| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Child and Adolescent Psychiatry (A.H., K.R., J.H.), Rheinische Kliniken Essen, University of Duisburg-Essen, D-45147 Essen, Germany; Institutes of Human Genetics (T.B., P.L., T.M.) and Epidemiology (C.V., T.I., H.W.), GSF-National Research Center for Environment and Health, Genome Analysis Center, D-85764 Neuherberg, Germany; Department of Pediatric Endocrinology (P.T., H.Br., H.Bi.), Charité Childrens Hospital, Humboldt University, D-13353 Berlin, Germany; Genome Analysis (K.R., M.P.), Leibniz Institute for Age Research - Fritz Lipmann Institute, D-07745 Jena, Germany; and Institute of Medical Biometry and Epidemiology (A.S., T.T.N., H.S.) and Department of Psychology (P.S., W.R.), Philipps-University of Marburg, D-35037 Marburg, Germany
Address all correspondence and requests for reprints to: Dr. A. Hinney, Department of Child and Adolescent Psychiatry, Rheinische Kliniken Essen, University of Duisburg-Essen, Virchowstrasse 174, 45147 Essen, Germany. E-mail: anke.hinney{at}uni-duisburg-essen.de.
| Abstract |
|---|
|
|
|---|
Objective: Our objective was to assess the relevance of MC4R mutations in a German population-based sample.
Design and Setting: We conducted a mutation screen of the MC4R gene by capillary electrophoresis-based single-strand conformation polymorphism analysis and denaturing HPLC.
Participants: Subjects included 4068 individuals of a German population-based study group [Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4 (KORA-S4); i.e. Cooperative Health Research in the Region of Augsburg] and 1003 German obese adults (body mass index
30 kg/m2).
Main Outcome Measures: Samples with aberrant capillary electrophoresis-based single-strand conformation polymorphism analysis/denaturing HPLC patterns were resequenced. Functional studies including agonistic receptor stimulation (Nle-D-Phe-
-,
-, and ß-MSH) and cell surface expression assays were performed.
Results: Sixteen (six novel) coding nonsynonymous mutations were detected in 27 heterozygous individuals of KORA-S4. Four of the mutation alleles led to impaired receptor function in vitro; however, none of these six heterozygous mutation carriers was obese (body mass index
30 kg/m2). In the obese adults, six coding nonsynonymous and a nonsense mutation were detected in 13 individuals. Only the nonsense mutation allele entailed impaired receptor function.
Conclusions: Our study depicts prevalence, spectrum, and functional characterization of MC4R mutations in the German population-based sample KORA-S4. In this epidemiological study group, individuals heterozygous for nonsynonymous MC4R mutation alleles entailing impaired function were not obese. Furthermore, nonsynonymous MC4R mutations causing impaired receptor function were rare in German obese adults (two in 1003 = 0.2%).
| Introduction |
|---|
|
|
|---|
Nonetheless, a significantly increased transmission for mutation alleles leading to impaired MC4R function to obese children and adolescents was found in 520 obesity trios (11). The quantitative effect of these MC4R mutation alleles on body weight was determined in a family-based setting (15). Individuals who were heterozygous for MC4R mutation alleles differed by almost two body mass index (BMI) SD scores (SDS) from homozygotes for the respective wild-type allele. The index patients were not included in the statistical analyses to avoid a bias that would have increased the effect size estimation. In females, the allelic effect was nearly twice as strong as that in males (15).
The observation that relatives of extremely obese heterozygous MC4R mutation allele carriers were also often obese but homozygous for the wild-type allele complicates the assessment of the effect size of individual alleles (15). Additional genetic and/or environmental factors contributed to obesity in these individuals. There are also reports about single relatives who harbored the same MC4R mutation as the index patient but were only moderately overweight or even lean (15, 16, 17, 18). In some cases, this was because of an underlying medical condition (16). Farooqi et al. (1) found complete penetrance of early-onset obesity in heterozygous MC4R mutation carriers. However, only 68% of individuals heterozygous for mutated MC4R alleles in families of homozygotes for these mutations displayed early-onset obesity. In general, individuals homozygous for MC4R mutations were more obese than heterozygous mutation carriers within these families (1).
The aforementioned quantitative results apply only to relatives of extremely obese heterozygotes for a mutated MC4R allele who are living in our current (German) obesogenic environment (15). A completely unbiased estimation of phenotypic effects of mutation alleles on body weight is only possible within a large representative population-based sample.
Hence, we performed a mutation screen in 4068 individuals from a representative population-based sample [Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4 (KORA-S4); i.e. Cooperative Health Research in the Region of Augsburg] that had not been ascertained for obesity to allow for the calculation of the combined frequency of MC4R mutations in an epidemiological sample for the first time. Functional studies were performed for novel mutations. We hypothesized that heterozygotes for mutations that lead to an impaired receptor function should have an increased BMI-SDS compared with the rest of the study group. In addition, we screened 1003 German obese adults to evaluate MC4R mutations.
| Subjects and Methods |
|---|
|
|
|---|
KORA-S4 is an epidemiological study group including 4261 German adult individuals representative of the population within the age range of 2574 yr in the city and region of Augsburg (Bavaria, Germany); probands were recruited from 19992001 (19). Phenotypic data (for males, mean BMI = 27.51 ± 4.04 kg/m2 and mean age = 49.60 ± 14.06 yr; for females, mean BMI = 26.95 ± 5.29 kg/m2 and mean age = 48.79 ± 13.83 yr) were available for all individuals. DNA was available for 4068 individuals (2051 females), and all subsequent analyses are based on this number.
The Marburg obese adults represent a study group of 1003 (635 female) German obese adults (for males, mean BMI = 35.14 ± 4.73 kg/m2 and mean age = 46.45 ± 14.20 yr; for females, mean BMI = 36.55 ± 5.66 kg/m2 and mean age = 46.12 ± 15.07 yr) ascertained in the city and region of Marburg (Hessia, Germany) by general practitioners. The sole inclusion criterion was a BMI of at least 30 kg/m2.
Written informed consent was given by all participants. The study was approved by the Bavarian Ethics Committee and the Ethics Committees of the Universities of Munich and Marburg and conducted in accordance with the guidelines of The Declaration of Helsinki.
Phenotypic measurements
KORA-S4.
All probands underwent a standardized interview, physical examination, and blood withdrawal by trained staff. For determination of body weight and height, participants were asked to remove shoes and heavy clothing. Weight measurements were done with a calibrated body weight scale (SECA 709) at an accuracy of ±0.1 kg. The height was read to the nearest 0.5 cm. All participants contributing DNA were screened for mutations in the MC4R. For a graphical representation of the BMI distribution of individuals heterozygous for mutated MC4R alleles, BMI-percentile curves were derived as the least-square estimates of empirical quantiles for the age range of 2574 yr for both sexes (see Fig. 1
).
|
Methods
Mutation screen of the MC4R in the representative population-based sample (KORA-S4) was performed by semiautomated fluorescent capillary electrophoresis-based single-strand conformation polymorphism analysis (CE-SSCP). The following primers were used to generate overlapping PCR products: 1) GGAGGTTAAATCAATTCAGG and GGTGAATGCAGATTCTTGT (product size, 278 bp), 2) CATCAGCTTGTTGGAGAAT and ACCCGCTTAACTGTCATAA (product size, 330 bp), 3) ATTGCAGTGGACAGGTACT and CAGCAATCCTCTTAATGTGA (product size, 256 bp), 4) CCTCATCACCATGTTCTTC and GAGACATGAAGCACACACA (product size, 260 bp), and 5) CGTCTTTGTTGTCTGCTG and CCTATATTGCGTGCTCTGT (product size, 269 bp). The sensitivity of CE-SSCP was 95% and the specificity 97%; the method was shown to be highly reproducible (20). DNA of probands heterozygous for 11 different known MC4R mutations (11) ([Tyr35Stop; 110A
T], Ser30Phe, Pro78Leu, Ile121Thr, Ser127Leu, Arg165Trp, Gly181Asp, Ala244Glu, and Gly252Ser) and for known single-nucleotide polymorphisms (SNPs) (Val103Ile and Ile251Leu) was used to establish and validate the CE-SSCP method. At one specific temperature (25 C), all variants but one (Pro78Leu) were detectable.
All Marburg obese adults were screened for mutations by denaturing (d)HPLC as described previously (11).
Resequencing of all samples with aberrant CE-SSCP or dHPLC patterns (see Tables 14![]()
![]()
![]()
) was performed either commercially (SeqLab, Göttingen, Germany) or in house. For the latter, a genomic region of 2697 bp encompassing MC4R was PCR amplified (GCACAGATTCGTCTCCCAAT and TGTTACGAAAGCACGCAAAG). The coding sequence of MC4R and flanking regions (5', 339 bp; 3', 100 bp) were amplified in four nested, overlapping PCRs: 1) GCATGGCAGCTTCAAGGA and GCACCCTCCATCAGAGTAGC (product size, 450 bp), 2) GCACACTTCTCTGCACCTC and CCAACCCGCTTAACTGTCAT (product size, 475 bp), 3) TAGCTCCTTGCTTGCATCC and CGGAGTGCATAAATCAGAGG (product size, 526 bp), 4) GGCCAGGCTTCACATTAAGA and ACGGAAGAGAAAGCTGTTGC (product size, 333 bp). PCR products were resequenced using PCR primers and the BigDye Terminator Cycle Sequencing version 2.0 kit (Applied Biosystems, Darmstadt, Germany) on ABI 3700 automated sequencers. Base calling was performed using phred (21). Sequence assembly was done using phrap (http://www.phrap.org/phrap.docs/phrap.html). Trace files were inspected visually in gap4 (22).
|
|
|
|
|
The assays described in the literature measured different properties of the receptor (e.g. direct or indirect cAMP measurement and different agonists/antagonists). Because the distinction between loss of function and reduced function is arbitrary, we use the general term impaired function for both groups. Accordingly, for the main statistical analyses, they were regarded as equivalent.
Statistical analyses
We hypothesized that MC4R mutation alleles entailing impaired function are associated with (extreme) obesity. Consequently, differences in BMI-SDS of probands heterozygous for the respective mutated allele vs. 3823 probands without a mutation/polymorphism were analyzed by the independent-sample t test. For validation, the data were also analyzed by Mann-Whitney U test and permutation tests and for BMI itself (similar results; data not shown). To assess the effect of allele classification problems on statistical analyses, we combined all 27 heterozygous probands for nonsynonymous MC4R mutations and compared those with the 3823 controls in a second test. All tests for significance and resulting P values were two sided, with a level of nominal significance of 0.05. Descriptive 95% CIs for frequency estimates were obtained by the method of Clopper and Pearson (26).
| Results |
|---|
|
|
|---|
In 4068 German individuals of the representative population-based sample KORA-S4, we identified 1) 16 nonsynonymous mutations (six of which are novel) in 27 individuals and 2) four synonymous mutations in eight individuals (Tables 1
and 2
and Fig. 1
); all probands were heterozygous for the respective mutation allele. Two known SNPs (Val103Ile and Ile251Leu) were also detected.
In the Marburg obese adults (BMI
30 kg/m2), we identified 1) a nonsense mutation ([Tyr35Stop; 110A
T]) in two individuals, 2) six different nonsynonymous mutations in 11 individuals, and 3) three synonymous mutations each in a single individual (Tables 3
and 4
), again all in the heterozygous state. The two known SNPs were also detected.
Classification of MC4R mutations
To evaluate the functional relevance of the nonsynonymous MC4R mutation alleles, we studied receptor signal transduction properties by measurement of agonist-induced intracellular cAMP accumulation. Based on these in vitro studies as well as on published data, we defined three main categories to classify MC4R mutations: 1) impaired function, 2) uncertain impaired function, and 3) like wild type.
Impaired function (loss of function and reduced function).
All available functional data indicate an impaired receptor function. Four of the nonsynonymous mutations identified in KORA-S4 led to an impaired MC4R function (Table 1
). In the obese adults from Marburg, the nonsense mutation [Tyr35Stop; 110A
T] entailed a complete loss of function (27).
Uncertain impaired function.
Available functional data were ambiguous. Five of the nonsynonymous mutations (Tables 1
and 3
) detected in either one or both study groups were previously reported to either lead to functional impairment or to be indistinguishable from the wild-type receptor. In our overexpression system, one of these MC4R constructs (Thr101Ala) was highly expressed on the cell surface. However, maximal stimulation after agonist challenge did not correlate with cell surface expression, indicating altered signal transduction properties (Table 5
).
Like wild type.
None of the functional tests showed an impaired receptor function. This applied to 11 MC4R mutations (Tables 1
and 3
). Of these, the His158Arg mutation entailed constitutive receptor activity (Table 5
) characterized by increased basal cAMP levels when compared with the wild-type receptor (28). Agonist stimulation resulted in a cAMP response similar to or slightly higher than wild-type MC4R. However, we consider His158Arg to be like wild type, because the response to agonist stimulation was not deviant or varied only slightly from the wild-type receptor. We are aware that Vaisse et al. (17) reported a constitutively active MC4R receptor, which was subsequently found to be partially retained intracellularly (29). Hence, we cannot exclude that His158Arg entails an impaired function.
Gain of function.
Reduced EC50 values after agonist stimulation compared with wild type was shown for three mutations: Thr112Lys, Gln156Arg, and Met200Val (Table 5
). However, this group was only tentatively assigned and hence included in the like wild-type group for the statistical analyses; the number of tests currently precludes a definitive classification.
Prevalence of MC4R mutations
The estimated prevalence of all nonsynonymous/nonsense mutations was 0.66% (95% CI, 0.440.96%) in the population-based sample KORA-S4 and 1.30% (95% CI, 0.692.21%) in the obese adults from Marburg. Whereas the estimated prevalence of mutations causing impaired function was 0.15% (95% CI, 0.050.32%) in KORA-S4 and 0.2% (95% CI, 0.020.72%) in the Marburg obese adults (Tables 1
and 3
).
Mutations in obese and overweight individuals in the epidemiological sample
Among the participants in KORA-S4, 23.4% were obese (BMI
30 kg/m2; n = 950; 499 females); 66.1% were overweight (BMI
25 kg/m2; n = 2688; 1203 females). None of the obese probands carried an impaired function MC4R mutation allele; two obese females were heterozygous for a mutation allele causing uncertain impaired function (Thr112Met; prevalence among the obese was 0.21%; 95% CI, 0.030.76%). Of the 2688 overweight individuals of KORA-S4, four males were heterozygous for mutations with impaired function (Table 2
; prevalence, 0.15%; 95% CI, 0.040.39%); four males and four females were heterozygous for mutations with uncertain impaired function (Table 2
; prevalence, 0.30%; 95% CI, 0.130.59%).
Statistical analyses for mutations in the population-based sample
We analyzed initially the six individuals heterozygous for mutation alleles entailing impaired function (Table 1
) and compared their BMI-SDS (mean SDS, 0.311; 95% CI, 0.901 to 0.280%) with gender-matched BMI-SDS values of homozygotes for the wild-type allele (mean SDS, 0.003; 95% CI, 0.028 to 0.035%). There was no difference between those groups (P > 0.4). To control for consistency of this result, we compared all 27 heterozygotes for nonsynonymous mutation alleles (mean SDS, 0.293; 95% CI, 0.578 to 0.008%) with homozygotes for the wild-type allele. Again, there were no differences between the groups (P > 0.1).
Heterozygotes for mutation alleles had a slightly reduced BMI-SDS in comparison with homozygotes for the wild-type allele, this nonsignificant effect was opposite to our hypothesis. Explorative comparisons substantiated this effect: 1) 19 heterozygotes for eight mutation alleles that cause either impaired or uncertain impaired function (Table 1
; mean SDS, 0.291; 95% CI, 0.646 to 0.064%); and 2) eight heterozygotes for mutation alleles that are functionally like wild type (mean SDS, 0.297; 95% CI, 0.909 to 0.315%) were each compared with 3823 individuals homozygous for the wild-type allele, and all comparisons were negative (global and all pairwise P > 0.2). To illustrate gender effects, the BMI distribution of the probands heterozygous for nonsynonymous mutation alleles was graphically displayed for males and females (Fig. 1
).
Polymorphisms
Two known nonsynonymous SNPs in the MC4R (Val103Ile and Ile251Leu) were each detected with low frequencies in both cases and controls. The allele 103Ile was recently shown to be negatively associated with obesity in the KORA-S4 sample (30, 31). For the 251Leu allele, no allelic effect on body regulation was detected previously: 1) Ile251Leu occurs with a similar frequency (0.52%) both in obese and normal-weight subjects in different populations (9, 10, 11, 17, 18, 32); 2) there was no transmission disequilibrium in 520 obesity trios (11); and 3) in cAMP assays, 251Leu-MC4R was like wild type (17). Therefore we did not analyze the SNPs further.
| Discussion |
|---|
|
|
|---|
Here we determined the prevalence and spectrum of MC4R mutations in a large German representative population-based sample (KORA-S4) and in a study group of obese adults (Marburg obese adults). Novel mutations were functionally characterized. We hypothesized that individuals heterozygous for mutation alleles leading to an impaired function should have a higher BMI-SDS than probands homozygous for the wild-type allele. We did not identify mutations that led to an impaired function in the 950 obese individuals of the 4068 KORA-S4 probands. Although 23.4% of the individuals were obese, only two heterozygous probands for a nonsynonymous mutation allele with uncertain impaired function were identified (0.21%; 95% CI, 0.030.76%). We did, however, detect mutations entailing impaired function in overweight and normal-weight individuals in KORA-S4. In the Marburg obese adults, the frequency of mutations with impaired function was rather low (0.2%).
Age effects and severity of obesity
The prevalence of heterozygotes for mutation alleles leading to impaired function was higher in 808 extremely obese German children and adolescents (1.86%; 95% CI, 1.043.04%) whose MC4R we screened previously (11) than in 950 obese adults of KORA-S4 (0.00%; 95% CI, 0.000.39%; P = 0.00000804, explorative Fishers exact test, two sided). The same holds true for the 1003 obese adults from Marburg (0.2%; 95% CI, 0.020.72%; P = 0.000228, explorative Fishers exact test, two-sided). There are several possible explanations for this: 1) the effect size of MC4R mutation alleles on the severity of obesity possibly decreases with age (1, 15); 2) the proportion of obesity attributable to MC4R mutations decreases because different and additional (partially genetic) causes for obesity apply later in life (33); 3) the current environment might be more obesogenic for carriers of mutation alleles leading to an impaired function; or 4) the severity of the analyzed phenotype is different because the children are more obese than the screened adults (65.5% of the extremely obese children and adolescents had an age- and gender-specific BMI percentile of 99 or above) (11).
Functional studies
Heterozygotes for MC4R mutation alleles leading to an impaired function had BMI-SDS similar to individuals without these mutations in the population-based group KORA-S4. In vitro assays of most of the previously described mutations showed that they lead to total or partial loss of function (7). Nonsynonymous mutations had to be grouped for the statistical analyses, because most of them are individually too infrequent to draw meaningful conclusions (34). Three main categories were formed to classify the MC4R mutations (see Results). We decided to include all mutation alleles leading to an impaired function in one group, although different mutation alleles might exert different quantitative effects in vivo. Divergent and sometimes inconsistent results on the degree of functional impairment of specific mutations have previously been described (7). One also has to bear in mind that the functional tests pertained to an artificial homozygous situation, because cotransfection with the wild-type receptor was not performed. In vivo, the mutations were detected in the heterozygous state. Dominant negative and haplo-insufficiency effects could well lead to a different classification of the severity of functional implications of the different mutations (7). Additionally, most mutations have not yet been fully tested for all experimentally accessible functions, so that a final classification based on more detailed in vitro results is not yet possible. Hence, some of the mutations that were functionally characterized as wild type might also lead to an impaired receptor function. In this context, it is noteworthy that variations in genes underlying differences in plasma levels of high-density lipoprotein cholesterol (35) predict functional data better than vice versa. Finally, albeit unlikely, functional alterations detected in in vitro assays do not necessarily imply that the respective mutations are also functionally deviant in vivo.
For some MC4R mutations, even a slight gain of function could be assumed. The Val103Ile SNP is associated with a mean BMI reduction of 0.5 kg/m2 in heterozygotes (30, 31), implying that in principle variants entailing a gain of function exist in MC4R, although functional assays have not yet been able to substantiate this effect. If indeed other mutations also lead to a substantial gain of function, it would not be too surprising to find these mutations mainly in individuals with a BMI in the normal or even at the bottom of the range.
Impact of ascertainment
Previously, we had shown descriptively a systematic trend within families for a stronger decrease of rates and degree of current and lifetime obesity among homozygotes for the wild-type allele than among heterozygotes for MC4R nonsynonymous/nonsense/frameshift mutation alleles with respect to the degree of relationship to the index patient (15). Because this decline is considerably less pronounced among relatives that are themselves heterozygotes, the relevance of MC4R mutations for obesity was underscored. However, the analysis also revealed that there were presumably large variations in allelic effect sizes of single mutations. It turned out that in some families, heterozygotes for the mutated alleles had even lower BMI-SDS than homozygotes for the wild-type allele, again underscoring the influence of other factors on body weight regulation (15).
In an attempt to understand why the BMI-SDS of heterozygotes for mutation alleles leading to impaired function in the population-based sample was not increased in comparison with homozygotes for the wild-type allele, we compared our results with other genetic epidemiological analyses. An example for the effect of ascertainment on parameter estimates was previously shown for the penetrance estimation of the breast cancer 1 gene (BRCA1) on breast cancer (36); in studies of high-risk families (at least four affected individuals), the highest penetrance estimates were obtained (37), and lower estimates were derived from studies based on cases ascertained independent of family history (38). In accordance with our results, the lowest estimates were obtained in a population-based study (39).
Methodological considerations
If, although unlikely, one or more specific mutations escaped detection, this might affect our results. However, the frequency of 0.66% heterozygotes of nonsynonymous mutation alleles in the MC4R was not dramatically distinct from frequency estimates previously reported for normal-weight individuals (0.22%; 95% CI, 0.080.48% (9, 10, 11, 18). Even if some mutations were missed, it seems improbable this would have occurred solely in obese individuals. Hence, the main message of the current analysis would remain unaltered.
Conclusion
Our results do not indicate that adults from a population-based sample who are heterozygous for MC4R nonsynonymous mutation alleles leading to an impaired function have increased BMI-SDS compared with homozygotes for the wild-type allele. Because long-term information on the weight history of the screened individuals is not available, it cannot be excluded that mutation carriers were previously (severely) obese.
Furthermore, we found a lower prevalence of MC4R mutations with impaired function in study groups of obese adults compared with our and other previous screens in extremely obese children and adolescents. This might imply an age-dependent prevalence effect.
Otherwise it might indicate that we will be able to detect such mutations only in groups of more extreme phenotypes. Even though the population-based sample is very large, it must be kept in mind that six heterozygotes of mutation alleles leading to an impaired function are not enough to exclude moderate allele effects for obesity with certainty. We demonstrated that the presence of MC4R mutations does not automatically lead to an increase in BMI-SDS.
| Acknowledgments |
|---|
| Footnotes |
|---|
The MONICA Augsburg study was initiated and conducted by U. Keil and co-workers.
The KORA group consists of H.-E. Wichmann (speaker), H. Löwel, C. Meisinger, T. Illig, R. Holle, J. John, and their co-workers, who are responsible for the design and conduct of the KORA studies.
Current address for T.B.: Max-Planck-Institute of Psychiatry, Munich, Germany.
A.H., T.B., P.T., H.Br., K.R., P.L., A.S., T.T.N., P.S., W.R., C.V., T.I., H.W., M.P., H.Bi., T.M., and J.H. have nothing to declare. H.S. is on the scientific advisory board of the GSF.
First Published Online February 21, 2006
Abbreviations: BMI, Body mass index; CE-SSCP, capillary electrophoresis-based single-strand conformation polymorphism analysis; CI, confidence interval; d, denaturing; KORA-S4, Kooperative Gesundheitsforschung im Raum Augsburg, Survey 4, i.e. Cooperative Health Research in the Region of Augsburg; MC4R, melanocortin-4 receptor; SDS, SD score; SNP, single-nucleotide polymorphism.
Received September 13, 2005.
Accepted February 14, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. R. H. Buch, D. Heling, E. Damm, T. Gudermann, and A. Breit Pertussis Toxin-sensitive Signaling of Melanocortin-4 Receptors in Hypothalamic GT1-7 Cells Defines Agouti-related Protein as a Biased Agonist J. Biol. Chem., September 25, 2009; 284(39): 26411 - 26420. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Calton, B. A. Ersoy, S. Zhang, J. P. Kane, M. J. Malloy, C. R. Pullinger, Y. Bromberg, L. A. Pennacchio, R. Dent, R. McPherson, et al. Association of functionally significant Melanocortin-4 but not Melanocortin-3 receptor mutations with severe adult obesity in a large North American case-control study Hum. Mol. Genet., March 15, 2009; 18(6): 1140 - 1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Kryukov, A. Shpunt, J. A. Stamatoyannopoulos, and S. R. Sunyaev Power of deep, all-exon resequencing for discovery of human trait genes PNAS, March 10, 2009; 106(10): 3871 - 3876. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Krakoff, L. Ma, S. Kobes, W. C. Knowler, R. L. Hanson, C. Bogardus, and L. J. Baier Lower Metabolic Rate in Individuals Heterozygous for Either a Frameshift or a Functional Missense MC4R Variant Diabetes, December 1, 2008; 57(12): 3267 - 3272. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stutzmann, K. Tan, V. Vatin, C. Dina, B. Jouret, J. Tichet, B. Balkau, N. Potoczna, F. Horber, S. O'Rahilly, et al. Prevalence of Melanocortin-4 Receptor Deficiency in Europeans and Their Age-Dependent Penetrance in Multigenerational Pedigrees Diabetes, September 1, 2008; 57(9): 2511 - 2518. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Conn, A. Ulloa-Aguirre, J. Ito, and J. A. Janovick G Protein-Coupled Receptor Trafficking in Health and Disease: Lessons Learned to Prepare for Therapeutic Mutant Rescue in Vivo Pharmacol. Rev., September 1, 2007; 59(3): 225 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hainerova, L. H. Larsen, B. Holst, M. Finkova, V. Hainer, J. Lebl, T. Hansen, and O. Pedersen Melanocortin 4 Receptor Mutations in Obese Czech Children: Studies of Prevalence, Phenotype Development, Weight Reduction Response, and Functional Analysis J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3689 - 3696. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Stutzmann, V. Vatin, S. Cauchi, A. Morandi, B. Jouret, O. Landt, P. Tounian, C. Levy-Marchal, R. Buzzetti, L. Pinelli, et al. Non-synonymous polymorphisms in melanocortin-4 receptor protect against obesity: the two facets of a Janus obesity gene Hum. Mol. Genet., August 1, 2007; 16(15): 1837 - 1844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Kublaoui and A. R. Zinn MC4R Mutations--Weight before Screening! J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1671 - 1672. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |