| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Diabetes Center and Department of Medicine (C.L.-B., B.D., F.P., A.S., S.Z., C.V.), University of California San Francisco, San Francisco, California 94143; Institut National de la Santé et de la Recherche Médicale (INSERM) "Avenir" and Equipe dAccueil 3502 and Institut Fédératif de Recherche 58 (C.L.-B., B.D., A.B., K.C.), University Pierre et Marie Curie-Paris 6 and Centre Hospitalier Régional Universitaire Pitié Salpétrière, Centre de Recherche en Nutrition Humaine Ile de de France, Hôtel-Dieu, 75004 Paris, France; Department of Pediatric Gastroenterology and Nutrition (B.D.), Armand-Trousseau Teaching Hospital, Paris, France; Biochemistry Department (J.-M.L.), Hôtel-Dieu Hospital, Paris, France; and Unité Mixte de Recherche INSERM Unit 557/Institut National de la Recherche Agronomique Unit 1125 (S.B., S.H.), Institut Scientifique et Technique de la Nutrition et de lAlimentation-Conservatoire National des Arts et Métiers, 75003 Paris, France
Address all correspondence and requests for reprints to: Christian Vaisse, M.D., Ph.D., University of California San Francisco, Diabetes Center and Department of Medicine, Room HSW1113, 513 Parnassus Avenue, San Francisco, California 94143-0573. E-mail: vaisse{at}medicine.ucsf.edu.
| Abstract |
|---|
|
|
|---|
Objective: Our objective was to determine the prevalence of MC4R mutations in a cohort of severely obese adults and to determine the clinical phenotype and the phenotype-genotype relationship within adult MC4R mutation carriers.
Design and Setting: We conducted an observational study at a referral center.
Patients or Other Participants: Participants included 769 adult patients with body mass index of at least 35 kg/m2 and 444 nonobese control individuals.
Interventions: There were no interventions.
Main Outcome Measures: We assessed the prevalence of pathogenic MC4R mutations, functional characteristics of the detected mutations, phenotype, and phenotype-genotype relationship within mutation carriers.
Results: The global prevalence of obesity-specific MC4R mutations was 2.6%, and the 95% confidence interval (CI95) was 1.53.7. The prevalence of MC4R mutations was similar in patients developing obesity in childhood (2.83%; CI95, 0.94.8) and in patients with a later onset of the disease (2.35%; CI95, 0.93.8). Adult obese MC4R mutation carriers did not present with binge eating or with any specific clinical phenotype. The severity of the functional alterations of the mutated MC4Rs and in particular the intracellular retention of the receptor correlates both with the severity and the onset of the obesity in the mutation carriers.
Conclusions: Obese adult carriers of functionally relevant MC4R mutations do not specifically present with binge-eating disorder or a history of early-onset obesity. The onset and severity of the obesity in the carriers is related to the functional severity of the MC4R mutations.
| Introduction |
|---|
|
|
|---|
-MSH and an orexigenic signal provided by its antagonist agouti-related protein (AGRP). Both of these ligands are expressed in distinct neuronal populations of the arcuate nucleus of the hypothalamus and are coordinately regulated by the adipocyte-secreted hormone leptin to control food intake and maintain long-term energy homeostasis (2). Recent data suggest that MC4R exhibits a constitutive activity upon which AGRP acts as an inverse agonist (3, 4, 5). Heterozygous mutations in the MC4R gene have been implicated in a significant proportion of cases of severe childhood-onset obesity (6, 7, 8, 9, 10, 11, 12, 13). These multiple studies have led to the discovery of a total of 91 mutation carriers, most of them heterozygous, in 3057 children and adolescents, representing 2.98% [95% confidence interval (CI95), 2.33.6] of childhood-onset obesity (6, 7, 8, 9, 10, 11, 12, 13, 14). The functional defects of the mutated receptor found in obese children include total loss of activity associated with intracellular retention of the mutated protein, decrease in agonist-induced receptor activity, or decreased constitutive activity of the receptor (5, 11, 12, 13, 15). In particular, using a quantitative assay, we have demonstrated that 80% of childhood obesity-associated mutations are partially or completely intracellularly retained (11).
There have been few studies that have examined the role of MC4R variants in the development of severe adult-onset obesity. We had initially observed a frequency of 4% pathogenic MC4R mutation carriers in adult obese patients from France [209 patients with body mass index (BMI)
35 kg/m2)] (16) and more recently have observed a similar frequency (3.5%) in obese adults from Northern California (166 patients with BMI
40 kg/m2) (17). Such mutations segregate with obesity in the families of the probands and are absent in nonobese controls (16). In contrast, several other studies have detected a far lower frequency of pathogenic mutations in obese adults in different countries (10, 18, 19). Because the observed frequencies are further confounded by the possible early onset of the obesity observed in adult patients, these results have led to the suggestion that MC4R mutations cause a specific form of early-onset highly penetrant obesity and that other genes or different gene-environment interactions are implicated in later-onset severe obesity (20). In addition, given the small number of mutations previously detected in these adult patient cohorts, studies of functional alterations due to MC4R mutations causing severe adult obesity have been very limited, and the potential relationship between functional alterations and the phenotype, in particular the onset of obesity, have not been evaluated, especially in groups of unrelated subjects. Finally, by using a less stringent definition of pathogenic MC4R mutations, i.e. not limited to obesity-associated functional sequence variants, Branson et al. (18) recently suggested that severely obese adult MC4R mutations carriers all presented with binge-eating disorder, an observation that was not confirmed by others (21).
We here use an extended cohort of severely obese adult subjects (769 subjects with BMI
35 kg/m2) to compare the prevalence and the function of MC4R mutations found in early- and late-onset forms of the disease, to search for specific phenotypes in adult MC4R mutation carriers, and to determine the presence of a genotype-phenotype relationship in adult MC4R mutation carriers.
| Subjects and Methods |
|---|
|
|
|---|
The 769 obese unrelated adult subjects were part of a previously described population (16) and a group of obese subjects prospectively recruited after 2001 at the Hôtel-Dieu Hospital, Paris, France. Informed consent was obtained for all subjects, and the protocol was approved by the Local Ethics Committee (Comités Consultatifs de Protection des Personnes dans la Recherche Biomedicale Hôtel-Dieu, Paris). The criterion for inclusion was a BMI of at least 35 kg/m2. Z-scores for BMI were calculated using the median, SD and Box-Cox power for the individuals age and sex of the French age 087 yr BMI charts (22).
Weight histories were obtained from the childhood health records (mandatory in France) and records of height and weight measurements at conscription for men. Two hundred eighty-three patients had a BMI of at least 30 kg/m2 at age 20 yr, and 425 had a BMI less than 30 kg/m2. Metabolic complications of obesity were evaluated by carbohydrate, insulin, and lipid measurements. Diagnosis of type 2 diabetes was based on the 1997 American Diabetes Association criteria. Diagnosis of hypertriglyceridemia was based on hypolipidemic treatments and/or criteria defined in the National Cholesterol Education Program Adult Treatment Panel III (serum triglycerides
2.21), and diagnosis of hypertension was based on hypotensive treatment and/or on World Health Organization criteria (blood pressure
160/90 mm Hg).
Quantitative food intake was individually assessed by a dietary history taken by registered dieticians the first day of investigation (23). Qualitative food intake was evaluated using the Three-Factor Eating Questionnaire (TFEQ), a psychometric instrument developed for the study of eating behavior and as described (23, 24). It measures three dimensions of human eating behavior: restraint, disinhibition, and hunger. Restrained eating is defined as the tendency to restrict food intake to control body weight. Disinhibition is the inability to resist emotional and social eating cues. Hunger is the subjective feeling of hunger (23).
As a second approach, we retrospectively assessed binge eating based on the Diagnostical and Statistical Manual of Mental Disorders, 4th edition. Each subject completed a questionnaire using the fully validated eating disorder questionnaire of Spitzer et al. (24). In addition, patients were evaluated by a psychologist, a dietitian, and a physician who conducted independent semistructured interviews with the subjects. Diagnostic criteria for binge-eating disorder included at least twice-weekly binge eating over a minimum of 6 months. A binge-eating event was defined as rapid consumption of an unusually large amount of food in the absence of hunger, causing the subject to feel embarrassed, depressed, and/or guilty and out of control. There was no purging behavior in any of the recruited subjects.
Nonobese control subjects were selected from participants in a French prospective study on the efficacy of daily supplementation with antioxidant vitamins and minerals in reducing the major health problems and the cause of premature death in a large population of healthy volunteers [Supplémentation en Vitamines et Minéraux Antioxydants (SU.VI.MAX) Study]. Details on the rationale, design, and methods of the study and baseline characteristics of the subjects have been described elsewhere (25). In total, 13,017 subjects (5,141 men, 4560 yr; 7,876 women, 3560 yr) were included between October 1994 and June 1995. The follow-up period ended in September 2002. During the 8-yr follow-up, participants were invited to three clinical examinations (19951996, 19971998, and 20012002), including anthropometric measurements. Controls were randomly selected from the subgroup of subjects for which DNA was available and who had never been obese according to retrospective and prospective weight records. This control group consisted of 444 individuals, 70% female, with a mean age of 51 ± 0.31 yr and mean BMI of 22.2 ± 0.1 kg/m2. Informed consent for the use of genomic DNA had been obtained at entry in the study.
Direct nucleotide sequencing of the MC4R gene
Genomic DNA was extracted from peripheral leukocytes for all subjects. Two primers, MC4R-AF (5'-ATCAATTCAGGGGGACACTG-3') and MC4R-ER (5'-TGCATGTTCCTATATTGCGTG-3'), were used in a PCR to amplify the entire coding region of the MC4R gene as described (16). The sequencing reaction was performed with the BigDye terminator kit (Applied Biosystems, Foster City, CA) under the standard manufacturers conditions. Each PCR product was sequenced using MC4R-AF, MC4R-ER, and two internal primers, MC4R-CF (TGTAGCTCCTTGCTTGCATC) and MC4R-CR (GGCCATCAGGAACATGTGGA). Sequencing was performed on an ABI PRISM 3700 automated DNA sequencer (Applied Biosystems).
Genomic amplification and construction of wild-type (WT) and mutant MC4R expression vectors
Because MC4R is a single-exon gene, we amplified the variant and WT MC4R genes from the available genomic DNA of the patients carrying the mutations using the primers MC4R-AF and MC4R-ER and cloned the PCR product into the pcDNA3 expression vector (Invitrogen, Carlsbad, CA). To construct the Flag-MC4R-EGFP fusion protein used in the membrane expression assay, WT and mutant MC4R were amplified by PCR from the pcDNA3 expression vector using a primer encoding the Flag epitope sequence (MDYKDDDDK) added 5' of MC4R-AF and the primer MC4R-ER. PCR products were subcloned in pEGFP-N1 (Clontech, Palo Alto, CA). All expression vectors were sequenced to establish the presence of the mutation and the absence of PCR-induced mutations.
Cell surface expression of WT and mutated MC4Rs
Cell surface expression of WT and mutant MC4R was measured using a previously validated FACS-based method (11). Briefly, HEK 293 cells were transiently transfected with a chimeric receptor in which we added an N-terminal Flag epitope and C-terminal (intracellular) green fluorescent protein (GFP). Twenty-four hours after transfection, immunostaining was performed in nondetergent conditions using a primary monoclonal anti-Flag antibody (M2; Sigma Chemical Co., St. Louis, MO) and a secondary phycoerythrin (PE)-conjugated antimouse (Caltag, Burlingame, CA). Cell fluorescence was analyzed through a FACSCalibur Beckton-Dickinson flow cytometer (Beckton-Dickinson Immunocytometry Systems, San Jose, CA). Using the Cell Quest software, 10,00015,000 cells were analyzed for each sample. For each cell, the GFP emission represents total expression of the receptor whereas PE emission represents membrane-expressed receptor. To limit artifacts caused by high receptor overexpression, we limited our analysis to cells expressing low levels of the receptor (11). The ratio PE emission/GFP emission was determined for each individual cell for the predetermined range of GFP emission level using the FlowJo software (Tree Star Inc., San Carlos, CA). ANOVA analysis of the data was performed using JMP3 software (SAS Institute Inc., Cary, NC).
Basal activity of MC4R mutants
HEK 293 cells were maintained in
-MEM supplemented with 10% calf serum (Hyclone, Logan, UT), 0.002 M L-glutamine, nonessential amino acids, and penicillin/streptomycin at 37 C and 5% CO2. Cells were seeded 1 d before transfection at 105 cells per well in 12-well dishes. Cells were transiently transfected (Effectene Transfection Reagent; QIAGEN, Chatsworth, CA) with 0.25 µg WT or mutant MC4R or Flag-MC4R expression plasmid DNA (pcDNA 3.1), 50 ng of the CRE-luciferase plasmid, a cAMP-inducible luciferase reporter gene (26) used to measure the intracellular production of cAMP, and 5 ng of a Renilla luciferase expression plasmid PRL RSV to control for transfection efficiency. A pcDNA 3.1 plasmid expressing ß-galactosidase was used as a negative control. Twenty-four hours after transfection, cells were split into 96-well plates (6500 cells per well) and in 48-well plates (5000 cells per well) for the Renilla luciferase assays. Cells were incubated for 6 h at 37 C in stimulation medium (11) (basal condition) or with AGRP 83132 (200 nM),
-MSH (107 M), or cAMP (1 mM). Firefly and Renilla luciferase activities were assessed as previously described (11). Each assay was performed in triplicate. A minimum of six independent experiments was performed for each mutant (three on the MC4R backbone and three on the Flag-MC4R backbone). Basal and AGRP values are expressed as a percentage of the basal values obtained for the WT receptor in each experiment.
-MSH values are expressed as a percentage of the WT
-MSH stimulation. Each data point represents the mean ± SEM of at least six experiments.
-MSH response of MC4R mutants
-MSH response of MC4R WT and mutant receptors was measured as previously described (11). Data points represent the mean of at least three independent experiments performed in triplicate.
Statistical analysis
The
2 and t tests, and ANOVA analysis of the data were performed using JMP3 software (SAS Institute) or GraphPad Prism (Graphpad Software, San Diego, CA).
| Results |
|---|
|
|
|---|
We had previously demonstrated the significance of MC4R mutations in the predisposition to severe adult obesity in a cohort of 209 patients (16). For the purpose of the present study, and in particular to determine the presence of a phenotype/genotype relationship within MC4R mutation carriers, we extended this cohort by sequencing the MC4R gene in an additional 560 patient subjects with a BMI above 35 kg/m2. The entire cohort was 75% female with a mean age of 44 ± 12 yr, mean BMI of 47.5 ± 7.8 kg/m2, and a mean BMI Z-score of 3.4 ± 0.9.
A total of 43 patients carried a variation in the MC4R coding sequence. Of these, nineteen patients carried the Ile103Val variant (including one homozygous carrier) and three patients carried the Ile251Leu variant. These two variants have previously been found in nonobese controls (16, 27). One patient carried a silent variant (C-593-T).
The remaining 20 patients (2.6%) carried nonsense, frameshift, or other missense mutations in the MC4R gene (Table 1
). None of these mutations has been found in any nonobese control populations screened by our group or by other investigators (13, 14, 16), including 366 nonobese controls screened in our initial study (16). In addition, none of these mutations was found in an additional 444 nonobese French subjects (70% female; mean age, 51 ± 0.31 yr; mean BMI, 22.2 ± 0.1 kg/m2) screened for the purpose of this study.
|
|
Functional defects associated with obesity-causing MC4R mutations include intracellular retention and alteration of the response to the endogenous agonist
-MSH. In addition, we have recently demonstrated that the MC4R displays a constitutive basal activity in the absence of ligand and that this constitutive activity is essential for body weight regulation in humans (5). We systematically and comparatively evaluated all three of these functional characteristics (membrane expression, activation by agonist, and basal activity) for each of the mutant MC4R found in obese adult subjects. Membrane expression of missense mutations was assessed using a sensitive quantitative FACS-based method used previously to study childhood obesity-associated mutations (Fig. 2A
and supplemental data, published on The Endocrine Societys Journals Online web site at http://jcem.endojournals.org) (11). Both basal (Fig. 2B
) and agonist-induced (Fig. 2C
) receptor activity were determined in HEK 293 cells using a cAMP-responsive luciferase reporter gene. All 19 mutations found only in obese subjects modified the function of the MC4R in at least one of the assays (Table 2
). Decreased basal activity was the most common detected defect (79% of mutants). EC50 for
-MSH activation was altered in 64% of the studied mutants. Membrane expression was decreased significantly in 50% of the mutants.
|
|
Early- vs. late-onset obesity. The prevalence of carriers of functionally relevant MC4R mutation in this large cohort of severely obese adults was 2.6%, with CI95 of 1.483.73%, and did not differ significantly from the mean prevalence of MC4R mutations described in all severely obese children (6, 7, 8, 9, 10, 11, 12, 13), including a cohort of 750 Scandinavian men with juvenile onset of obesity, i.e. BMI above 30 kg/m2 at age 20 yr (14). The frequency of MC4R mutations in patients developing obesity in their childhood (as defined by BMI > 30 kg/m2 at age 20 yr) was 2.83%, with CI95 of 0.94.8, and was not significantly different from the frequency of MC4R variants in subjects with a later onset of the disease (2.35%; CI95, 0.93.8). This result establishes that the early onset of obesity is not a specific clinical characteristic of functionally relevant heterozygous MC4R mutation carriers.
MC4R mutations and eating behavior.
Binge eating has been reported as a specific phenotype of adult MC4R mutation carriers (18), but others did not confirm this finding (21). We used two approaches to test the hypothesis that obesity-associated MC4R mutations predispose to binge eating in the patients under study. We first used prospectively collected data from the TFEQ (23, 24). This questionnaire, validated in obese patients, evaluates dietary restraint, disinhibition, and hunger. In particular, disinhibition defines the loss of food intake control under a variety of situations and has been shown to correlate with binge eating (24). The TFEQ was administered to all patients at the time of their entry in the study (23). When compared with nonmutated severely obese patients, carriers of MC4R mutations and carriers of the I103V polymorphism did not differ with respect to the disinhibition, restraint, or hunger scores (Table 3
).
|
Other phenotypes in adult MC4R mutation carriers.
We did not observe any differences in anthropometric measures, including the degree of obesity, and in the severity of obesity complications between obese adult MC4R mutation carriers and noncarriers (Table 3
). Fasting hyperinsulinemia was recently described as a specific feature of children carrying MC4R mutations (12), although we did not observe it in a 7-yr-old carrier of a homozygous null MC4R mutation (30). In this cohort of adult patients, there was no difference in the prevalence of type 2 diabetes between carriers and noncarriers of MC4R mutations. In addition, in the nondiabetic patients, there were no differences in fasting insulinemia or in the parameter of insulin sensitivity as evaluated by the homeostasis model assessment index between carriers and noncarriers of MC4R mutations.
Phenotype/genotype relationship within adult obese MC4R mutation carriers
We evaluated the relationship between the type and extent of the functional alterations caused by mutant MC4R and the precocity or severity of the obesity in the mutation carriers. The precocity of obesity was assessed by the Z-score for BMI at age 20 yr, and the severity of obesity was assessed using the maximal lifetime BMI Z-score.
When considered independently, we found a positive relationship between the presence of any of the functional defects and both the onset and the severity of the obesity in the carriers (Table 4
). This relationship was strongest and most significant for the intracellular retention, making this the best predictor of both the onset and the severity of the obesity in MC4R mutation carriers.
|
| Discussion |
|---|
|
|
|---|
Our study confirms that mutations in MC4R are a significant cause of severe human obesity and extends this finding to patients with a later onset of the condition. Although it had been suggested that obesity caused by MC4R mutations should be isolated from common obesity on the basis of its early onset and its high penetrance, the frequency of 2.6% (CI95, 1.483.73) of pathogenic MC4R mutations in adult subjects with severe obesity reported here matches the frequency of MC4R mutations detected in cohorts of patients presenting with childhood obesity of different origins (6, 7, 8, 9, 10, 11, 12, 13, 14). In addition, our finding of a similar frequency of MC4R mutations in patients with a later onset of the disease clearly confirms that childhood onset of obesity is not a specific clinical phenotype differentiating adult MC4R mutation carriers from other severely obese patients.
The prevalence of MC4R mutations reported here does not include sequence variants for which there is no functional evidence of a deleterious effect and/or that are present at a similar frequency in nonobese individuals, such as Ile103Val or Ile251Leu. The frequencies of rare pathogenic variants observed here is in agreement with previous studies performed in adult populations. For example, in the study performed in obese adult Swiss patients, the frequency of MC4R mutations is 1.7% when polymorphisms are excluded (14, 18). We support the argument made by others in reference to this report that including common polymorphisms in the study of obesity caused by MC4R mutations may create confusion and lead to inappropriate clinical decisions (31, 32, 33).
We did not detect any phenotype differences between adult MC4R mutation carriers and noncarriers of equivalent BMI. Our study confirms in particular that binge eating is not a specific phenotype of adult MC4R mutation carriers and that glucose metabolism is not specifically altered in these patients. Together, these data suggest that, in a clinical context, no specific phenotype can be used to predict the presence of an MC4R mutation in severely obese adult patients. It is possible, however, that other phenotypes not studied here might permit this differentiation. For example, in children, patients with MC4R mutations seem to present with an increased bone density as measured by dual-energy x-ray absorptiometry. Although we have not found any evidence of a relationship between MC4R mutations and body composition evaluated by dual-energy x-ray absorptiometry in our group of severely obese adult subjects (data not shown), it should be noted that the use of this technique is notoriously unreliable in severely obese subjects (34, 35). It should also be noted that effects of MC4R mutations on bone density, stature, or food intake could be more salient during periods of somatic growth.
We previously demonstrated that intracellular retention was a frequent feature of MC4R mutations associated with childhood obesity being observed for 80% of studied mutations (11). The results obtained here confirm this finding, because 70% of the mutations found in patients with early onset of obesity (BMI
30 kg/m2 at age 20 yr) led to intracellular retention of the receptor, whereas only 23% of the MC4R mutations detected in patients with late-onset obesity were intracellularly retained. This result also further supports the use of intracellular retention as a relevant criteria for the functional classification of MC4R mutations (36).
In summary, although we did not find a difference in the prevalence of MC4R mutations in severely obese patients with late-onset vs. early-onset obesity, we found an association between the severity of the functional alterations in the MC4R and the onset of obesity in the carriers. These findings extend previous observations of a phenotype-genotype relationship within MC4R mutation carriers and suggest that it is allelic heterogeneity rather than genetic heterogeneity that determines the onset of obesity in humans.
| Acknowledgments |
|---|
| Footnotes |
|---|
None of the authors of the manuscript has anything to declare.
First Published Online February 28, 2006
Abbreviations: AGRP, Agouti-related protein; BMI, body mass index; CI95, 95% confidence interval; GFP, green fluorescent protein; MC4R, melanocortin-4 receptor; PE, phycoerythrin; TFEQ, Three-Factor Eating Questionnaire; WT, wild-type.
Received June 27, 2005.
Accepted February 16, 2006.
| References |
|---|
|
|
|---|
-melanocyte-stimulating hormone genes in severely obese children. J Pediatr 139:204209[CrossRef][Medline]This article has been cited by other articles:
![]() |
M. A. Calton, B. A. Ersoy, S. Zhang, J. P. Kane, M. J. Malloy, C. R. Pullinger, Y. Bromberg, L. A. Pennacchio, R. Dent, R. McPherson, et al. Association of functionally significant Melanocortin-4 but not Melanocortin-3 receptor mutations with severe adult obesity in a large North American case-control study Hum. Mol. Genet., March 15, 2009; 18(6): 1140 - 1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tan, I. D. Pogozheva, G. S. H. Yeo, D. Hadaschik, J. M. Keogh, C. Haskell-Leuvano, S. O'Rahilly, H. I. Mosberg, and I. S. Farooqi Functional Characterization and Structural Modeling of Obesity Associated Mutations in the Melanocortin 4 Receptor Endocrinology, January 1, 2009; 150(1): 114 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pichler, B. Kollerits, I. M Heid, S. C Hunt, T. D Adams, P. N Hopkins, and F. Kronenberg Association of the melanocortin-4 receptor V103I polymorphism with dietary intake in severely obese persons Am. J. Clinical Nutrition, September 1, 2008; 88(3): 797 - 800. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stutzmann, K. Tan, V. Vatin, C. Dina, B. Jouret, J. Tichet, B. Balkau, N. Potoczna, F. Horber, S. O'Rahilly, et al. Prevalence of Melanocortin-4 Receptor Deficiency in Europeans and Their Age-Dependent Penetrance in Multigenerational Pedigrees Diabetes, September 1, 2008; 57(9): 2511 - 2518. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Geliebter, C. N. Ochner, and R. Aviram-Friedman Appetite-Related Gut Peptides in Obesity and Binge Eating Disorder American Journal of Lifestyle Medicine, July 1, 2008; 2(4): 305 - 314. [Abstract] [PDF] |
||||
![]() |
P. M. Conn, A. Ulloa-Aguirre, J. Ito, and J. A. Janovick G Protein-Coupled Receptor Trafficking in Health and Disease: Lessons Learned to Prepare for Therapeutic Mutant Rescue in Vivo Pharmacol. Rev., September 1, 2007; 59(3): 225 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hainerova, L. H. Larsen, B. Holst, M. Finkova, V. Hainer, J. Lebl, T. Hansen, and O. Pedersen Melanocortin 4 Receptor Mutations in Obese Czech Children: Studies of Prevalence, Phenotype Development, Weight Reduction Response, and Functional Analysis J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3689 - 3696. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stutzmann, V. Vatin, S. Cauchi, A. Morandi, B. Jouret, O. Landt, P. Tounian, C. Levy-Marchal, R. Buzzetti, L. Pinelli, et al. Non-synonymous polymorphisms in melanocortin-4 receptor protect against obesity: the two facets of a Janus obesity gene Hum. Mol. Genet., August 1, 2007; 16(15): 1837 - 1844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Kublaoui and A. R. Zinn MC4R Mutations--Weight before Screening! J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1671 - 1672. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |