| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pediatrics, University of Parma (A.V., M.C., S.G., I.V., M.Z., S.B., L.G.), and Human Genetics Branch (M.C., T.M.N.), Parma Hospital, 43100 Parma, Italy
Address all correspondence and requests for reprints to: Lucia Ghizzoni, M.D., Department of Pediatrics, University of Parma, Via Gramsci 14, 43100 Parma, Italy. E-mail: lucia.ghizzoni{at}unipr.it.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Objective: The objective of this study was to assess whether abnormalities in the AR function in both peripheral blood leukocytes (PBLs) and androgen target tissues are present in children with premature pubarche (PP).
Design: Human DNA was extracted from PBLs and pubic hair and CAG repeats length and methylation status of the AR gene were analyzed.
Setting: The study was performed at a Pediatric Endocrinology referral clinic.
Patients: Twenty-five girls with PP, 23 prepubertal children, and 10 girls with Tanner stage II pubertal development were studied.
Main Outcome Measure: The main outcome measures were CAG repeat length and AR methylation pattern in PBLs and pubic hair.
Results: In PBLs from PP patients, AR gene methylation was significantly lower (P < 0.01) than that of prepubertal children and similar to that of girls with Tanner II stage pubertal development. A negative correlation between AR gene methylation in PBLs and the age of normal children was detected. Patients with PP exhibited a hair follicle AR methylation pattern similar to that of Tanner stage II girls. The mean number of CAG repeats was lower in PP patients than in prepubertal and Tanner stage II girls, although it was within the normal range for the general population in both groups.
Conclusions: The increased AR gene activity observed in PP patients, as indicated by the reduced AR gene methylation pattern, together with the presence of shorter CAG repeats, might lead to hypersensitivity of the hair follicles to steroid hormones and therefore to the premature development of pubic hair.
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Several studies found links between DNA methylation and gene expression (15, 16). Sequences near silent genes generally are methylated, whereas those near active regions are not. Hypermethylation of cytosine-rich areas (CpG islands) in the promoter region of steroid receptor genes has been associated with the transcriptional inactivation of genes and has been viewed as functionally equivalent to an inactivation mutation (17). In addition, abnormal methylation in CpG islands has been detected frequently in cancer (17). Because methylation is an important mechanism in silencing gene expression during X-chromosome inactivation, and methylation of HpaII and HhaI sites near the polymorphic CAG repeats in exon 1 of the AR gene was shown to correlate with X-chromosome inactivation, the former is considered an indicator of X chromosome inactivation.
Skewed X-chromosome inactivation in peripheral blood leukocytes (PBLs) favoring the expression of shorter AR alleles was reported in women with nonhyperandrogenic hirsutism. Because in vitro studies showed that the AR function is increased by decreasing the length of CAG repeats within the receptor, skewed X-chromosome inactivation was hypothesized to play a role in the hypersensitivity of the AR to androgens in women with idiopathic hirsutism (18). A shorter AR gene CAG repeat number, indicative of increased androgen sensitivity, was reported to increase the risks of premature pubarche (PP) and subsequent ovarian hyperandrogenism (19) and to be associated with androgenic disorders of the skin in men and women, including acne and androgenetic alopecia. Other authors failed to find an association between the CAG repeat polymorphism in the AR gene or the skewed X-chromosome inactivation and AR-mediated hypersensitivity to androgens in idiopathic or hyperandrogenic hirsutism (20). None of the studies so far reported, however, examined the AR methylation pattern in androgen target tissues. Although it is plausible to believe that gene methylation in PBLs might be a marker of the one in tissues, the possibility exists that a distinct methylation pattern characterizes the AR at the target tissue.
PP refers to the appearance of pubic hair before age 8 yr in girls and 9 yr in boys without other signs of pubertal development or virilization (21, 22). Pubarche is usually preceded by adrenarche, which is characterized by increased dehydroepiandrosterone (DHEA) and DHEA-sulfate (DHEA-S) serum levels (22). The precise etiology of premature pubarche is not known. Generally, it has been attributed to the early maturation of the zona reticularis, leading to androgen levels normally seen in early puberty (23, 24). It has also been proposed as a preferential hyperphosphorylation of the enzyme P450c17, the key regulatory enzyme controlling androgen biosynthesis (25). Finally, because half of PP patients have normal androgen levels (26), a hypersensitivity of the pilosebaceous unit to androgens has been proposed.
To assess whether abnormalities in the AR function contributing to the early appearance of pubic hair are present in children with PP, CAG length and AR gene methylation patterns in PBLs and hair follicles of PP patients were analyzed. The same parameters were examined in prepubertal children (PBLs only) and in girls with Tanner stage II pubertal development.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Twenty-five girls with PP (age, 6.4 ± 2.4 yr; mean ± SD), 23 prepubertal children (age, 6.1 ± 3.4 yr), and 10 girls with Tanner stage II pubertal development (age, 11.7 ± 1.5 yr) with similar body mass indexes were studied. All subjects included in the study were Caucasian of Italian origin. Patients with PP underwent an ACTH stimulation test, to rule out nonclassic 21-hydroxylase deficiency. Baseline dihydrotestosterone (DHT), DHEA-S, and estradiol (E2) serum concentrations were measured in all subjects. At least four pubic hairs were collected from all PP patients and Tanner II subjects and were used for DNA extraction. This study was approved by the Clinical Research Committee of the Department of Pediatrics at the University of Parma (Parma, Italy), and informed consent was obtained from the children’s parents.
Microsatellite size determination: CAG repeats
Genomic DNA was extracted from PBLs obtained from a total of 58 individuals, using a rapid extraction protocol (QIAamp kit; QIAGEN, Chatsworth, CA), according to the instructions provided by the manufacturer. PCR amplification of the AR CAG repeat was first carried out with a fluorescent-based PCR using primers flanking the region of interest [AR PCR 1.1 (sense), 5'TCCAGAATCTGTTCCAGAGCGTGC 3'; and AR PCR 1.2 (antisense), 5' GCTGTGAAGGTTGCTGTTCCTCAT 3']. About 100 ng of DNA was amplified in a 15-µl vol containing 1x PCR reaction buffer, 2.5 mM of MgCl2, 0.2 mM of deoxynucleotides, 10 pmol of each primer, and 1 U of Ampli Taq Gold Polymerase (Applied Biosystems, Foster City, CA). The amplification was performed using a GeneAmp PCR System 9700 (Applied Biosystems) under the following conditions: initial denaturation at 95 C for 5 min, amplification for 35 cycles with denaturation at 95 C for 45 sec, annealing at 60 C for 45 sec, and extension at 72 C for 1 min; final extension at 72 C for 10 min. Products were run on ABI PRISM 310 Genetic Analyzer (Applied Biosystems) and were analyzed using Genescan to determine the sizes of the repeated length. CAG length was also validated by direct sequencing, using the sense (5'-GTGCGCGAAGTGATCCAGAA-3') and antisense (5'-TCTGGGACGCAACCTCTCTC-3') primers. Amplification conditions consisted of an initial denaturing step at 95 C for 5 min, followed by 40 cycles at 95 C for 1 min, at 57 C for 1 min, and at 72 C for 1 min. Extension was carried out at 72 C for 5 min. In all cases, the size obtained from both methods was the same.
DNA methylation analysis
DNA extraction. Genomic DNA was isolated from PBLs as previously described. Genomic DNA was also extracted from a minimum of two to a maximum of four pubic hairs from each subject. Pubic hair was kept in nylon bags for up to 1 month. Each hair sample was first washed in water with soap, rinsed in distilled H2O, then cut in small pieces and introduced into an Eppendorf tube. Samples were incubated with 1 ml 0.85% NaCl, 100 µl buffer K (25 mM MgCl2; 20 mM Tris, pH 8.5; 0.5% Tween 20), and 10 µl proteinase K (10 mg/ml) at 65 C overnight. After incubation, the supernatant was removed and dispensed into another Eppendorf tube, while the pieces of hair were rinsed with 500 µl of 0.85% NaCl before being added to the supernatant. The solution was then centrifuged at 13,000 rpm for 15 min, the supernatant discarded, and the pellet air-dried.
Bisulfite modification. DNA (1 µg) from PBLs and the amount of DNA obtained from two to four pubic hairs was used for the bisulfite modification. For hair samples, 1 µg of salmon sperm (Sigma, St. Louis, MO) was added as carrier before modification. Each sample in a volume of 50 µl was denatured by NaOH (final concentration, 0.2 M) for 10 min at 37 C. Thirty microliters of 10 mM hydroquinone (Sigma) and 520 µl of 3 M sodium bisulfite (Sigma) at pH 5, both freshly prepared, were added and mixed, and samples were incubated at 50 C for 16 h. Modified DNA was purified using the Wizard DNA purification resin according to the manufacturer (Promega, Madison, WI) and eluted into 50 µl of diethyl pyrocarbonate water. Modification was completed by NaOH (final concentration, 0.3 M) treatment for 5 min at room temperature, followed by ethanol precipitation. DNA samples from PBLs were resuspended in 50 µl of diethyl pyrocarbonate water (to have 20 ng/µl), while hair DNA in 25 µl to be used entirely in real-time PCR.
Real-time quantitative methylation-specific PCR
For the detection and quantitation of DNA methylation, we developed a real-time methylation-specific PCR system for the AR gene promoter region. For this purpose, we designed two different fluorogenic probes (minor groove binder) recognizing the bisulfite-converted unmethylated and methylated DNA, respectively. A set of specific primers flanking the region of interest was also used. The choice of the two probes was done after sequencing our control groups to check for their methylation pattern, and they were tested using unmethylated and methylated AR DNA controls. Following the TaqMan protocol, the reactions were prepared in triplicate using 100 ng of each DNA obtained from PBLs or two to four pubic hair samples and adding the following reagents at the following concentrations: 1x TaqMan Universal PCR Master Mix (Applied Biosystems), 150 nM of primers, and 100 nM of methylated and unmethylated probes. Reactions were started at 95 C for 10 min to activate AmpliTaq Gold DNA Polymerase (Promega) and were run for 50 cycles at 95 C for 15 sec and 60 C for 1 min. Multiple negative water blanks were included in every analysis. PCR amplification was performed using the ABI PRISM 7700 Sequence Detection System, and methylation percentage was calculated.
Hormone assays
Commercial kits were used for the measurement of serum DHT (RIA; Diagnostic Systems Laboratories, Webster, TX), DHEA-S (RIA; Diagnostic Products Corp., Los Angeles, CA), and E2 (RIA; Diagnostic Systems Laboratories). The latter is a third-generation, ultra-sensitive RIA with a sensitivity of 2.2 pmol/liter. Mean intra- and interassay coefficients of variation were 4.6% and 6.4% for DHT, 4.6% and 8.2% for DHEA-S, and 3.6% and 6.0% for E2, respectively. The sensitivity of the DHT and DHEA-S assays were 0.01 nmol/liter and 0.029 µmol/liter, respectively.
Statistical analysis
A power analysis was performed, and a sample size of 10 per group was found to be sufficient to detect a difference of 15 U between groups with a power greater than 0.80. All experiments were repeated on at least three independent occasions. Values are reported as mean ± SD. A test for normality was performed on all data. Statistical significance within each group was determined by the paired t test or the Mann-Whitney rank sum test, as appropriate. Comparisons among groups were performed using the one-way ANOVA followed by Scheffè’s multiple comparisons tests. The association between two variables was analyzed by Pearsons correlation coefficient. To test a cause-effect relationship between the percentage of the AR gene methylation and the age of the subjects, a linear regression analysis with the methylation as the dependent and the age as the independent variable was performed.
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Hormone serum levels of the subjects studied are reported in Table 1
. DHT blood concentrations in PP patients were significantly lower than in Tanner II girls, whereas DHEA-S blood levels were not different from those detected in both prepubertal and Tanner II girls. No differences in E2 serum levels were found among the groups of children studied.
|
The number of CAG repeats ranged from 16 to 26 and from 16 to 25 in normal children and PP patients, respectively (Fig. 1). The mean number of CAG repeats was significantly lower in PP patients than in normal children (prepubertal and Tanner stage II girls) (20.5 ± 2.1 vs. 21.4 ± 2.0, mean ± SD, P < 0.05), although it remained within the normal range for the general population (11–31) (6) in both groups. Examination of the allele distribution revealed that this difference was due to an excess of alleles with 20 repeats or less in the PP group (47% and 25% in PP and normal children, respectively), whereas the proportion of alleles longer than 23 repeats was higher in normal children than in PP patients (34% vs. 15%, respectively). The CAG repeats length was homozygous in 70% and 59% of PP patients and normal children, respectively, and heterozygous in 30% and 41% of PP patients and normal children, respectively.
|
PP patients exhibited an AR gene methylation in PBLs similar to that of Tanner stage II girls (47.9 ± 12.8 vs. 55.7 ± 12.6, PP patients vs. TII girls) (Fig. 2) and significantly lower than that of prepubertal children (47.9 ± 12.8 vs. 70.8 ± 8.1, PP patients vs. prepubertal children, P < 0.01). A negative correlation between the AR gene methylation status in PBLs and age of the normal subjects was found (r = –0.58, P < 0.005) (Fig. 3).
|
|
). No correlation between AR gene methylation status and age of the subjects was found in pubic hairs. Furthermore, no correlation between the methylation status, both in PBLs and hair follicles, and the hormonal levels was observed.
|
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Exon 1 of AR, located on the X-chromosome, encodes for the transactivation domain and contains a large variable-length CAG repeat polymorphism encoding for glutamine residues in the amino terminus of the AR (11, 12). In vitro studies showed that progressive expansion of the repeat length in the AR was associated with a linear decrease in its transactivation function (13), and the resulting variation in androgen activity was related to a number of clinical consequences (14). In a recent study, shorter AR gene CAG number was reported in a Spanish female population with PP compared with normal women from the same area (19). Despite the wide population differences in AR CAG repeat distribution reported in the literature, the results of the present study in Italian PP patients and normal girls showing shorter AR gene CAG number in the patient group are similar to those reported in the Spanish patients, confirming the common Mediterranean origin of the two populations studied.
Methylation at regulatory regions, especially promoters, correlates with transcriptional activity: sequences near silent genes generally are methylated, whereas those near active regions are not. AR genes from patients with PP were less methylated, and thus more active, than those of prepubertal children of the same age and with the same serum steroid hormone levels and were similar to those of older children with the same degree of pubic hair development and higher steroid hormone concentrations. It can therefore be hypothesized that, in the presence of similar hormonal milieu, the presence of a more active receptor can be instrumental in the precocious appearance of pubic hair. This is in accordance with previous data on patients with idiopathic hirsutism in whom a preferential methylation of the longer AR allele, and thus inactivation of the functionally weaker gene, was demonstrated by a methylation analysis far less sensitive than the one used in the present study (18). In addition, in the present stud, AR gene methylation was also estimated, for the first time to our knowledge, in an androgen target tissue, such as the hair follicles. Obviously, such an analysis was performed only in the patient and Tanner II groups, as prepubertal children are devoid of pubic hair. The results obtained from the hair follicles confirmed what was shown in PBLs: that the AR gene in patients with PP is methylated to the same degree as in normal girls with Tanner II stage of pubertal development. Despite the similarities between the PBLs and the hair follicle data, the absence of a significant association between the AR gene methylation in PBLs and hair follicles indicates that the AR gene activity in PBLs does not necessarily represent the one at the target tissue, and methylation patterns in the two tissues are not constitutionally the same. Therefore, the results obtained in different tissues are not directly comparable.
The negative correlation between the age of the children and the methylation pattern in PBLs detected in the present study suggests an age-dependent modulation of the gene methylation that seems independent of steroid hormone levels, as a correlation between AR gene methylation and circulating steroid hormone levels was not found. An age-specific variation of X-chromosome inactivation was previously described in a group of normal women from various age groups (27). The causes of age-related methylation are still unknown, although evidence points to an interplay between local predisposing factors in DNA (methylation centers), levels of gene expression, and environmental exposure (28). Recently it was shown that AR mRNA expression and its promoter methylation are inversely regulated by sex steroid hormones in the adult mice brain cortex (29). A correlation between AR gene methylation and circulating steroid hormone levels was not found in the present study, suggesting that AR gene methylation might be independent of steroid levels. However, such a conclusion must be validated by a full spectrum of hormone values. Regardless of the pathogenetic mechanism, the presence of an AR gene less active in prepubertal than in pubertal children suggests that a change in the methylation pattern of the gene may be one of the factors involved in the normal development of pubic hair. The different gene methylation in the PP group compared with normal children of the same age corroborates this hypothesis.
In conclusion, because methylation at regulatory regions correlates negatively with transcriptional activity, the reduced AR gene methylation pattern observed in PP patients indicates that the AR gene is more active in the patients than in normal prepubertal children. The increased AR gene activity together with the presence of shorter CAG repeats number in PP patients might lead to hypersensitivity of the hair follicles and therefore to the premature development of pubic hair. The causes for the distinct AR gene methylation pattern are presently unknown and deserve further investigation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 A.V. and M.C. contributed equally to the study. 
Abbreviations: AR, Androgen receptor; DHEA, dehydroepiandrosterone; DHEA-S, DHEA-sulfate; DHT, dihydrotestosterone; E2, estradiol; PBL, peripheral blood leukocyte; PP, premature pubarche.
A.V., M.C., S.G., I.V., M.Z., T.M.N., S.B., and L.G. have nothing to declare.
Received October 26, 2005.
Accepted December 27, 2005.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
18) in the androgen receptor gene in human prostate cancer. Biochem Biophys Res Commun 198:74–80[CrossRef][Medline]This article has been cited by other articles:
 |
|
 |
|
  H. H Ortega, N. R Salvetti, and V. Padmanabhan Developmental programming: prenatal androgen excess disrupts ovarian steroid receptor balance Reproduction, May 1, 2009; 137(5): 865 - 877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Utriainen, R. Voutilainen, and J. Jaaskelainen Continuum of phenotypes and sympathoadrenal function in premature adrenarche Eur. J. Endocrinol., April 1, 2009; 160(4): 657 - 665. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lappalainen, P. Utriainen, T. Kuulasmaa, R. Voutilainen, and J. Jaaskelainen Androgen Receptor Gene CAG Repeat Polymorphism and X-Chromosome Inactivation in Children with Premature Adrenarche J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1304 - 1309. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
