help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-2056
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hinney, A.
Right arrow Articles by Hebebrand, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hinney, A.
Right arrow Articles by Hebebrand, J.
Right arrowPubmed/NCBI databases
*OMIM
Medline Plus Health Information
*Obesity
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Metabolism
Right arrow Obesity
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 5 1761-1769
Copyright © 2006 by The Endocrine Society

Prevalence, Spectrum, and Functional Characterization of Melanocortin-4 Receptor Gene Mutations in a Representative Population-Based Sample and Obese Adults from Germany

Anke Hinney, Thomas Bettecken, Patrick Tarnow, Harald Brumm, Kathrin Reichwald, Peter Lichtner, André Scherag, Thuy Trang Nguyen, Pia Schlumberger, Winfried Rief, Caren Vollmert, Thomas Illig, H-Erich Wichmann, Helmut Schäfer, Matthias Platzer, Heike Biebermann, Thomas Meitinger and Johannes Hebebrand

Department of Child and Adolescent Psychiatry (A.H., K.R., J.H.), Rheinische Kliniken Essen, University of Duisburg-Essen, D-45147 Essen, Germany; Institutes of Human Genetics (T.B., P.L., T.M.) and Epidemiology (C.V., T.I., H.W.), GSF-National Research Center for Environment and Health, Genome Analysis Center, D-85764 Neuherberg, Germany; Department of Pediatric Endocrinology (P.T., H.Br., H.Bi.), Charité Children’s Hospital, Humboldt University, D-13353 Berlin, Germany; Genome Analysis (K.R., M.P.), Leibniz Institute for Age Research - Fritz Lipmann Institute, D-07745 Jena, Germany; and Institute of Medical Biometry and Epidemiology (A.S., T.T.N., H.S.) and Department of Psychology (P.S., W.R.), Philipps-University of Marburg, D-35037 Marburg, Germany

Address all correspondence and requests for reprints to: Dr. A. Hinney, Department of Child and Adolescent Psychiatry, Rheinische Kliniken Essen, University of Duisburg-Essen, Virchowstrasse 174, 45147 Essen, Germany. E-mail: anke.hinney{at}uni-duisburg-essen.de.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Autosomal dominant inheritance of mutations in the melanocortin-4 receptor gene (MC4R) is currently regarded as the most relevant genetic cause for extreme obesity and affects 2–4% of extremely obese individuals.

Objective: Our objective was to assess the relevance of MC4R mutations in a German population-based sample.

Design and Setting: We conducted a mutation screen of the MC4R gene by capillary electrophoresis-based single-strand conformation polymorphism analysis and denaturing HPLC.

Participants: Subjects included 4068 individuals of a German population-based study group [Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4 (KORA-S4); i.e. Cooperative Health Research in the Region of Augsburg] and 1003 German obese adults (body mass index ≥ 30 kg/m2).

Main Outcome Measures: Samples with aberrant capillary electrophoresis-based single-strand conformation polymorphism analysis/denaturing HPLC patterns were resequenced. Functional studies including agonistic receptor stimulation (Nle-D-Phe-{alpha}-, {alpha}-, and ß-MSH) and cell surface expression assays were performed.

Results: Sixteen (six novel) coding nonsynonymous mutations were detected in 27 heterozygous individuals of KORA-S4. Four of the mutation alleles led to impaired receptor function in vitro; however, none of these six heterozygous mutation carriers was obese (body mass index ≥ 30 kg/m2). In the obese adults, six coding nonsynonymous and a nonsense mutation were detected in 13 individuals. Only the nonsense mutation allele entailed impaired receptor function.

Conclusions: Our study depicts prevalence, spectrum, and functional characterization of MC4R mutations in the German population-based sample KORA-S4. In this epidemiological study group, individuals heterozygous for nonsynonymous MC4R mutation alleles entailing impaired function were not obese. Furthermore, nonsynonymous MC4R mutations causing impaired receptor function were rare in German obese adults (two in 1003 = 0.2%).


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
THE MELANOCORTIN-4 RECEPTOR (MC4R) is involved in central regulation of energy homeostasis and body weight (1, 2, 3). To date, 72 coding nonsynonymous (n = 57), nonsense (n = 5), and frameshift (n = 10) mutations were detected in 140 of 6134 extremely obese individuals from different study samples (4, 5, 6, 7, 8). The combined frequency for all nonsynonymous, nonsense, and frameshift mutations in these extremely obese individuals was 2.28% [95% confidence interval (CI), 1.92–2.69%). In vitro, most of the mutation alleles led to partial or total loss of receptor function (reviewed in Ref.7). In contrast, only six nonsynonymous MC4R mutations were found in six heterozygous individuals of 2731 normal-weight controls (0.22%; 95% CI, 0.08–0.48%) (9, 10, 11). Two of these mutation alleles entailed a loss of function (12); another two were reported to cause impaired function (13, 14). Therefore, loss of function mutations in the MC4R gene do not necessarily lead to obesity (12).

Nonetheless, a significantly increased transmission for mutation alleles leading to impaired MC4R function to obese children and adolescents was found in 520 obesity trios (11). The quantitative effect of these MC4R mutation alleles on body weight was determined in a family-based setting (15). Individuals who were heterozygous for MC4R mutation alleles differed by almost two body mass index (BMI) SD scores (SDS) from homozygotes for the respective wild-type allele. The index patients were not included in the statistical analyses to avoid a bias that would have increased the effect size estimation. In females, the allelic effect was nearly twice as strong as that in males (15).

The observation that relatives of extremely obese heterozygous MC4R mutation allele carriers were also often obese but homozygous for the wild-type allele complicates the assessment of the effect size of individual alleles (15). Additional genetic and/or environmental factors contributed to obesity in these individuals. There are also reports about single relatives who harbored the same MC4R mutation as the index patient but were only moderately overweight or even lean (15, 16, 17, 18). In some cases, this was because of an underlying medical condition (16). Farooqi et al. (1) found complete penetrance of early-onset obesity in heterozygous MC4R mutation carriers. However, only 68% of individuals heterozygous for mutated MC4R alleles in families of homozygotes for these mutations displayed early-onset obesity. In general, individuals homozygous for MC4R mutations were more obese than heterozygous mutation carriers within these families (1).

The aforementioned quantitative results apply only to relatives of extremely obese heterozygotes for a mutated MC4R allele who are living in our current (German) obesogenic environment (15). A completely unbiased estimation of phenotypic effects of mutation alleles on body weight is only possible within a large representative population-based sample.

Hence, we performed a mutation screen in 4068 individuals from a representative population-based sample [Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4 (KORA-S4); i.e. Cooperative Health Research in the Region of Augsburg] that had not been ascertained for obesity to allow for the calculation of the combined frequency of MC4R mutations in an epidemiological sample for the first time. Functional studies were performed for novel mutations. We hypothesized that heterozygotes for mutations that lead to an impaired receptor function should have an increased BMI-SDS compared with the rest of the study group. In addition, we screened 1003 German obese adults to evaluate MC4R mutations.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Study groups

KORA-S4 is an epidemiological study group including 4261 German adult individuals representative of the population within the age range of 25–74 yr in the city and region of Augsburg (Bavaria, Germany); probands were recruited from 1999–2001 (19). Phenotypic data (for males, mean BMI = 27.51 ± 4.04 kg/m2 and mean age = 49.60 ± 14.06 yr; for females, mean BMI = 26.95 ± 5.29 kg/m2 and mean age = 48.79 ± 13.83 yr) were available for all individuals. DNA was available for 4068 individuals (2051 females), and all subsequent analyses are based on this number.

The Marburg obese adults represent a study group of 1003 (635 female) German obese adults (for males, mean BMI = 35.14 ± 4.73 kg/m2 and mean age = 46.45 ± 14.20 yr; for females, mean BMI = 36.55 ± 5.66 kg/m2 and mean age = 46.12 ± 15.07 yr) ascertained in the city and region of Marburg (Hessia, Germany) by general practitioners. The sole inclusion criterion was a BMI of at least 30 kg/m2.

Written informed consent was given by all participants. The study was approved by the Bavarian Ethics Committee and the Ethics Committees of the Universities of Munich and Marburg and conducted in accordance with the guidelines of The Declaration of Helsinki.

Phenotypic measurements

KORA-S4. All probands underwent a standardized interview, physical examination, and blood withdrawal by trained staff. For determination of body weight and height, participants were asked to remove shoes and heavy clothing. Weight measurements were done with a calibrated body weight scale (SECA 709) at an accuracy of ±0.1 kg. The height was read to the nearest 0.5 cm. All participants contributing DNA were screened for mutations in the MC4R. For a graphical representation of the BMI distribution of individuals heterozygous for mutated MC4R alleles, BMI-percentile curves were derived as the least-square estimates of empirical quantiles for the age range of 25–74 yr for both sexes (see Fig. 1Go).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 1. BMI percentile plots for the representative population-based study group (KORA-S4) indicating heterozygotes for different coding nonsynonymous MC4R mutations. The graphics show the BMI distribution of detected heterozygotes for MC4R mutations within the KORA-S4 sample (A, females; B, males). Different mutations ({blacktriangleup}, impaired function; {circ}, uncertain impaired function and like wild type; and {square}, potential gain of function) are depicted. We derived BMI percentile curves as the least-square estimates of empirical quantiles for the age span 25–74 yr for both sexes within the KORA-S4 population. Note that the individual quantiles in Table 2Go slightly deviate from those depicted in these figures, which is because of the least square fit. Individual BMI percentiles were derived by calculating the relative proportion of subjects in the age- and gender-matched group who had BMI smaller than the one observed for the individual. Consequently, BMI SDS values were derived by standardization to this group. The 5–95th percentiles are displayed (P95, P90, P50, P10, and P05 refer to the 95th, 90th, 50th, 10th, and 5th percentile, respectively).

 
Marburg obese adults. Local physicians provided data about age, gender, body weight, and height.

Methods

Mutation screen of the MC4R in the representative population-based sample (KORA-S4) was performed by semiautomated fluorescent capillary electrophoresis-based single-strand conformation polymorphism analysis (CE-SSCP). The following primers were used to generate overlapping PCR products: 1) GGAGGTTAAATCAATTCAGG and GGTGAATGCAGATTCTTGT (product size, 278 bp), 2) CATCAGCTTGTTGGAGAAT and ACCCGCTTAACTGTCATAA (product size, 330 bp), 3) ATTGCAGTGGACAGGTACT and CAGCAATCCTCTTAATGTGA (product size, 256 bp), 4) CCTCATCACCATGTTCTTC and GAGACATGAAGCACACACA (product size, 260 bp), and 5) CGTCTTTGTTGTCTGCTG and CCTATATTGCGTGCTCTGT (product size, 269 bp). The sensitivity of CE-SSCP was 95% and the specificity 97%; the method was shown to be highly reproducible (20). DNA of probands heterozygous for 11 different known MC4R mutations (11) ([Tyr35Stop; 110A->T], Ser30Phe, Pro78Leu, Ile121Thr, Ser127Leu, Arg165Trp, Gly181Asp, Ala244Glu, and Gly252Ser) and for known single-nucleotide polymorphisms (SNPs) (Val103Ile and Ile251Leu) was used to establish and validate the CE-SSCP method. At one specific temperature (25 C), all variants but one (Pro78Leu) were detectable.

All Marburg obese adults were screened for mutations by denaturing (d)HPLC as described previously (11).

Resequencing of all samples with aberrant CE-SSCP or dHPLC patterns (see Tables 1–4GoGoGoGo) was performed either commercially (SeqLab, Göttingen, Germany) or in house. For the latter, a genomic region of 2697 bp encompassing MC4R was PCR amplified (GCACAGATTCGTCTCCCAAT and TGTTACGAAAGCACGCAAAG). The coding sequence of MC4R and flanking regions (5', 339 bp; 3', 100 bp) were amplified in four nested, overlapping PCRs: 1) GCATGGCAGCTTCAAGGA and GCACCCTCCATCAGAGTAGC (product size, 450 bp), 2) GCACACTTCTCTGCACCTC and CCAACCCGCTTAACTGTCAT (product size, 475 bp), 3) TAGCTCCTTGCTTGCATCC and CGGAGTGCATAAATCAGAGG (product size, 526 bp), 4) GGCCAGGCTTCACATTAAGA and ACGGAAGAGAAAGCTGTTGC (product size, 333 bp). PCR products were resequenced using PCR primers and the BigDye Terminator Cycle Sequencing version 2.0 kit (Applied Biosystems, Darmstadt, Germany) on ABI 3700 automated sequencers. Base calling was performed using phred (21). Sequence assembly was done using phrap (http://www.phrap.org/phrap.docs/phrap.html). Trace files were inspected visually in gap4 (22).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Mutations detected in the MC4R within 4068 representative population-based samples of the KORA-S4 study group

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Gender, age, and BMI of heterozygotes for MC4R mutations in the KORA-S4 study group

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Mutations detected in the MC4R within 1003 German obese adults (BMI ≥ 30 kg/m2)

 

View this table:
[in this window]
[in a new window]
 
TABLE 4. Gender, age, and BMI of heterozygotes for MC4R mutations within 1003 German obese adults (BMI ≥ 30 kg/m2)

 
Functional classification of nonsynonymous MC4R mutations. When we initiated our functional analyses, we evaluated all published information on MC4R mutation alleles and used the data to complement our functional classification scheme (see Tables 1Go, 3Go, and 5Go). Before or in parallel to our functional in vitro studies, 14 mutations were characterized (see Tables 1Go and 3Go).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Functional in vitro assays pertaining to the previously not functionally analyzed mutation alleles within the MC4R

 
We analyzed nine mutation alleles by the following in vitro assays (see Table 5Go). Respective alleles were amplified from the DNA of the proband and inserted into the expression vector. Mutated and wild-type receptors were transiently transfected into COS-7 cells, and cAMP accumulation assays were performed as described previously (23, 24). To investigate cell-surface expression, receptor constructs were hemagglutinin tagged at the NH2 terminus, and cell-surface ELISAs were performed as previously described (24, 25).

The assays described in the literature measured different properties of the receptor (e.g. direct or indirect cAMP measurement and different agonists/antagonists). Because the distinction between loss of function and reduced function is arbitrary, we use the general term impaired function for both groups. Accordingly, for the main statistical analyses, they were regarded as equivalent.

Statistical analyses

We hypothesized that MC4R mutation alleles entailing impaired function are associated with (extreme) obesity. Consequently, differences in BMI-SDS of probands heterozygous for the respective mutated allele vs. 3823 probands without a mutation/polymorphism were analyzed by the independent-sample t test. For validation, the data were also analyzed by Mann-Whitney U test and permutation tests and for BMI itself (similar results; data not shown). To assess the effect of allele classification problems on statistical analyses, we combined all 27 heterozygous probands for nonsynonymous MC4R mutations and compared those with the 3823 controls in a second test. All tests for significance and resulting P values were two sided, with a level of nominal significance of 0.05. Descriptive 95% CIs for frequency estimates were obtained by the method of Clopper and Pearson (26).


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
MC4R mutations

In 4068 German individuals of the representative population-based sample KORA-S4, we identified 1) 16 nonsynonymous mutations (six of which are novel) in 27 individuals and 2) four synonymous mutations in eight individuals (Tables 1Go and 2Go and Fig. 1Go); all probands were heterozygous for the respective mutation allele. Two known SNPs (Val103Ile and Ile251Leu) were also detected.

In the Marburg obese adults (BMI ≥ 30 kg/m2), we identified 1) a nonsense mutation ([Tyr35Stop; 110A->T]) in two individuals, 2) six different nonsynonymous mutations in 11 individuals, and 3) three synonymous mutations each in a single individual (Tables 3Go and 4Go), again all in the heterozygous state. The two known SNPs were also detected.

Classification of MC4R mutations

To evaluate the functional relevance of the nonsynonymous MC4R mutation alleles, we studied receptor signal transduction properties by measurement of agonist-induced intracellular cAMP accumulation. Based on these in vitro studies as well as on published data, we defined three main categories to classify MC4R mutations: 1) impaired function, 2) uncertain impaired function, and 3) like wild type.

Impaired function (loss of function and reduced function). All available functional data indicate an impaired receptor function. Four of the nonsynonymous mutations identified in KORA-S4 led to an impaired MC4R function (Table 1Go). In the obese adults from Marburg, the nonsense mutation [Tyr35Stop; 110A->T] entailed a complete loss of function (27).

Uncertain impaired function. Available functional data were ambiguous. Five of the nonsynonymous mutations (Tables 1Go and 3Go) detected in either one or both study groups were previously reported to either lead to functional impairment or to be indistinguishable from the wild-type receptor. In our overexpression system, one of these MC4R constructs (Thr101Ala) was highly expressed on the cell surface. However, maximal stimulation after agonist challenge did not correlate with cell surface expression, indicating altered signal transduction properties (Table 5Go).

Like wild type. None of the functional tests showed an impaired receptor function. This applied to 11 MC4R mutations (Tables 1Go and 3Go). Of these, the His158Arg mutation entailed constitutive receptor activity (Table 5Go) characterized by increased basal cAMP levels when compared with the wild-type receptor (28). Agonist stimulation resulted in a cAMP response similar to or slightly higher than wild-type MC4R. However, we consider His158Arg to be like wild type, because the response to agonist stimulation was not deviant or varied only slightly from the wild-type receptor. We are aware that Vaisse et al. (17) reported a constitutively active MC4R receptor, which was subsequently found to be partially retained intracellularly (29). Hence, we cannot exclude that His158Arg entails an impaired function.

Gain of function. Reduced EC50 values after agonist stimulation compared with wild type was shown for three mutations: Thr112Lys, Gln156Arg, and Met200Val (Table 5Go). However, this group was only tentatively assigned and hence included in the like wild-type group for the statistical analyses; the number of tests currently precludes a definitive classification.

Prevalence of MC4R mutations

The estimated prevalence of all nonsynonymous/nonsense mutations was 0.66% (95% CI, 0.44–0.96%) in the population-based sample KORA-S4 and 1.30% (95% CI, 0.69–2.21%) in the obese adults from Marburg. Whereas the estimated prevalence of mutations causing impaired function was 0.15% (95% CI, 0.05–0.32%) in KORA-S4 and 0.2% (95% CI, 0.02–0.72%) in the Marburg obese adults (Tables 1Go and 3Go).

Mutations in obese and overweight individuals in the epidemiological sample

Among the participants in KORA-S4, 23.4% were obese (BMI ≥ 30 kg/m2; n = 950; 499 females); 66.1% were overweight (BMI ≥ 25 kg/m2; n = 2688; 1203 females). None of the obese probands carried an impaired function MC4R mutation allele; two obese females were heterozygous for a mutation allele causing uncertain impaired function (Thr112Met; prevalence among the obese was 0.21%; 95% CI, 0.03–0.76%). Of the 2688 overweight individuals of KORA-S4, four males were heterozygous for mutations with impaired function (Table 2Go; prevalence, 0.15%; 95% CI, 0.04–0.39%); four males and four females were heterozygous for mutations with uncertain impaired function (Table 2Go; prevalence, 0.30%; 95% CI, 0.13–0.59%).

Statistical analyses for mutations in the population-based sample

We analyzed initially the six individuals heterozygous for mutation alleles entailing impaired function (Table 1Go) and compared their BMI-SDS (mean SDS, –0.311; 95% CI, –0.901 to 0.280%) with gender-matched BMI-SDS values of homozygotes for the wild-type allele (mean SDS, 0.003; 95% CI, –0.028 to 0.035%). There was no difference between those groups (P > 0.4). To control for consistency of this result, we compared all 27 heterozygotes for nonsynonymous mutation alleles (mean SDS, –0.293; 95% CI, –0.578 to –0.008%) with homozygotes for the wild-type allele. Again, there were no differences between the groups (P > 0.1).

Heterozygotes for mutation alleles had a slightly reduced BMI-SDS in comparison with homozygotes for the wild-type allele, this nonsignificant effect was opposite to our hypothesis. Explorative comparisons substantiated this effect: 1) 19 heterozygotes for eight mutation alleles that cause either impaired or uncertain impaired function (Table 1Go; mean SDS, –0.291; 95% CI, –0.646 to 0.064%); and 2) eight heterozygotes for mutation alleles that are functionally like wild type (mean SDS, –0.297; 95% CI, –0.909 to 0.315%) were each compared with 3823 individuals homozygous for the wild-type allele, and all comparisons were negative (global and all pairwise P > 0.2). To illustrate gender effects, the BMI distribution of the probands heterozygous for nonsynonymous mutation alleles was graphically displayed for males and females (Fig. 1Go).

Polymorphisms

Two known nonsynonymous SNPs in the MC4R (Val103Ile and Ile251Leu) were each detected with low frequencies in both cases and controls. The allele 103Ile was recently shown to be negatively associated with obesity in the KORA-S4 sample (30, 31). For the 251Leu allele, no allelic effect on body regulation was detected previously: 1) Ile251Leu occurs with a similar frequency (0.5–2%) both in obese and normal-weight subjects in different populations (9, 10, 11, 17, 18, 32); 2) there was no transmission disequilibrium in 520 obesity trios (11); and 3) in cAMP assays, 251Leu-MC4R was like wild type (17). Therefore we did not analyze the SNPs further.


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Autosomal dominantly inherited MC4R mutations that lead to an impaired function have consistently been viewed as a risk factor for the development of extreme obesity (2, 3, 7). All those mutations are individually infrequent; the combined frequency for all mutations in extremely obese cases is 10 times higher than in normal-weight controls. Evidence for a strong allelic effect of these mutations on obesity mainly stems from family studies (15).

Here we determined the prevalence and spectrum of MC4R mutations in a large German representative population-based sample (KORA-S4) and in a study group of obese adults (Marburg obese adults). Novel mutations were functionally characterized. We hypothesized that individuals heterozygous for mutation alleles leading to an impaired function should have a higher BMI-SDS than probands homozygous for the wild-type allele. We did not identify mutations that led to an impaired function in the 950 obese individuals of the 4068 KORA-S4 probands. Although 23.4% of the individuals were obese, only two heterozygous probands for a nonsynonymous mutation allele with uncertain impaired function were identified (0.21%; 95% CI, 0.03–0.76%). We did, however, detect mutations entailing impaired function in overweight and normal-weight individuals in KORA-S4. In the Marburg obese adults, the frequency of mutations with impaired function was rather low (0.2%).

Age effects and severity of obesity

The prevalence of heterozygotes for mutation alleles leading to impaired function was higher in 808 extremely obese German children and adolescents (1.86%; 95% CI, 1.04–3.04%) whose MC4R we screened previously (11) than in 950 obese adults of KORA-S4 (0.00%; 95% CI, 0.00–0.39%; P = 0.00000804, explorative Fisher’s exact test, two sided). The same holds true for the 1003 obese adults from Marburg (0.2%; 95% CI, 0.02–0.72%; P = 0.000228, explorative Fisher’s exact test, two-sided). There are several possible explanations for this: 1) the effect size of MC4R mutation alleles on the severity of obesity possibly decreases with age (1, 15); 2) the proportion of obesity attributable to MC4R mutations decreases because different and additional (partially genetic) causes for obesity apply later in life (33); 3) the current environment might be more obesogenic for carriers of mutation alleles leading to an impaired function; or 4) the severity of the analyzed phenotype is different because the children are more obese than the screened adults (65.5% of the extremely obese children and adolescents had an age- and gender-specific BMI percentile of 99 or above) (11).

Functional studies

Heterozygotes for MC4R mutation alleles leading to an impaired function had BMI-SDS similar to individuals without these mutations in the population-based group KORA-S4. In vitro assays of most of the previously described mutations showed that they lead to total or partial loss of function (7). Nonsynonymous mutations had to be grouped for the statistical analyses, because most of them are individually too infrequent to draw meaningful conclusions (34). Three main categories were formed to classify the MC4R mutations (see Results). We decided to include all mutation alleles leading to an impaired function in one group, although different mutation alleles might exert different quantitative effects in vivo. Divergent and sometimes inconsistent results on the degree of functional impairment of specific mutations have previously been described (7). One also has to bear in mind that the functional tests pertained to an artificial homozygous situation, because cotransfection with the wild-type receptor was not performed. In vivo, the mutations were detected in the heterozygous state. Dominant negative and haplo-insufficiency effects could well lead to a different classification of the severity of functional implications of the different mutations (7). Additionally, most mutations have not yet been fully tested for all experimentally accessible functions, so that a final classification based on more detailed in vitro results is not yet possible. Hence, some of the mutations that were functionally characterized as wild type might also lead to an impaired receptor function. In this context, it is noteworthy that variations in genes underlying differences in plasma levels of high-density lipoprotein cholesterol (35) predict functional data better than vice versa. Finally, albeit unlikely, functional alterations detected in in vitro assays do not necessarily imply that the respective mutations are also functionally deviant in vivo.

For some MC4R mutations, even a slight gain of function could be assumed. The Val103Ile SNP is associated with a mean BMI reduction of 0.5 kg/m2 in heterozygotes (30, 31), implying that in principle variants entailing a gain of function exist in MC4R, although functional assays have not yet been able to substantiate this effect. If indeed other mutations also lead to a substantial gain of function, it would not be too surprising to find these mutations mainly in individuals with a BMI in the normal or even at the bottom of the range.

Impact of ascertainment

Previously, we had shown descriptively a systematic trend within families for a stronger decrease of rates and degree of current and lifetime obesity among homozygotes for the wild-type allele than among heterozygotes for MC4R nonsynonymous/nonsense/frameshift mutation alleles with respect to the degree of relationship to the index patient (15). Because this decline is considerably less pronounced among relatives that are themselves heterozygotes, the relevance of MC4R mutations for obesity was underscored. However, the analysis also revealed that there were presumably large variations in allelic effect sizes of single mutations. It turned out that in some families, heterozygotes for the mutated alleles had even lower BMI-SDS than homozygotes for the wild-type allele, again underscoring the influence of other factors on body weight regulation (15).

In an attempt to understand why the BMI-SDS of heterozygotes for mutation alleles leading to impaired function in the population-based sample was not increased in comparison with homozygotes for the wild-type allele, we compared our results with other genetic epidemiological analyses. An example for the effect of ascertainment on parameter estimates was previously shown for the penetrance estimation of the breast cancer 1 gene (BRCA1) on breast cancer (36); in studies of high-risk families (at least four affected individuals), the highest penetrance estimates were obtained (37), and lower estimates were derived from studies based on cases ascertained independent of family history (38). In accordance with our results, the lowest estimates were obtained in a population-based study (39).

Methodological considerations

If, although unlikely, one or more specific mutations escaped detection, this might affect our results. However, the frequency of 0.66% heterozygotes of nonsynonymous mutation alleles in the MC4R was not dramatically distinct from frequency estimates previously reported for normal-weight individuals (0.22%; 95% CI, 0.08–0.48% (9, 10, 11, 18). Even if some mutations were missed, it seems improbable this would have occurred solely in obese individuals. Hence, the main message of the current analysis would remain unaltered.

Conclusion

Our results do not indicate that adults from a population-based sample who are heterozygous for MC4R nonsynonymous mutation alleles leading to an impaired function have increased BMI-SDS compared with homozygotes for the wild-type allele. Because long-term information on the weight history of the screened individuals is not available, it cannot be excluded that mutation carriers were previously (severely) obese.

Furthermore, we found a lower prevalence of MC4R mutations with impaired function in study groups of obese adults compared with our and other previous screens in extremely obese children and adolescents. This might imply an age-dependent prevalence effect.

Otherwise it might indicate that we will be able to detect such mutations only in groups of more extreme phenotypes. Even though the population-based sample is very large, it must be kept in mind that six heterozygotes of mutation alleles leading to an impaired function are not enough to exclude moderate allele effects for obesity with certainty. We demonstrated that the presence of MC4R mutations does not automatically lead to an increase in BMI-SDS.


    Acknowledgments
 
We thank Gerti Gerber for her excellent technical assistance.


    Footnotes
 
This study was supported by grants from the German Ministry of Education and Research (Bundesministerium für Bildung und Forschung; National Genome Research Network, NGFN1 and -2).

The MONICA Augsburg study was initiated and conducted by U. Keil and co-workers.

The KORA group consists of H.-E. Wichmann (speaker), H. Löwel, C. Meisinger, T. Illig, R. Holle, J. John, and their co-workers, who are responsible for the design and conduct of the KORA studies.

Current address for T.B.: Max-Planck-Institute of Psychiatry, Munich, Germany.

A.H., T.B., P.T., H.Br., K.R., P.L., A.S., T.T.N., P.S., W.R., C.V., T.I., H.W., M.P., H.Bi., T.M., and J.H. have nothing to declare. H.S. is on the scientific advisory board of the GSF.

First Published Online February 21, 2006

Abbreviations: BMI, Body mass index; CE-SSCP, capillary electrophoresis-based single-strand conformation polymorphism analysis; CI, confidence interval; d, denaturing; KORA-S4, Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4, i.e. Cooperative Health Research in the Region of Augsburg; MC4R, melanocortin-4 receptor; SDS, SD score; SNP, single-nucleotide polymorphism.

Received September 13, 2005.

Accepted February 14, 2006.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Farooqi IS, Keogh JM, Yeo GS, Lank EJ, Cheetham T, O’Rahilly S 2003 Clinical spectrum of obesity and mutations in the melanocortin 4 receptor gene. N Engl J Med 348:1085–1095[Abstract/Free Full Text]
  2. Farooqi IS, O’Rahilly S 2005 Monogenic obesity in humans. Annu Rev Med 56:443–458[CrossRef][Medline]
  3. Cone RD 2005 Anatomy and regulation of the central melanocortin system. Nat Neurosci 8:571–578[CrossRef][Medline]
  4. Herpertz S, Siffert W, Hebebrand J 2003 Binge eating as a phenotype of melanocortin 4 receptor gene mutations. N Engl J Med 349:606–609[CrossRef][Medline]
  5. Potoczna N, Branson R, Kral JG, Piec G, Steffen R, Ricklin T, Hoehe MR, Lentes KU, Horber FF 2004 Gene variants and binge eating as predictors of comorbidity and outcome of treatment in severe obesity. J Gastrointest Surg 8:971–982[CrossRef][Medline]
  6. Buono P, Pasanisi F, Nardelli C, Ieno L, Capone S, Liguori R, Finelli C, Oriani G, Contaldo F, Sacchetti L 2005 Six novel mutations in the proopiomelanocortin and melanocortin receptor 4 genes in severely obese adults living in southern Italy. Clin Chem 51:1358–1364[Abstract/Free Full Text]
  7. Tao YX 2005 Molecular mechanisms of the neural melanocortin receptor dysfunction in severe early onset obesity. Mol Cell Endocrinol 239:1–14[CrossRef][Medline]
  8. Zakel UA, Wudy SA, Heinzel-Gutenbrunner M, Gorg T, Schafer H, Gortner L, Blum WF, Hebebrand J, Hinney A 2005 [Prevalence of melanocortin 4 receptor (MC4R) mutations and polymorphisms in consecutively ascertained obese children and adolescents from a pediatric health care utilization population]. Klin Padiatr 217:244–249 (German)[Medline]
  9. Jacobson P, Ukkola O, Rankinen T, Snyder EE, Leon AS, Rao DC, Skinner JS, Wilmore JH, Lonn L, Cowan Jr GS, Sjostrom L, Bouchard C 2002 Melanocortin 4 receptor sequence variations are seldom a cause of human obesity: the Swedish Obese Subjects, the HERITAGE Family Study, and a Memphis cohort. J Clin Endocrinol Metab 87:4442–4446[Abstract/Free Full Text]
  10. Marti A, Corbalan MS, Forga L, Martinez JA, Hinney A, Hebebrand J 2003 A novel nonsense mutation in the melanocortin-4 receptor associated with obesity in a Spanish population. Int J Obes Relat Metab Disord 27:385–388[CrossRef][Medline]
  11. Hinney A, Hohmann S, Geller F, Vogel C, Hess C, Wermter AK, Brokamp B, Goldschmidt H, Siegfried W, Remschmidt H, Schafer H, Gudermann T, Hebebrand J 2003 Melanocortin-4 receptor gene: case-control study and transmission disequilibrium test confirm that functionally relevant mutations are compatible with a major gene effect for extreme obesity. J Clin Endocrinol Metab 88:4258–4267[Abstract/Free Full Text]
  12. Tao YX, Segaloff DL 2005 Functional analyses of melanocortin-4 receptor mutations identified from patients with binge eating disorder and nonobese or obese subjects. J Clin Endocrinol Metab 90:5632–5638[Abstract/Free Full Text]
  13. Nijenhuis WA, Garner KM, VanRozen RJ, Adan RA 2003 Poor cell surface expression of human melanocortin-4 receptor mutations associated with obesity. J Biol Chem 278:22939–22945[Abstract/Free Full Text]
  14. Farooqi IS, Yeo GS, Keogh JM, Aminian S, Jebb SA, Butler G, Cheetham T, O’Rahilly S 2000 Dominant and recessive inheritance of morbid obesity associated with melanocortin 4 receptor deficiency. J Clin Invest 106:271–279[Medline]
  15. Dempfle A, Hinney A, Heinzel-Gutenbrunner M, Raab M, Geller F, Gudermann T, Schafer H, Hebebrand J 2004 Large quantitative effect of melanocortin-4 receptor gene mutations on body mass index. J Med Genet 10:795–800
  16. Sina M, Hinney A, Ziegler A, Neupert T, Mayer H, Siegfried W, Blum WF, Remschmidt H, Hebebrand J 1999 Phenotypes in three pedigrees with autosomal dominant obesity caused by haploinsufficiency mutations in the melanocortin-4 receptor gene. Am J Hum Genet 65:1501–1507[CrossRef][Medline]
  17. Vaisse C, Clement K, Durand E, Hercberg S, Guy-Grand B, Froguel P 2000 Melanocortin-4 receptor mutations are a frequent and heterogeneous cause of morbid obesity. J Clin Invest 106:253–262[Medline]
  18. Valli-Jaakola K, Lipsanen-Nyman M, Oksanen L, Hollenberg AN, Kontula K, Bjorbaek C, Schalin-Jantti C 2004 Identification and characterization of melanocortin-4 receptor gene mutations in morbidly obese Finnish children and adults. J Clin Endocrinol Metab 89:940–945[Abstract/Free Full Text]
  19. Holle R, Happich M, Lowel H, Wichmann HE, MONICA/KORA Study Group 2005 KORA: a research platform for population based health research. Gesundheitswesen 67(Suppl 1):S19–S25
  20. Mogensen J, Bahl A, Kubo T, Elanko N, Taylor R, McKenna WJ 2003 Comparison of fluorescent SSCP and denaturing HPLC analysis with direct sequencing for mutation screening in hypertrophic cardiomyopathy. J Med Genet 40:e59
  21. Ewing B, Green P 1998 Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res 8:186–194[Abstract/Free Full Text]
  22. Bonfield JK, Smith K, Staden R 1995 A new DNA sequence assembly program. Nucleic Acids Res 23:4992–4999[Abstract/Free Full Text]
  23. Biebermann H, Schöneberg T, Krude H, Schultz G, Gudermann T, Grüters A 1997 Mutations of the human thyrotropin gene causing thyroid hypoplasia and persistent congenital hypothyroidism. J Clin Endocrinol Metab 82:3471–3480[Abstract/Free Full Text]
  24. Biebermann H, Krude H, Elsner A, Chubanov V, Gudermann T, Gruters A 2003 Autosomal-dominant mode of inheritance of a melanocortin-4 receptor mutation in a patient with severe early-onset obesity is due to a dominant-negative effect caused by receptor dimerization. Diabetes 52:2984–2988[Abstract/Free Full Text]
  25. Schulz A, Grosse R, Schultz G, Gudermann T, Schöneberg T 2000 Structural implication for receptor oligomerization from functional reconstitution studies of mutant V2 vasopressin receptors. J Biol Chem 275:2381–2389[Abstract/Free Full Text]
  26. Clopper CJ, Pearson E 1934 The use of confidence or fiducial limits illustrated in the case of binomial. Biometrika 26:404–413[Free Full Text]
  27. Larsen LH, Echwald SM, Sorensen TI, Andersen T, Wulff BS, Pedersen O 2005 Prevalence of mutations and functional analyses of melanocortin 4 receptor variants identified among 750 men with juvenile-onset obesity. J Clin Endocrinol Metab 90:219–224[Abstract/Free Full Text]
  28. Lefkowitz RJ, Cotecchia S, Samama P, Costa T 1993 Constitutive activity of receptors coupled to guanine nucleotide regulatory proteins. Trends Pharmacol Sci 14:303–307[CrossRef][Medline]
  29. Lubrano-Berthelier C, Durand E, Dubern B, Shapiro A, Dazin P, Weill J, Ferron C, Froguel P, Vaisse C 2003 Intracellular retention is a common characteristic of childhood obesity-associated MC4R mutations. Hum Mol Genet 12:145–153[Abstract/Free Full Text]
  30. Geller F, Reichwald K, Dempfle A, Illig T, Vollmert C, Herpertz S, Siffert W, Platzer M, Hess C, Gudermann T, Biebermann H, Wichmann HE, Schafer H, Hinney A, Hebebrand J 2004 Melanocortin-4 receptor gene variant I103 is negatively associated with obesity. Am J Hum Genet 74:572–581[CrossRef][Medline]
  31. Heid IM, Vollmert C, Hinney A, Doring A, Geller F, Lowel H, Wichmann HE, Illig T, Hebebrand J, Kronenberg F, KORA Group 2005 Association of the 103I MC4R allele with decreased body mass in 7937 participants of two population based surveys. J Med Genet 42:e21
  32. Hinney A, Schmidt A, Nottebom K, Heibult O, Becker I, Ziegler A, Gerber G, Sina M, Gorg T, Mayer H, Siegfried W, Fichter M, Remschmidt H, Hebebrand J 1999 Several mutations in the melanocortin-4 receptor gene including a nonsense and a frameshift mutation associated with dominantly inherited obesity in humans. J Clin Endocrinol Metab 84:1483–1486[Abstract/Free Full Text]
  33. Hebebrand J, Friedel S, Schauble N, Geller F, Hinney A 2003 Perspectives: molecular genetic research in human obesity. Obes Rev 4:139–146[CrossRef][Medline]
  34. Hirschhorn JN, Altshuler D 2002 Once and again—issues surrounding replication in genetic association studies. J Clin Endocrinol Metab 87:4438–4441[Free Full Text]
  35. Cohen JC, Kiss RS, Pertsemlidis A, Marcel YL, McPherson R, Hobbs HH 2004 Multiple rare alleles contribute to low plasma levels of HDL cholesterol. Science 305:869–872[Abstract/Free Full Text]
  36. Begg CB 2002 On the use of familial aggregation in population-based case probands for calculating penetrance. J Natl Cancer Inst 94:1221–1226[Abstract/Free Full Text]
  37. Ford D, Easton DF, Stratton M, Narod S, Goldgar D, Devilee P, Bishop DT, Weber B, Lenoir G, Chang-Claude J, Sobol H, Teare MD, Struewing J, Arason A, Scherneck S, Peto J, Rebbeck TR, Tonin P, Neuhausen S, Barkardottir R, Eyfjord J, Lynch H, Ponder BA, Gayther SA, Birch JM, Lindblom A, Stoppa-Lyonnet D, Bignon Y, Borg A, Hamann U, Haites N, Scott RJ, Maugard CM, Vasen H, Seitz S, Cannon-Albright LA, Schofield A, Zelada-Hedman M, Breast Cancer Linkage Consortium 1998 Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. Am J Hum Genet 62:676–689[CrossRef][Medline]
  38. Warner E, Foulkes W, Goodwin P, Meschino W, Blondal J, Paterson C, Ozcelik H, Goss P, Allingham-Hawkins D, Hamel N, Di Prospero L, Contiga V, Serruya C, Klein M, Moslehi R, Honeyford J, Liede A, Glendon G, Brunet JS, Narod S 1999 Prevalence and penetrance of BRCA1 and BRCA2 gene mutations in unselected Ashkenazi Jewish women with breast cancer. J Natl Cancer Inst 91:1241–1247[Abstract/Free Full Text]
  39. Struewing JP, Hartge P, Wacholder S, Baker SM, Berlin M, McAdams M, Timmerman MM, Brody LC, Tucker MA 1997 The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. N Engl J Med 336:1401–1408[Abstract/Free Full Text]
  40. Srinivasan S, Lubrano-Berthelier C, Govaerts C, Picard F, Santiago P, Conklin BR, Vaisse C 2004 Constitutive activity of the melanocortin-4 receptor is maintained by its N-terminal domain and plays a role in energy homeostasis in humans. J Clin Invest 114:1158–1164[CrossRef][Medline]
  41. Santini F, Maffei M, Ceccarini G, Pelosini C, Scartabelli G, Rosellini V, Chiellini C, Marsili A, Lisi S, Tonacchera M, Agretti P, Chiovato L, Mammoli C, Vitti P, Pinchera A 2004 Genetic screening for melanocortin-4 receptor mutations in a cohort of Italian obese patients: description and functional characterization of a novel mutation. J Clin Endocrinol Metab 89:904–908[Abstract/Free Full Text]
  42. Gu W, Tu Z, Kleyn PW, Kissebah A, Duprat L, Lee J, Chin W, Maruti S, Deng N, Fisher SL, Franco LS, Burn P, Yagaloff KA, Nathan J, Heymsfield S, Albu J, Pi-Sunyer FX, Allison DB 1999 Identification and functional analysis of novel human melanocortin-4 receptor variants. Diabetes 48:635–639[Abstract]
  43. Tarnow P, Schoneberg T, Krude H, Gruters A, Biebermann H 2003 Mutationally induced disulfide bond formation within the third extracellular loop causes melanocortin 4 receptor inactivation in patients with obesity. J Biol Chem 278:48666–48673[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T. R. H. Buch, D. Heling, E. Damm, T. Gudermann, and A. Breit
Pertussis Toxin-sensitive Signaling of Melanocortin-4 Receptors in Hypothalamic GT1-7 Cells Defines Agouti-related Protein as a Biased Agonist
J. Biol. Chem., September 25, 2009; 284(39): 26411 - 26420.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. A. Calton, B. A. Ersoy, S. Zhang, J. P. Kane, M. J. Malloy, C. R. Pullinger, Y. Bromberg, L. A. Pennacchio, R. Dent, R. McPherson, et al.
Association of functionally significant Melanocortin-4 but not Melanocortin-3 receptor mutations with severe adult obesity in a large North American case-control study
Hum. Mol. Genet., March 15, 2009; 18(6): 1140 - 1147.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. V. Kryukov, A. Shpunt, J. A. Stamatoyannopoulos, and S. R. Sunyaev
Power of deep, all-exon resequencing for discovery of human trait genes
PNAS, March 10, 2009; 106(10): 3871 - 3876.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. Krakoff, L. Ma, S. Kobes, W. C. Knowler, R. L. Hanson, C. Bogardus, and L. J. Baier
Lower Metabolic Rate in Individuals Heterozygous for Either a Frameshift or a Functional Missense MC4R Variant
Diabetes, December 1, 2008; 57(12): 3267 - 3272.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Stutzmann, K. Tan, V. Vatin, C. Dina, B. Jouret, J. Tichet, B. Balkau, N. Potoczna, F. Horber, S. O'Rahilly, et al.
Prevalence of Melanocortin-4 Receptor Deficiency in Europeans and Their Age-Dependent Penetrance in Multigenerational Pedigrees
Diabetes, September 1, 2008; 57(9): 2511 - 2518.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
P. M. Conn, A. Ulloa-Aguirre, J. Ito, and J. A. Janovick
G Protein-Coupled Receptor Trafficking in Health and Disease: Lessons Learned to Prepare for Therapeutic Mutant Rescue in Vivo
Pharmacol. Rev., September 1, 2007; 59(3): 225 - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Hainerova, L. H. Larsen, B. Holst, M. Finkova, V. Hainer, J. Lebl, T. Hansen, and O. Pedersen
Melanocortin 4 Receptor Mutations in Obese Czech Children: Studies of Prevalence, Phenotype Development, Weight Reduction Response, and Functional Analysis
J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3689 - 3696.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. Stutzmann, V. Vatin, S. Cauchi, A. Morandi, B. Jouret, O. Landt, P. Tounian, C. Levy-Marchal, R. Buzzetti, L. Pinelli, et al.
Non-synonymous polymorphisms in melanocortin-4 receptor protect against obesity: the two facets of a Janus obesity gene
Hum. Mol. Genet., August 1, 2007; 16(15): 1837 - 1844.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. M. Kublaoui and A. R. Zinn
MC4R Mutations--Weight before Screening!
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1671 - 1672.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hinney, A.
Right arrow Articles by Hebebrand, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hinney, A.
Right arrow Articles by Hebebrand, J.
Right arrowPubmed/NCBI databases
*OMIM
Medline Plus Health Information
*Obesity
Related Collections
Right arrow Neuroendocrinology and Pituitary
Right arrow Metabolism
Right arrow Obesity


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals