help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-2252
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 5 1909-1915
Copyright © 2006 by The Endocrine Society

Adrenocorticotropin Preferentially Up-Regulates Angiopoietin 2 in the Human Fetal Adrenal Gland: Implications for Coordinated Adrenal Organ Growth and Angiogenesis

Hitoshi Ishimoto, David G. Ginzinger and Robert B. Jaffe

Center for Reproductive Sciences, Department of Obstetrics, Gynecology, and Reproductive Sciences (H.I., R.B.J.), and Genomic Analysis Core Facility, Comprehensive Cancer Center (D.G.G.), University of California, San Francisco, San Francisco, California 94143

Address all correspondence and requests for reprints to: Robert B. Jaffe, M.D., Center for Reproductive Sciences, 1450 Health Science West, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Context: ACTH is the key tropic hormone for the human fetal adrenal (HFA). Because vascular development must be coordinated with organ growth, ACTH may regulate local angiogenic factors, thereby influencing HFA angiogenesis. We previously demonstrated that ACTH up-regulates vascular endothelial growth factor in HFA cortical cells. A newer angiogenic factor family, the angiopoietins (Angs), also plays critical roles. Ang1 stabilizes, whereas Ang2 destabilizes vessels, increasing responsiveness to angiogenic stimuli.

Objective: The objective of this study was to investigate expression and ACTH regulation of Angs and their receptor Tie2 in the HFA.

Design, Setting, and Patients: Studies were conducted involving RNA, frozen sections, and primary cell cultures from HFAs (14–24 wk) and human adult adrenal RNA.

Main Outcome Measures: Angs and Tie2 mRNA levels were determined by real-time quantitative RT-PCR, Ang2 and Tie2 were localized by immunostaining, and ACTH regulation of Angs was investigated by real-time quantitative RT-PCR, Western blot, and ELISA.

Results: Mean HFA Ang2 to Ang1 mRNA ratio was 6.3-fold higher than adult adrenals (P < 0.001). Ang2 was localized predominantly in the HFA periphery, whereas Tie2 demonstrated endothelial localization. In isolated HFA cortical cells, ACTH up-regulated Ang mRNA levels in a time- and dose-dependent manner, with the balance favoring Ang2. Ang2 protein levels were elevated in ACTH-stimulated HFA cortical cells and conditioned medium. 8-Bromoadenosine cAMP and forskolin mimicked ACTH effects on the Angs.

Conclusions: Higher HFA Ang2 to Ang1 ratios may reflect greater vascular remodeling than in the adult. Angs, particularly Ang2, in concert with vascular endothelial growth factor, may mediate ACTH tropic action, ensuring coordination of HFA growth, steroidogenesis, and angiogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HUMAN FETAL adrenal (HFA) is an active endocrine organ that plays a pivotal role in maintenance of intrauterine homeostasis, fetal organ maturation, preparation for extrauterine life, and likely the initiation of parturition (1, 2). For most of gestation, the HFA is composed primarily of two zones; the outer, definitive zone (DZ) comprises a narrow band of small, undifferentiated cells whereas the inner, fetal zone (FZ) accounts for the bulk (80–90%) of the organ and produces large quantities of dehydroepiandrosterone sulfate, a substrate for placental estrogen synthesis. The HFA undergoes a phase of rapid growth in midgestation, due primarily to enlargement of the FZ. By 30 wk, the gland achieves a relative size 10- to 20-fold that of the adult adrenal (1).

Angiogenesis, the process of formation of new capillaries from preexisting blood vessels, is essential for embryonic and fetal organ development as well as the support of normal metabolic demands. Among a variety of factors implicated in the regulation of angiogenesis, vascular endothelial growth factor (VEGF) family members and the angiopoietins (Angs) are believed to act almost exclusively on vascular endothelial cells (3). The VEGF family members regulate endothelial cell proliferation, migration, and survival, essential components of angiogenesis (4). Among the Ang family, Ang1 and Ang2 have been the most extensively studied to date (3, 5). Both Ang1 and Ang2 act as ligands of the endothelial cell-specific tyrosine kinase receptor, Tie2. Through binding to Tie2, Ang1 supports endothelial cell survival, promotes vascular integrity, and stabilizes the established vasculature. In contrast, Ang2 promotes vessel destabilization by antagonizing the effects of Ang1 (6). Indeed, Ang2 expression is restricted to sites of vascular remodeling. It has been proposed that Ang2 renders endothelial cells responsive to angiogenic stimuli, such as VEGF. However, in the absence of such stimuli, the expression of Ang2 produces vascular regression (3, 7).

Although the adrenal gland is one of the most highly vascularized organs in the human fetus, little is known about the factors and mechanisms responsible for regulating its vascular development. The development of an extensive vasculature in the organ is essential for delivery of tropic hormones and steroid hormone precursors to the gland and secretion of hormone products into the peripheral circulation. Furthermore, the establishment of an adequate vascular supply is an absolute requirement for normal organ growth. It is evident, therefore, that regulation of the vasculature must be coordinated with tropic regulation of the HFA so that blood vessel formation and adrenal growth are synchronized. The central drive for growth and function of the HFA is provided by ACTH (1, 8, 9). The growth-stimulatory actions of ACTH are mediated, at least in part, by locally produced growth factors, acting in an autocrine and/or paracrine fashion (9, 10, 11). Therefore, we hypothesized that ACTH modulates adrenal angiogenesis by stimulating the local expression of vascular endothelial cell-specific angiogenic factors. We previously demonstrated that ACTH up-regulates VEGF in HFA cortical cells (8). Similar results subsequently were reported in studies using human and bovine adult adrenal cortical cells (12, 13, 14). However, to date, expression and regulation of the Ang/Tie2 system have not been documented in the primate adrenal gland.

Therefore, we examined whether ACTH affects expression of Ang1 and Ang2 in HFA cortical cells. Here, we demonstrate that ACTH up-regulates the Angs with an altered Ang balance in which Ang2 predominates. We also demonstrate an increased Ang2 to Ang1 ratio in the HFA when compared with the adult adrenal. Furthermore, immunostaining revealed that Ang2 is expressed in the periphery of the HFA, whereas the Tie2 receptor is distributed in the endothelial cells. These results indicate that the Angs are likely to be important local regulators of HFA angiogenesis and mediate the tropic action of ACTH, exerting parallel control over the vasculature.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue preparation and reagents

HFA glands (14–24 wk gestation) were obtained after elective termination of pregnancy by dilatation and evacuation. Gestational age was estimated by foot length. Adrenal glands were collected and placed in ice-cold medium for primary cell culture, in RNA Later (Ambion, Austin, TX) for RNA extraction, or in 4% paraformaldehyde in PBS for histological examinations. The study protocol was approved by the Committee on Human Research, University of California, San Francisco. Human ACTH [ACTH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24); Cortrosyn] was obtained from Organon (West Orange, NJ). 8-Bromoadenosine cAMP (8-Br-cAMP) and forskolin were obtained from Sigma Chemical Co. (St. Louis, MO).

Fetal adrenal cortical cell culture

Primary cultures of midgestation HFA cortical cells, consisting mainly (90–95%) of FZ cells, were prepared as previously described (15). Briefly, the capsule with the adherent DZ was peeled away, and the remaining FZ was dispersed by enzymatic digestion with collagenase and plated on plastic culture dishes (Falcon, Los Angeles, CA) or Lab-Tek chamber slides (Nunc, Naperville, IL) at a density of approximately 25,000 cells/cm2. Culture medium consisted of a 1:1 (vol/vol) mixture of DMEM H-16 and Ham’s F-12 with 10% FCS, 2 mM glutamine, and antibiotics. Cells were incubated at 37 C in a humidified environment consisting of 5% CO2 in air. After 48 h in culture, the medium was changed to one containing 2% FCS, and nonadherent cells were removed. At the initiation of experiments (usually 96 h after plating), the medium was renewed, and test substances were added in the doses shown in the figures.

RNA isolation and real-time quantitative RT-PCR (qRT-PCR)

Total RNA extraction from HFAs was performed with TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Human adult adrenal total RNA was obtained from archival material isolated from operative specimens from our previous studies (16, 17) and a commercial source (BD Biosciences, San Diego, CA). RNA was further purified with a RNeasy Mini kit (QIAGEN, Valencia, CA) followed by use of their deoxyribonuclease. Total RNA from primary culture cells was isolated and purified with a RNeasy Mini kit and deoxyribonuclease treatment. Purity and integrity of the RNA were assessed spectroscopically and by gel electrophoresis before RT. RT reactions with random primers were carried out with Omniscript reverse transcriptase (QIAGEN) under conditions described by the supplier. Expression of Ang1, Ang2, and 17{alpha}-hydroxylase/17,20 lyase (P450c17) was analyzed using the 5' nuclease assay (real-time TaqMan RT-PCR) as we have described previously (18, 19). The levels of expression of each gene were normalized using ß-glucuronidase (GUS) levels after the comparative threshold cycle method (18, 20). Sequences for the PCR primers and TaqMan fluorogenic probe for P450c17 were: forward primer, TGGAGACCACCACCTCTGTG; reverse primer, GGAGGAGACGGTTACGGTCA; and TaqMan probe, 5-carboxyfluorescein-CCTGCTGCACAATCCTCAGGTGAAGA-TAMRA (6-carboxytetramethyl-rhodamine) (Integrated DNA Technologies, Coralville, IA).

Indirect immunofluorescence

HFAs were processed for immunofluorescence and subsequent imaging analysis as previously described (19). Ten- and 20-µm frozen sections were prepared and used for immunolocalization of Ang2 and Tie2, respectively. Primary antibody incubation was performed with a 1:40 dilution of goat antihuman Ang2 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), or a combination of a 1:40 dilution of mouse antihuman Tie2 monoclonal antibody (Ab33, Upstate Biotechnology, Lake Placid, NY) and a 1:10 dilution of sheep antihuman CD31 polyclonal antibody (R&D Systems, Minneapolis, MN) for 1 h at room temperature. After washing, incubation with Cy3-conjugated rabbit antigoat antibody (Jackson Laboratories, West Grove, PA) was performed at room temperature for 30 min for Ang2 localization. For double-color immunohistochemical studies, Cy3-conjugated goat antimouse and FITC-conjugated goat antisheep antibody (Jackson Laboratories) were used to detect staining for Tie2 and CD31, respectively. After washing, slides were mounted with VectorShield mounting medium (Vector Laboratories, Burlingame, CA). Control sections were stained with appropriate species-specific IgG or serum. Control sections for Ang2 staining were also immunostained with the antibody that had previously been incubated with an excess of the corresponding immunizing peptide (Santa Cruz Biotechnology). Background staining using these controls under the conditions described above was minimal.

Immunocytochemistry

Ang2 protein was localized by immunocytochemistry in HFA cells cultured on chamber slides, using a modified avidin-biotin-peroxidase method as described previously (8). Slides and sections were incubated overnight with a 1:40 dilution of goat antihuman Ang2 polyclonal antibody at 4 C in a humidified chamber. Control sections were immunostained with antibody that previously had been preabsorbed with an excess of the Ang2 immunizing peptide.

Western blot analysis

Cells were solubilized in PBS-based radioimmunoprecipitation assay buffer (pH 7.4) containing 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate with Complete tablet protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentrations were measured using the BCA assay kit (Pierce, Rockford, IL). Samples were mixed with the sample buffer with reducing reagent (Invitrogen) and incubated for 10 min. An equal amount of protein was loaded and subjected to electrophoresis on a 4–12% gradient gel (NuPAGE BIS-Tris electrophoresis system, Invitrogen) according to the manufacturer’s instructions. Subsequently, proteins were electroblotted onto polyvinylidene difluoride membranes. The membranes were blocked at room temperature with 5% dried milk in PBS with 1% Tween 20 for 1 h. The membranes were then probed with a primary antibody against human Ang2 (goat polyclonal, 1:400; Santa Cruz Biotechnology) for 1 h, followed by a secondary antibody (donkey antigoat IgG horseradish-peroxidase-conjugated antibody, 1:2000; Santa Cruz Biotechnology). Protein expression was detected with an enhanced chemiluminescence detection system (ECL, Amersham Pharmacia Biotech, Piscataway, NJ). We used recombinant human Ang2 (a generous gift from Regeneron Pharmaceuticals, Inc., Tarrytown, NY) as a positive control.

ELISA

HFA cortical cell-conditioned medium samples were concentrated approximately 5-fold using Centricon-10 apparatuses (Millipore, Bedford, MA). Free Ang1 and Ang2 protein levels were quantified using two-site ELISA (18, 21).

Statistical analysis

Data are presented as means ± SE. Data were analyzed by ANOVA, followed by Dunnett’s test for multiple comparisons, or by Student’s t test, where appropriate. Differences were considered significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ang1, Ang2, and Tie2 mRNA expression in human fetal and adult adrenals

qRT-PCR revealed that mean Ang2 mRNA levels in fetal adrenals were 5.8-fold higher than those in adults (P < 0.005; Fig. 1AGo), whereas fetal Ang1 mRNA levels were not significantly different from adult values. Because Ang1 and Ang2 have been postulated to have opposing effects, the arbitrary ratio of Ang2 to Ang1 mRNA was calculated. The mean Ang2 to Ang1 mRNA ratio was 6.3-fold higher for fetal than for adult adrenals (P < 0.001) (Fig. 1BGo). The levels of Tie2 mRNAs in fetal and adult adrenals were similar (Fig. 1AGo). Ang1, Ang2, and Tie2 mRNA levels did not change significantly during midgestation.


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. Quantification of Ang1, Ang2, and Tie2 mRNA expression in human fetal and adult adrenal glands. A, qRT-PCR was performed on RNA isolated from HFA glands (14–24 wk, n = 11) and adult adrenals (n = 7). Ang1 ({blacktriangleup}), Ang2 ({circ}), and Tie2 ({blacksquare}) mRNA expression relative to GUS. (Values shown on log scale). B, Arbitrary ratio of Ang2 to Ang1 mRNA levels in fetal and adult adrenals. *, P < 0.001.

 
Ang2 and Tie2 protein localization

Ang2 and Tie2 receptor proteins were localized in the midgestation HFA frozen sections by immunofluorescence (Fig. 2Go). Predominant staining for Ang2 was evident in the periphery of the gland (Fig. 2AGo). Cells in the DZ and an outer region of the FZ exhibited strong cytoplasmic staining for Ang2 peptide, whereas Ang2 was absent in the more central areas of the FZ. Tie2 was detectable throughout the gland with a network-like staining pattern indicative of its endothelial distribution (Fig. 2CGo), and costaining for the endothelial cell marker CD31 (19) confirmed the endothelial localization of Tie2 (Fig. 2DGo). There was no apparent effect of gestational age on the pattern of staining for Ang2 and Tie2 over the age range studied (i.e. 17–24 wk). We failed to detect Ang1 protein using the panel of antibodies available during the study period.


Figure 2
View larger version (145K):
[in this window]
[in a new window]
 
FIG. 2. Immunofluorescent staining of Ang2 and Tie2 in the HFA gland. A and B, Ang2 protein (A) localized principally in the DZ and an outer region of the FZ in a 22-wk HFA gland. Control (B) in which the primary anti-Ang2 antibody had been preabsorbed with an excess of the immunizing peptide (1:25). C and D, Labeling for Tie2 (C) and the endothelial marker CD31 (D) in an 18-wk HFA gland, illustrating the endothelial localization of Tie2. Original magnification, x100 (A and B) and x200 (C and D).

 
Regulation of Ang1 and Ang2 by ACTH

Treatment with ACTH increased Ang1 and Ang2 mRNA in isolated HFA cortical cells (Fig. 3Go, A and B). A significant (P < 0.05) 6- to 7-fold increase in Ang2 mRNA levels was detected 24 h after ACTH (1 nM) treatment and persisted for up to 48 h (Fig. 3AGo). Ang1 mRNA was significantly increased by about 3-fold at 48 h after the addition of ACTH (Fig. 3AGo). Thus, the magnitude of up-regulation was greater for Ang2 than Ang1. ACTH elevated Ang2 mRNA levels in a dose-dependent manner, with a maximum effect at 1 nM (Fig. 3BGo). Changes in Ang1 mRNA abundance in response to various concentrations of ACTH were not statistically significant by ANOVA (Fig. 3BGo). Forskolin or 8-Br-cAMP mimicked the effects of ACTH on the accumulation of mRNA encoding Ang1 and Ang2 (Fig. 3CGo). As expected, ACTH, forskolin, or 8-Br-cAMP increased P450c17 mRNA (Fig. 3Go, A–C) (22).


Figure 3
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. A, Time-dependent effect of ACTH on Ang1 (1 ), Ang2 (2 ), and P450c17 (3 ) mRNA levels. HFA cortical cells were treated with ACTH (1 nM) at indicated times. GUS-normalized data are expressed as fold increase relative to time-matched, unstimulated controls. Black and white bars, ACTH-treated and time-matched, unstimulated control cells, respectively. Values are the mean ± SE (n = 4–6). *, P < 0.05; **, P < 0.01 vs. time-matched control. B, Dose-dependent effect of ACTH on Ang1, Ang2, and P450c17 mRNA levels. HFA cortical cells were treated with various concentrations of ACTH for 48 h. Each point represents the mean ± SE (n = 4). *, P < 0.01 vs. control (without ACTH treatment). C, Effects of forskolin and 8-Br-cAMP on Ang1, Ang2, and P450c17 mRNA levels. HFA cortical cells were exposed to forskolin (1 µM) or 8-Br-cAMP (0.1 mM) for 48 h. GUS-normalized data are expressed as fold increase relative to unstimulated controls. *, P < 0.01 vs. time-matched control.

 
ACTH also up-regulated Ang2 at the protein level. After treatment without or with various concentrations of ACTH for 48 h, cell were lysed and analyzed for Ang2 production by immunoblotting. As Fig. 4AGo demonstrates, Ang2 protein levels were increased in a dose-dependent manner. The effects of ACTH on Ang2 protein levels were mimicked by 8-Br-cAMP or forskolin (Fig. 4BGo). Effects of ACTH and 8-Br-cAMP on the abundance of Ang2 protein expression in cultured HFA cortical cells were further confirmed by immunocytochemistry (Fig. 5Go).


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4. Western blot analysis of Ang2 protein in cultured HFA cortical cells. Protein (15 µg) was loaded in each lane. A, Ang2 protein levels were increased after exposure to ACTH for 48 h in a dose-dependent manner. B, Exposure to 8-Br-cAMP (Br; 1 mM) or forskolin (F; 1 µM) for 48 h increased abundance of Ang2 protein. Ac, ACTH (1 nM); Co, control without the test substances. Recombinant human Ang2 protein (20 ng) was used as a positive control (PC).

 

Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. Effect of ACTH (1 nM) and 8-Br-cAMP (1 mM) on Ang2 protein expression in cultured HFA cortical cells, as assessed by immunocytochemistry. Specific staining for Ang2 protein is indicated by dark staining. Under basal conditions, cells stained very weakly for Ang2 (A). After exposure to ACTH (B) or 8-Br-cAMP (C) for 36 h, the intensity of Ang2 staining increased markedly in HFA cortical cells. The cortical cells retracted in response to ACTH or 8-Br-cAMP (B–D, as indicated by arrows), whereas cells under basal conditions did not exhibit the retracted shape (A), confirming the biological activity of these agonists on adrenal cortical cells. Staining was reduced to near-background levels in ACTH-stimulated cells incubated with Ang2 antibody preabsorbed with an excess of the immunizing Ang2 peptide (D). Original magnification, x200.

 
Regulation of Ang2 secretion

The effect of ACTH on Ang2 secretion by HFA cortical cells into the culture medium was determined by ELISA. ACTH increased Ang2 secretion in a dose-dependent manner, although we were unable to analyze statistically changes in Ang2 secretion in response to ACTH due to the high variability between experiments (Fig. 6AGo). The effects of ACTH on Ang2 secretion were mimicked by forskolin or 8-Br-cAMP (Fig. 6BGo). Ang1 protein levels were undetectable by ELISA.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. A, Effects of ACTH on Ang2 protein secreted from cultured HFA cortical cells. Cells were exposed to various concentrations of ACTH for 48 h. Note that the values are shown on log scale. B, Effects of ACTH (1 nM), forskolin (1 µM), and 8-Br-cAMP (1 mM) on Ang2 protein secreted from cultured HFA cortical cells. Cells were exposed to the agonists for 48 h. (Values shown on log scale.)

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here, we describe the expression and regulation of the essential angiogenic factors, Ang1 and Ang2, and their Tie2 receptor in the HFA for the first time. These observations extend our understanding of the coordinated molecular regulation of adrenal growth, steroidogenic function, and angiogenesis by ACTH. We previously demonstrated that the potent angiogenic growth factor, VEGF, is abundantly expressed in the HFA and that VEGF can be up-regulated by ACTH (8, 16), the primary regulator of adrenal growth and function. Our current results identify ACTH as also stimulating expression of the Angs in HFA cortical cells, implying that the Angs, in concert with VEGF, may mediate the tropic action of ACTH and regulate angiogenesis in the HFA.

In this study, ACTH exhibited preferential induction of Ang2 over Ang1 in primary cultures of HFA cortical cells. The major role of Ang1-Tie2 signaling appears to be vessel stabilization (3, 5). The role of Ang2, an endogenous antagonist of Tie2, in the angiogenic process is less clear. Mouse embryos overexpressing Ang2 have poorly developed vasculature and defects in blood vessel growth (6). Ang2 expression in adult organs appears to be correlated with periods of blood vessel regression. Although these observations suggest that Ang2 is a potent inhibitor of angiogenesis, an increasing number of studies have shown that the actions of Ang2 are context-dependent. Asahara et al. (23) using a corneal assay, demonstrated that Ang2 alone lacked angiogenic activity; however, when coadministered with VEGF, exogenous Ang2 enhanced the sprouting of capillary vessels by antagonizing the stabilizing effect of Ang1 on vessel formation. Similarly, in a pupillary membrane model (24), as well as in a tumor model (25), Ang2 in the presence of endogenous VEGF promotes angiogenesis. In contrast, if the activity of VEGF is blocked in these models, Ang2 causes vessel regression. Visconti et al. (26) also provided in vivo evidence for the synergistic effects of Ang2 and VEGF on the induction of angiogenesis using transgenic mouse lines ectopically expressing a combination of these angiogenic factors, specifically in cardiac muscle. Furthermore, Ang2 and VEGF were coexpressed at sites where new vessel formation is about to begin (25, 27). Taken together, these studies support a model in which in the presence of VEGF, the action of Ang2 is proangiogenic, whereas in its absence, it is antiangiogenic. Viewed in this light, the up-regulation of Ang2 and VEGF by ACTH in HFA cortical cells suggests that ACTH may promote angiogenesis in the HFA through the intermediacy of these vascular endothelium-specific growth factors.

We present quantitative data on Ang1, Ang2, and Tie2 expression in human fetal and adult adrenal glands using qRT-PCR. Ang2 mRNA levels in the HFA were markedly higher than in adult adrenals, whereas levels of mRNA encoding Ang1 and Tie2 were similar in fetal and adult adrenals. Taking into consideration the proposed roles of the Angs, the dominant Ang2 expression compared with Ang1 likely reflects greater vascular remodeling activity in the fetal than in the adult adrenal. This interpretation is consistent with the generally accepted concept that the vasculature in normal adult organs, with several exceptions such as the female reproductive tract (5), is quiescent compared with vessels in fetal organs (28, 29).

We demonstrate further that HFA cells express and secrete Ang2 protein, as assessed by immunostaining, western blotting, and ELISA. In contrast, expression of the Ang receptor, Tie2, is restricted to the endothelial cells of the gland, consistent with the notion that the endothelium-specific expression of the Tie2 receptor is critical for the biological actions of the Angs (30). Paracrine regulation of vessel formation is a universal phenomenon regulated by the VEGF family proteins (31). Our present study suggests that Ang2, in concert with VEGF, also exerts paracrine control of the fetal adrenal vasculature under the control of the adrenal tropic hormone, ACTH. This suggests an efficient mechanism by which ACTH can induce angiogenesis to support the vascular supply commensurate with organ growth and the hormonal function of the gland.

We also demonstrate that expression of Ang1 and Ang2 by HFA cortical cells is increased by agents that elevate intracellular cAMP, i.e. 8-Br-cAMP and forskolin. The almost identical effects of these agents and ACTH are consistent with the concept that ACTH action is mediated through the activation of adenylate cyclase, with subsequent increase in intracellular cAMP (32). Other actions of ACTH on HFA cortical cells, including the induction of growth factor (e.g. IGF-II) and steroidogenic enzyme (e.g. P450c17) expression, also are mediated through G protein-coupled activation of adenylate cyclase (1, 33), suggesting that the expression of the Angs is part of a complex series of events triggered by ACTH stimulation.

Ramsden et al. (34) showed that Tie2 is expressed in human thyroid follicular cells and that TSH and cAMP increase Tie2 mRNA and protein but not Ang1 mRNA. Ang2 was not expressed in those cells. Although no studies thus far have demonstrated direct regulation of the Angs by cAMP, in more recent studies, several authors have investigated in vivo regulation of the Angs by tropic hormones. Haggstrom-Rudolfsson et al. (35) demonstrated that in vivo administration of human chorionic gonadotropin resulted in up-regulation of Ang2 in microvessels in the adult rat testis, whereas Ang1 was largely unaffected by human chorionic gonadotropin stimulation. Interestingly, Ang1 and Ang2 expression was limited to the endothelium of the adult rat testis in their studies. In dexamethasone-induced adrenal regression in the adult mouse, Feraud et al. (36) reported that Ang1 mRNA was decreased, whereas Ang2 mRNA remained constant, and exogenous administration of ACTH increased Ang1 mRNA back to control levels, suggesting that ACTH preferentially regulates expression of Ang1 mRNA in the murine adult adrenal gland. In contrast, in the present study, Ang2 was preferentially induced by ACTH in HFA cortical cells. These differences may be due either to species differences and/or the difference between the adult and fetal gland.

Finally, the current study shows that Ang2 protein is predominantly localized in the periphery of the HFA (i.e. the DZ and an outer region of the FZ). The mechanism(s) regulating this zonal pattern of Ang2 expression remain to be clarified. One possible mechanism is that cortical cells in the outer portion of the gland may be more sensitive to ACTH than cells in the more central areas of the gland. This may hold true only for an outer component of FZ cells but not for DZ cells. We previously found ACTH receptor mRNA accumulation, as judged by in situ hybridization signal intensities, to be highest in the outer region and decreased in the more central areas of the HFA (37). Similar results were obtained by Aberdeen et al. (38) in the baboon fetal adrenal. Although these results suggested that cells in the outer, DZ are more responsive to ACTH, several lines of evidence, both in vivo and in vitro, have demonstrated that DZ cells are not responsive to ACTH (1, 39). One of the pitfalls of using in situ hybridization for determining spatial mRNA levels is that hybridization signals depend on cell density and size. Because DZ cells are much smaller and more tightly packed than FZ cells, this might affect hybridization signals. Therefore, more recently, we revisited this issue and found that ACTH receptor mRNA levels are much lower in the DZ cells than in the FZ cells, using a more sensitive and quantitatively reliable method, laser capture microdissection coupled with qRT-PCR (Ishimoto, H., D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe, unpublished data). Alternatively, Ang2 expression may be regulated by local factors, demonstrating differential zonal localization. Given the presumed roles of Ang2 and VEGF in angiogenesis, the outer zone-predominant Ang2 localization may reflect the primary site of angiogenesis in the HFA.

In summary, our studies with HFA cortical cells demonstrate that ACTH is capable of preferentially inducing Ang2 in vitro. The Angs are likely important local regulators of angiogenesis in the HFA. The regulation of expression of adrenal growth factors and proangiogenic factors by ACTH may be a key mechanism by which organ growth, differentiated function, and vascular development are coordinated.


    Acknowledgments
 
We thank John S. Rudge and Donna Hylton (Regeneron Pharmaceuticals, Inc., Tarrytown, NY) for gifts of reagents and for performing the ELISAs, Mikiye Nakanishi for technical assistance, and Michiyo Ishimoto for assistance with manuscript preparation.


    Footnotes
 
This work was supported by National Institutes of Health Grant HD08478.

Present address for H.I.: Department of Obstetrics and Gynecology, School of Medicine, Keio University, Tokyo 160-8582, Japan.

Present address for D.G.G.: Applied Biosystems, Foster City, California 94401-1105.

This work was presented, in part, at the annual meetings of The Endocrine Society, June, 2003 (Philadelphia, PA), and The Society for Gynecologic Investigation, March, 2003 (Washington, DC).

None of the authors have anything to declare.

First Published Online February 21, 2006

Abbreviations: Ang, Angiopoietin; 8-Br-cAMP, 8-bromoadenosine cAMP; DZ, definitive zone; FZ, fetal zone; GUS, ß-glucuronidase; HFA, human fetal adrenal; P450c17, 17{alpha}-hydroxylase/17,20 lyase; qRT-PCR, real-time quantitative RT-PCR; VEGF, vascular endothelial growth factor.

Received October 12, 2005.

Accepted February 10, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mesiano S, Jaffe RB 1997 Developmental and functional biology of the primate fetal adrenal cortex. Endocr Rev 18:378–403[Abstract/Free Full Text]
  2. Jaffe RB 2001 Role of the human fetal adrenal gland in the initiation of parturition. In: Smith R, ed. The endocrinology of parturition: basic science and clinical application. Basel, Switzerland: Karger; 75–85
  3. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J 2000 Vascular-specific growth factors and blood vessel formation. Nature 407:242–248[CrossRef][Medline]
  4. Ferrara N, Gerber HP 2001 The role of vascular endothelial growth factor in angiogenesis. Acta Haematol 106:148–156[CrossRef][Medline]
  5. Geva E, Jaffe RB 2000 Role of angiopoietins in reproductive tract angiogenesis. Obstet Gynecol Surv 55:511–519[CrossRef][Medline]
  6. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wieganad SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD 1997 Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277:55–60[Abstract/Free Full Text]
  7. Ramsauer M, D’Amore PA 2002 Getting Tie(2)d up in angiogenesis. J Clin Invest 110:1615–1617[CrossRef][Medline]
  8. Shifren JL, Mesiano S, Taylor RN, Ferrara N, Jaffe RB 1998 Corticotropin regulates vascular endothelial growth factor expression in human fetal adrenal cortical cells. J Clin Endocrinol Metab 83:1342–1347[Abstract/Free Full Text]
  9. Mesiano S, Mellon SH, Gospodarowicz D, Di Blasio AM, Jaffe RB 1991 Basic fibroblast growth factor expression is regulated by corticotropin in the human fetal adrenal: a model for adrenal growth regulation. Proc Natl Acad Sci USA 88:5428–5432[Abstract/Free Full Text]
  10. Mesiano S, Mellon SH, Jaffe RB 1993 Mitogenic action, regulation, and localization of insulin-like growth factors in the human fetal adrenal gland. J Clin Endocrinol Metab 76:968–976[Abstract]
  11. Coulter CL, Goldsmith PC, Mesiano S, Voytek CC, Martin MC, Han VK, Jaffe RB 1996 Functional maturation of the primate fetal adrenal in vivo: I. Role of insulin-like growth factors (IGFs), IGF-I receptor, and IGF binding proteins in growth regulation. Endocrinology 137:4487–4498[Abstract]
  12. Heikkila P, Arola J, Voutilainen R, Salmenkivi K, Kahri AI, Liu J 2000 Expression of vascular endothelial growth factor in human adrenals. Endocr Res 26:867–871[Medline]
  13. Gaillard I, Keramidas M, Liakos P, Vilgrain I, Feige JJ, Vittet D 2000 ACTH-regulated expression of vascular endothelial growth factor in the adult bovine adrenal cortex: a possible role in the maintenance of the microvasculature. J Cell Physiol 185:226–234[CrossRef][Medline]
  14. Vittet D, Ciais D, Keramidas M, De Fraipont F, Feige JJ 2000 Paracrine control of the adult adrenal cortex vasculature by vascular endothelial growth factor. Endocr Res 26:843–852[Medline]
  15. Mesiano S, Jaffe RB 1993 Interaction of insulin-like growth factor-II and estradiol directs steroidogenesis in the human fetal adrenal toward dehydroepiandrosterone sulfate production. J Clin Endocrinol Metab 77:754–758[Abstract]
  16. Shifren JL, Doldi N, Ferrara N, Mesiano S, Jaffe RB 1994 In the human fetus, vascular endothelial growth factor is expressed in epithelial cells and myocytes, but not vascular endothelium: implications for mode of action. J Clin Endocrinol Metab 79:316–322[Abstract]
  17. Spencer SJ, Mesiano S, Lee JY, Jaffe RB 1999 Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. J Clin Endocrinol Metab 84:1110–1115[Abstract/Free Full Text]
  18. Geva E, Ginzinger DG, Zaloudek CJ, Moore DH, Byrne A, Jaffe RB 2002 Human placental vascular development: vasculogenic and angiogenic (branching and nonbranching) transformation is regulated by vascular endothelial growth factor-A, angiopoietin-1, and angiopoietin-2. J Clin Endocrinol Metab 87:4213–4224[Abstract/Free Full Text]
  19. Muench MO, Ratcliffe JV, Nakanishi M, Ishimoto H, Jaffe RB 2003 Isolation of definitive zone and chromaffin cells based upon expression of CD56 (neural cell adhesion molecule) in the human fetal adrenal gland. J Clin Endocrinol Metab 88:3921–3930[Abstract/Free Full Text]
  20. Ginzinger DG, Godfrey TE, Nigro J, Moore II DH, Suzuki S, Pallavicini MG, Gray JW, Jensen RH 2000 Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis. Cancer Res 60:5405–5409[Abstract/Free Full Text]
  21. Thurston G, Rudge JS, Ioffe E, Zhou H, Ross L, Croll SD, Glazer N, Holash J, McDonald DM, Yancopoulos GD 2000 Angiopoietin-1 protects the adult vasculature against plasma leakage. Nat Med 6:460–463[CrossRef][Medline]
  22. Mesiano S, Katz SL, Lee JY, Jaffe RB 1997 Insulin-like growth factors augment steroid production and expression of steroidogenic enzymes in human fetal adrenal cortical cells: implications for adrenal androgen regulation. J Clin Endocrinol Metab 82:1390–1396[Abstract/Free Full Text]
  23. Asahara T, Chen D, Takahashi T, Fujikawa K, Kearney M, Magner M, Yancopoulos GD, Isner JM 1998 Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ Res 83:233–240[Abstract/Free Full Text]
  24. Lobov IB, Brooks PC, Lang RA 2002 Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA 99:11205–11210[Abstract/Free Full Text]
  25. Holash J, Maisonpierre PC, Compton D, Boland P, Alexander CR, Zagzag D, Yancopoulos GD, Wiegand SJ 1999 Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science 284:1994–1998[Abstract/Free Full Text]
  26. Visconti RP, Richardson CD, Sato TN 2002 Orchestration of angiogenesis and arteriovenous contribution by angiopoietins and vascular endothelial growth factor (VEGF). Proc Natl Acad Sci USA 99:8219–8224[Abstract/Free Full Text]
  27. Stratmann A, Risau W, Plate KH 1998 Cell type-specific expression of angiopoietin-1 and angiopoietin-2 suggests a role in glioblastoma angiogenesis. Am J Pathol 153:1459–1466[Abstract/Free Full Text]
  28. Risau W 1995 Differentiation of endothelium. FASEB J 9:926–933[Abstract]
  29. Wong AL, Haroon ZA, Werner S, Dewhirst MW, Greenberg CS, Peters KG 1997 Tie2 expression and phosphorylation in angiogenic and quiescent adult tissues. Circ Res 81:567–574[Abstract/Free Full Text]
  30. Thurston G 2003 Role of angiopoietins and Tie receptor tyrosine kinases in angiogenesis and lymphangiogenesis. Cell Tissue Res 314:61–68[CrossRef][Medline]
  31. Cleaver O, Melton DA 2003 Endothelial signaling during development. Nat Med 9:661–668[CrossRef][Medline]
  32. Gallo-Payet N, Payet MD 2003 Mechanism of action of ACTH: beyond cAMP. Microsc Res Tech 61:275–287[CrossRef][Medline]
  33. Voutilainen R, Miller WL 1987 Coordinate tropic hormone regulation of mRNAs for insulin-like growth factor II and the cholesterol side-chain-cleavage enzyme, P450scc [corrected], in human steroidogenic tissues. Proc Natl Acad Sci USA 84:1590–1594[Abstract/Free Full Text]
  34. Ramsden JD, Cocks HC, Shams M, Nijjar S, Watkinson JC, Sheppard MC, Ahmed A, Eggo MC 2001 Tie-2 is expressed on thyroid follicular cells, is increased in goiter, and is regulated by thyrotropin through cyclic adenosine 3',5'-monophosphate. J Clin Endocrinol Metab 86:2709–2716[Abstract/Free Full Text]
  35. Haggstrom-Rudolfsson S, Johansson A, Franck Lissbrant I, Wikstrom P, Bergh A 2003 Localized expression of angiopoietin 1 and 2 may explain unique characteristics of the rat testicular microvasculature. Biol Reprod 69:1231–1237[Abstract/Free Full Text]
  36. Feraud O, Mallet C, Vilgrain I 2003 Expressional regulation of the angiopoietin-1 and -2 and the endothelial-specific receptor tyrosine kinase Tie2 in adrenal atrophy: a study of adrenocorticotropin-induced repair. Endocrinology 144:4607–4615[Abstract/Free Full Text]
  37. Mesiano S, Fujimoto VY, Nelson LR, Lee JY, Voytek CC, Jaffe RB 1996 Localization and regulation of corticotropin receptor expression in the midgestation human fetal adrenal cortex: implications for in utero homeostasis. J Clin Endocrinol Metab 81:340–345[Abstract]
  38. Aberdeen GW, Babischkin JS, Davies WA, Pepe GJ, Albrecht ED 1997 Decline in adrenocorticotropin receptor messenger ribonucleic acid expression in the baboon fetal adrenocortical zone in the second half of pregnancy. Endocrinology 138:1634–1641[Abstract/Free Full Text]
  39. Leavitt MG, Albrecht ED, Pepe GJ 1999 Development of the baboon fetal adrenal gland: regulation of the ontogenesis of the definitive and transitional zones by adrenocorticotropin. J Clin Endocrinol Metab 84:3831–3835[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J. D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, et al.
Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis
Endocrinology, July 1, 2009; 150(7): 3353 - 3359.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. S. Woolf, L. Gnudi, and D. A. Long
Roles of Angiopoietins in Kidney Development and Disease
J. Am. Soc. Nephrol., February 1, 2009; 20(2): 239 - 244.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors
J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, M. O. Muench, T. Higuchi, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
Midkine, a Heparin-Binding Growth Factor, Selectively Stimulates Proliferation of Definitive Zone Cells of the Human Fetal Adrenal Gland
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4050 - 4056.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishimoto, D. G. Ginzinger, T. Matsumoto, Y. Hattori, M. Furuya, K. Minegishi, M. Tanaka, Y. Yoshimura, and R. B. Jaffe
Differential Zonal Expression and Adrenocorticotropin Regulation of Secreted Protein Acidic and Rich in Cysteine (SPARC), a Matricellular Protein, in the Midgestation Human Fetal Adrenal Gland: Implications for Adrenal Development
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3208 - 3214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishimoto, H.
Right arrow Articles by Jaffe, R. B.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals