors, acting in an autocrine and/or paracrine fashion (9, 10, 11). Therefore, we hypothesized that ACTH modulates adrenal angiogenesis by stimulating the local expression of vascular endothelial cell-specific angiogenic factors. We previously demonstrated that ACTH up-regulates VEGF in HFA cortical cells (8). Similar results subsequently were reported in studies using human and bovine adult adrenal cortical cells (12, 13, 14). However, to date, expression and regulation of the Ang/Tie2 system have not been documented in the primate adrenal gland.
Therefore, we examined whether ACTH affects expression of Ang1 and Ang2 in HFA cortical cells. Here, we demonstrate that ACTH up-regulates the Angs with an altered Ang balance in which Ang2 predominates. We also demonstrate an increased Ang2 to Ang1 ratio in the HFA when compared with the adult adrenal. Furthermore, immunostaining revealed that Ang2 is expressed in the periphery of the HFA, whereas the Tie2 receptor is distributed in the endothelial cells. These results indicate that the Angs are likely to be important local regulators of HFA angiogenesis and mediate the tropic action of ACTH, exerting parallel control over the vasculature.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
HFA glands (14–24 wk gestation) were obtained after elective termination of pregnancy by dilatation and evacuation. Gestational age was estimated by foot length. Adrenal glands were collected and placed in ice-cold medium for primary cell culture, in RNA Later (Ambion, Austin, TX) for RNA extraction, or in 4% paraformaldehyde in PBS for histological examinations. The study protocol was approved by the Committee on Human Research, University of California, San Francisco. Human ACTH [ACTH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24); Cortrosyn] was obtained from Organon (West Orange, NJ). 8-Bromoadenosine cAMP (8-Br-cAMP) and forskolin were obtained from Sigma Chemical Co. (St. Louis, MO).
Fetal adrenal cortical cell culture
Primary cultures of midgestation HFA cortical cells, consisting mainly (90–95%) of FZ cells, were prepared as previously described (15). Briefly, the capsule with the adherent DZ was peeled away, and the remaining FZ was dispersed by enzymatic digestion with collagenase and plated on plastic culture dishes (Falcon, Los Angeles, CA) or Lab-Tek chamber slides (Nunc, Naperville, IL) at a density of approximately 25,000 cells/cm2. Culture medium consisted of a 1:1 (vol/vol) mixture of DMEM H-16 and Ham’s F-12 with 10% FCS, 2 mM glutamine, and antibiotics. Cells were incubated at 37 C in a humidified environment consisting of 5% CO2 in air. After 48 h in culture, the medium was changed to one containing 2% FCS, and nonadherent cells were removed. At the initiation of experiments (usually 96 h after plating), the medium was renewed, and test substances were added in the doses shown in the figures.
RNA isolation and real-time quantitative RT-PCR (qRT-PCR)
Total RNA extraction from HFAs was performed with TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Human adult adrenal total RNA was obtained from archival material isolated from operative specimens from our previous studies (16, 17) and a commercial source (BD Biosciences, San Diego, CA). RNA was further purified with a RNeasy Mini kit (QIAGEN, Valencia, CA) followed by use of their deoxyribonuclease. Total RNA from primary culture cells was isolated and purified with a RNeasy Mini kit and deoxyribonuclease treatment. Purity and integrity of the RNA were assessed spectroscopically and by gel electrophoresis before RT. RT reactions with random primers were carried out with Omniscript reverse transcriptase (QIAGEN) under conditions described by the supplier. Expression of Ang1, Ang2, and 17
-hydroxylase/17,20 lyase (P450c17) was analyzed using the 5' nuclease assay (real-time TaqMan RT-PCR) as we have described previously (18, 19). The levels of expression of each gene were normalized using ß-glucuronidase (GUS) levels after the comparative threshold cycle method (18, 20). Sequences for the PCR primers and TaqMan fluorogenic probe for P450c17 were: forward primer, TGGAGACCACCACCTCTGTG; reverse primer, GGAGGAGACGGTTACGGTCA; and TaqMan probe, 5-carboxyfluorescein-CCTGCTGCACAATCCTCAGGTGAAGA-TAMRA (6-carboxytetramethyl-rhodamine) (Integrated DNA Technologies, Coralville, IA).
Indirect immunofluorescence
HFAs were processed for immunofluorescence and subsequent imaging analysis as previously described (19). Ten- and 20-µm frozen sections were prepared and used for immunolocalization of Ang2 and Tie2, respectively. Primary antibody incubation was performed with a 1:40 dilution of goat antihuman Ang2 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), or a combination of a 1:40 dilution of mouse antihuman Tie2 monoclonal antibody (Ab33, Upstate Biotechnology, Lake Placid, NY) and a 1:10 dilution of sheep antihuman CD31 polyclonal antibody (R&D Systems, Minneapolis, MN) for 1 h at room temperature. After washing, incubation with Cy3-conjugated rabbit antigoat antibody (Jackson Laboratories, West Grove, PA) was performed at room temperature for 30 min for Ang2 localization. For double-color immunohistochemical studies, Cy3-conjugated goat antimouse and FITC-conjugated goat antisheep antibody (Jackson Laboratories) were used to detect staining for Tie2 and CD31, respectively. After washing, slides were mounted with VectorShield mounting medium (Vector Laboratories, Burlingame, CA). Control sections were stained with appropriate species-specific IgG or serum. Control sections for Ang2 staining were also immunostained with the antibody that had previously been incubated with an excess of the corresponding immunizing peptide (Santa Cruz Biotechnology). Background staining using these controls under the conditions described above was minimal.
Immunocytochemistry
Ang2 protein was localized by immunocytochemistry in HFA cells cultured on chamber slides, using a modified avidin-biotin-peroxidase method as described previously (8). Slides and sections were incubated overnight with a 1:40 dilution of goat antihuman Ang2 polyclonal antibody at 4 C in a humidified chamber. Control sections were immunostained with antibody that previously had been preabsorbed with an excess of the Ang2 immunizing peptide.
Western blot analysis
Cells were solubilized in PBS-based radioimmunoprecipitation assay buffer (pH 7.4) containing 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate with Complete tablet protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentrations were measured using the BCA assay kit (Pierce, Rockford, IL). Samples were mixed with the sample buffer with reducing reagent (Invitrogen) and incubated for 10 min. An equal amount of protein was loaded and subjected to electrophoresis on a 4–12% gradient gel (NuPAGE BIS-Tris electrophoresis system, Invitrogen) according to the manufacturer’s instructions. Subsequently, proteins were electroblotted onto polyvinylidene difluoride membranes. The membranes were blocked at room temperature with 5% dried milk in PBS with 1% Tween 20 for 1 h. The membranes were then probed with a primary antibody against human Ang2 (goat polyclonal, 1:400; Santa Cruz Biotechnology) for 1 h, followed by a secondary antibody (donkey antigoat IgG horseradish-peroxidase-conjugated antibody, 1:2000; Santa Cruz Biotechnology). Protein expression was detected with an enhanced chemiluminescence detection system (ECL, Amersham Pharmacia Biotech, Piscataway, NJ). We used recombinant human Ang2 (a generous gift from Regeneron Pharmaceuticals, Inc., Tarrytown, NY) as a positive control.
ELISA
HFA cortical cell-conditioned medium samples were concentrated approximately 5-fold using Centricon-10 apparatuses (Millipore, Bedford, MA). Free Ang1 and Ang2 protein levels were quantified using two-site ELISA (18, 21).
Statistical analysis
Data are presented as means ± SE. Data were analyzed by ANOVA, followed by Dunnett’s test for multiple comparisons, or by Student’s t test, where appropriate. Differences were considered significant at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
qRT-PCR revealed that mean Ang2 mRNA levels in fetal adrenals were 5.8-fold higher than those in adults (P < 0.005; Fig. 1A
), whereas fetal Ang1 mRNA levels were not significantly different from adult values. Because Ang1 and Ang2 have been postulated to have opposing effects, the arbitrary ratio of Ang2 to Ang1 mRNA was calculated. The mean Ang2 to Ang1 mRNA ratio was 6.3-fold higher for fetal than for adult adrenals (P < 0.001) (Fig. 1B). The levels of Tie2 mRNAs in fetal and adult adrenals were similar (Fig. 1A). Ang1, Ang2, and Tie2 mRNA levels did not change significantly during midgestation.
|
Ang2 and Tie2 receptor proteins were localized in the midgestation HFA frozen sections by immunofluorescence (Fig. 2). Predominant staining for Ang2 was evident in the periphery of the gland (Fig. 2A). Cells in the DZ and an outer region of the FZ exhibited strong cytoplasmic staining for Ang2 peptide, whereas Ang2 was absent in the more central areas of the FZ. Tie2 was detectable throughout the gland with a network-like staining pattern indicative of its endothelial distribution (Fig. 2C), and costaining for the endothelial cell marker CD31 (19) confirmed the endothelial localization of Tie2 (Fig. 2D). There was no apparent effect of gestational age on the pattern of staining for Ang2 and Tie2 over the age range studied (i.e. 17–24 wk). We failed to detect Ang1 protein using the panel of antibodies available during the study period.
|
Treatment with ACTH increased Ang1 and Ang2 mRNA in isolated HFA cortical cells (Fig. 3, A and B). A significant (P < 0.05) 6- to 7-fold increase in Ang2 mRNA levels was detected 24 h after ACTH (1 nM) treatment and persisted for up to 48 h (Fig. 3A). Ang1 mRNA was significantly increased by about 3-fold at 48 h after the addition of ACTH (Fig. 3A). Thus, the magnitude of up-regulation was greater for Ang2 than Ang1. ACTH elevated Ang2 mRNA levels in a dose-dependent manner, with a maximum effect at 1 nM (Fig. 3B). Changes in Ang1 mRNA abundance in response to various concentrations of ACTH were not statistically significant by ANOVA (Fig. 3B). Forskolin or 8-Br-cAMP mimicked the effects of ACTH on the accumulation of mRNA encoding Ang1 and Ang2 (Fig. 3C). As expected, ACTH, forskolin, or 8-Br-cAMP increased P450c17 mRNA (Fig. 3, A–C) (22).
|
demonstrates, Ang2 protein levels were increased in a dose-dependent manner. The effects of ACTH on Ang2 protein levels were mimicked by 8-Br-cAMP or forskolin (Fig. 4B). Effects of ACTH and 8-Br-cAMP on the abundance of Ang2 protein expression in cultured HFA cortical cells were further confirmed by immunocytochemistry (Fig. 5).
|
|
The effect of ACTH on Ang2 secretion by HFA cortical cells into the culture medium was determined by ELISA. ACTH increased Ang2 secretion in a dose-dependent manner, although we were unable to analyze statistically changes in Ang2 secretion in response to ACTH due to the high variability between experiments (Fig. 6A). The effects of ACTH on Ang2 secretion were mimicked by forskolin or 8-Br-cAMP (Fig. 6B). Ang1 protein levels were undetectable by ELISA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, ACTH exhibited preferential induction of Ang2 over Ang1 in primary cultures of HFA cortical cells. The major role of Ang1-Tie2 signaling appears to be vessel stabilization (3, 5). The role of Ang2, an endogenous antagonist of Tie2, in the angiogenic process is less clear. Mouse embryos overexpressing Ang2 have poorly developed vasculature and defects in blood vessel growth (6). Ang2 expression in adult organs appears to be correlated with periods of blood vessel regression. Although these observations suggest that Ang2 is a potent inhibitor of angiogenesis, an increasing number of studies have shown that the actions of Ang2 are context-dependent. Asahara et al. (23) using a corneal assay, demonstrated that Ang2 alone lacked angiogenic activity; however, when coadministered with VEGF, exogenous Ang2 enhanced the sprouting of capillary vessels by antagonizing the stabilizing effect of Ang1 on vessel formation. Similarly, in a pupillary membrane model (24), as well as in a tumor model (25), Ang2 in the presence of endogenous VEGF promotes angiogenesis. In contrast, if the activity of VEGF is blocked in these models, Ang2 causes vessel regression. Visconti et al. (26) also provided in vivo evidence for the synergistic effects of Ang2 and VEGF on the induction of angiogenesis using transgenic mouse lines ectopically expressing a combination of these angiogenic factors, specifically in cardiac muscle. Furthermore, Ang2 and VEGF were coexpressed at sites where new vessel formation is about to begin (25, 27). Taken together, these studies support a model in which in the presence of VEGF, the action of Ang2 is proangiogenic, whereas in its absence, it is antiangiogenic. Viewed in this light, the up-regulation of Ang2 and VEGF by ACTH in HFA cortical cells suggests that ACTH may promote angiogenesis in the HFA through the intermediacy of these vascular endothelium-specific growth factors.
We present quantitative data on Ang1, Ang2, and Tie2 expression in human fetal and adult adrenal glands using qRT-PCR. Ang2 mRNA levels in the HFA were markedly higher than in adult adrenals, whereas levels of mRNA encoding Ang1 and Tie2 were similar in fetal and adult adrenals. Taking into consideration the proposed roles of the Angs, the dominant Ang2 expression compared with Ang1 likely reflects greater vascular remodeling activity in the fetal than in the adult adrenal. This interpretation is consistent with the generally accepted concept that the vasculature in normal adult organs, with several exceptions such as the female reproductive tract (5), is quiescent compared with vessels in fetal organs (28, 29).
We demonstrate further that HFA cells express and secrete Ang2 protein, as assessed by immunostaining, western blotting, and ELISA. In contrast, expression of the Ang receptor, Tie2, is restricted to the endothelial cells of the gland, consistent with the notion that the endothelium-specific expression of the Tie2 receptor is critical for the biological actions of the Angs (30). Paracrine regulation of vessel formation is a universal phenomenon regulated by the VEGF family proteins (31). Our present study suggests that Ang2, in concert with VEGF, also exerts paracrine control of the fetal adrenal vasculature under the control of the adrenal tropic hormone, ACTH. This suggests an efficient mechanism by which ACTH can induce angiogenesis to support the vascular supply commensurate with organ growth and the hormonal function of the gland.
We also demonstrate that expression of Ang1 and Ang2 by HFA cortical cells is increased by agents that elevate intracellular cAMP, i.e. 8-Br-cAMP and forskolin. The almost identical effects of these agents and ACTH are consistent with the concept that ACTH action is mediated through the activation of adenylate cyclase, with subsequent increase in intracellular cAMP (32). Other actions of ACTH on HFA cortical cells, including the induction of growth factor (e.g. IGF-II) and steroidogenic enzyme (e.g. P450c17) expression, also are mediated through G protein-coupled activation of adenylate cyclase (1, 33), suggesting that the expression of the Angs is part of a complex series of events triggered by ACTH stimulation.
Ramsden et al. (34) showed that Tie2 is expressed in human thyroid follicular cells and that TSH and cAMP increase Tie2 mRNA and protein but not Ang1 mRNA. Ang2 was not expressed in those cells. Although no studies thus far have demonstrated direct regulation of the Angs by cAMP, in more recent studies, several authors have investigated in vivo regulation of the Angs by tropic hormones. Haggstrom-Rudolfsson et al. (35) demonstrated that in vivo administration of human chorionic gonadotropin resulted in up-regulation of Ang2 in microvessels in the adult rat testis, whereas Ang1 was largely unaffected by human chorionic gonadotropin stimulation. Interestingly, Ang1 and Ang2 expression was limited to the endothelium of the adult rat testis in their studies. In dexamethasone-induced adrenal regression in the adult mouse, Feraud et al. (36) reported that Ang1 mRNA was decreased, whereas Ang2 mRNA remained constant, and exogenous administration of ACTH increased Ang1 mRNA back to control levels, suggesting that ACTH preferentially regulates expression of Ang1 mRNA in the murine adult adrenal gland. In contrast, in the present study, Ang2 was preferentially induced by ACTH in HFA cortical cells. These differences may be due either to species differences and/or the difference between the adult and fetal gland.
Finally, the current study shows that Ang2 protein is predominantly localized in the periphery of the HFA (i.e. the DZ and an outer region of the FZ). The mechanism(s) regulating this zonal pattern of Ang2 expression remain to be clarified. One possible mechanism is that cortical cells in the outer portion of the gland may be more sensitive to ACTH than cells in the more central areas of the gland. This may hold true only for an outer component of FZ cells but not for DZ cells. We previously found ACTH receptor mRNA accumulation, as judged by in situ hybridization signal intensities, to be highest in the outer region and decreased in the more central areas of the HFA (37). Similar results were obtained by Aberdeen et al. (38) in the baboon fetal adrenal. Although these results suggested that cells in the outer, DZ are more responsive to ACTH, several lines of evidence, both in vivo and in vitro, have demonstrated that DZ cells are not responsive to ACTH (1, 39). One of the pitfalls of using in situ hybridization for determining spatial mRNA levels is that hybridization signals depend on cell density and size. Because DZ cells are much smaller and more tightly packed than FZ cells, this might affect hybridization signals. Therefore, more recently, we revisited this issue and found that ACTH receptor mRNA levels are much lower in the DZ cells than in the FZ cells, using a more sensitive and quantitatively reliable method, laser capture microdissection coupled with qRT-PCR (Ishimoto, H., D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe, unpublished data). Alternatively, Ang2 expression may be regulated by local factors, demonstrating differential zonal localization. Given the presumed roles of Ang2 and VEGF in angiogenesis, the outer zone-predominant Ang2 localization may reflect the primary site of angiogenesis in the HFA.
In summary, our studies with HFA cortical cells demonstrate that ACTH is capable of preferentially inducing Ang2 in vitro. The Angs are likely important local regulators of angiogenesis in the HFA. The regulation of expression of adrenal growth factors and proangiogenic factors by ACTH may be a key mechanism by which organ growth, differentiated function, and vascular development are coordinated.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Present address for H.I.: Department of Obstetrics and Gynecology, School of Medicine, Keio University, Tokyo 160-8582, Japan.
Present address for D.G.G.: Applied Biosystems, Foster City, California 94401-1105.
This work was presented, in part, at the annual meetings of The Endocrine Society, June, 2003 (Philadelphia, PA), and The Society for Gynecologic Investigation, March, 2003 (Washington, DC).
None of the authors have anything to declare.
First Published Online February 21, 2006
Abbreviations: Ang, Angiopoietin; 8-Br-cAMP, 8-bromoadenosine cAMP; DZ, definitive zone; FZ, fetal zone; GUS, ß-glucuronidase; HFA, human fetal adrenal; P450c17, 17-hydroxylase/17,20 lyase; qRT-PCR, real-time quantitative RT-PCR; VEGF, vascular endothelial growth factor.
Received October 12, 2005.
Accepted February 10, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J. D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, et al. Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis Endocrinology, July 1, 2009; 150(7): 3353 - 3359. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Woolf, L. Gnudi, and D. A. Long Roles of Angiopoietins in Kidney Development and Disease J. Am. Soc. Nephrol., February 1, 2009; 20(2): 239 - 244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ishimoto, M. O. Muench, T. Higuchi, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe Midkine, a Heparin-Binding Growth Factor, Selectively Stimulates Proliferation of Definitive Zone Cells of the Human Fetal Adrenal Gland J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4050 - 4056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ishimoto, D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe Differential Zonal Expression and Adrenocorticotropin Regulation of Secreted Protein Acidic and Rich in Cysteine (SPARC), a Matricellular Protein, in the Midgestation Human Fetal Adrenal Gland: Implications for Adrenal Development J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3208 - 3214. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
), Ang2 (
), and Tie2 (
) mRNA expression relative to GUS. (Values shown on log scale). B, Arbitrary ratio of Ang2 to Ang1 mRNA levels in fetal and adult adrenals. *, P < 0.001.
