help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-2354
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vottero, A.
Right arrow Articles by Ghizzoni, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vottero, A.
Right arrow Articles by Ghizzoni, L.
Related Collections
Right arrow Male Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 3 968-972
Copyright © 2006 by The Endocrine Society

Decreased Androgen Receptor Gene Methylation in Premature Pubarche: A Novel Pathogenetic Mechanism?

A. Vottero1, M. Capelletti1, S. Giuliodori, I. Viani, M. Ziveri, T. M. Neri, S. Bernasconi and L. Ghizzoni

Department of Pediatrics, University of Parma (A.V., M.C., S.G., I.V., M.Z., S.B., L.G.), and Human Genetics Branch (M.C., T.M.N.), Parma Hospital, 43100 Parma, Italy

Address all correspondence and requests for reprints to: Lucia Ghizzoni, M.D., Department of Pediatrics, University of Parma, Via Gramsci 14, 43100 Parma, Italy. E-mail: lucia.ghizzoni{at}unipr.it.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Context: Several studies found links between DNA methylation and gene expression. In patients with idiopathic hirsutism, a preferential methylation of the of shorter androgen receptor (AR) alleles was hypothesized to be responsible for the abnormal hair growth.

Objective: The objective of this study was to assess whether abnormalities in the AR function in both peripheral blood leukocytes (PBLs) and androgen target tissues are present in children with premature pubarche (PP).

Design: Human DNA was extracted from PBLs and pubic hair and CAG repeats length and methylation status of the AR gene were analyzed.

Setting: The study was performed at a Pediatric Endocrinology referral clinic.

Patients: Twenty-five girls with PP, 23 prepubertal children, and 10 girls with Tanner stage II pubertal development were studied.

Main Outcome Measure: The main outcome measures were CAG repeat length and AR methylation pattern in PBLs and pubic hair.

Results: In PBLs from PP patients, AR gene methylation was significantly lower (P < 0.01) than that of prepubertal children and similar to that of girls with Tanner II stage pubertal development. A negative correlation between AR gene methylation in PBLs and the age of normal children was detected. Patients with PP exhibited a hair follicle AR methylation pattern similar to that of Tanner stage II girls. The mean number of CAG repeats was lower in PP patients than in prepubertal and Tanner stage II girls, although it was within the normal range for the general population in both groups.

Conclusions: The increased AR gene activity observed in PP patients, as indicated by the reduced AR gene methylation pattern, together with the presence of shorter CAG repeats, might lead to hypersensitivity of the hair follicles to steroid hormones and therefore to the premature development of pubic hair.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
THE ANDROGEN RECEPTOR (AR), encoded by the AR gene on the X-chromosome, is a member of the steroid receptor superfamily (1). The AR gene contains a polymorphic CAG microsatellite repeat within exon 1, which codes for a variable length of polyglutamine chain in the amino terminus, the transactivation domain of the AR protein. Triple-repeat DNA sequences can be sites of genetic instability and, indeed, their expansion in a variety of genes was associated with human genetic diseases, such as fragile-X syndrome (2, 3) and myotonic dystrophy (4). In the case of the AR gene (5), an inverse correlation of the number of CAG repeats with the risk for prostate cancer was described (6, 7, 8, 9, 10), and expansion of the gene was documented in Kennedy’s disease (spinal and bulbar muscular atrophy), a disorder associated with primary hypogonadism (11, 12). Moreover, in vitro studies showed that progressive expansion of the repeat length in the AR was associated with a linear decrease in its transactivation function (13, 14).

Several studies found links between DNA methylation and gene expression (15, 16). Sequences near silent genes generally are methylated, whereas those near active regions are not. Hypermethylation of cytosine-rich areas (CpG islands) in the promoter region of steroid receptor genes has been associated with the transcriptional inactivation of genes and has been viewed as functionally equivalent to an inactivation mutation (17). In addition, abnormal methylation in CpG islands has been detected frequently in cancer (17). Because methylation is an important mechanism in silencing gene expression during X-chromosome inactivation, and methylation of HpaII and HhaI sites near the polymorphic CAG repeats in exon 1 of the AR gene was shown to correlate with X-chromosome inactivation, the former is considered an indicator of X chromosome inactivation.

Skewed X-chromosome inactivation in peripheral blood leukocytes (PBLs) favoring the expression of shorter AR alleles was reported in women with nonhyperandrogenic hirsutism. Because in vitro studies showed that the AR function is increased by decreasing the length of CAG repeats within the receptor, skewed X-chromosome inactivation was hypothesized to play a role in the hypersensitivity of the AR to androgens in women with idiopathic hirsutism (18). A shorter AR gene CAG repeat number, indicative of increased androgen sensitivity, was reported to increase the risks of premature pubarche (PP) and subsequent ovarian hyperandrogenism (19) and to be associated with androgenic disorders of the skin in men and women, including acne and androgenetic alopecia. Other authors failed to find an association between the CAG repeat polymorphism in the AR gene or the skewed X-chromosome inactivation and AR-mediated hypersensitivity to androgens in idiopathic or hyperandrogenic hirsutism (20). None of the studies so far reported, however, examined the AR methylation pattern in androgen target tissues. Although it is plausible to believe that gene methylation in PBLs might be a marker of the one in tissues, the possibility exists that a distinct methylation pattern characterizes the AR at the target tissue.

PP refers to the appearance of pubic hair before age 8 yr in girls and 9 yr in boys without other signs of pubertal development or virilization (21, 22). Pubarche is usually preceded by adrenarche, which is characterized by increased dehydroepiandrosterone (DHEA) and DHEA-sulfate (DHEA-S) serum levels (22). The precise etiology of premature pubarche is not known. Generally, it has been attributed to the early maturation of the zona reticularis, leading to androgen levels normally seen in early puberty (23, 24). It has also been proposed as a preferential hyperphosphorylation of the enzyme P450c17, the key regulatory enzyme controlling androgen biosynthesis (25). Finally, because half of PP patients have normal androgen levels (26), a hypersensitivity of the pilosebaceous unit to androgens has been proposed.

To assess whether abnormalities in the AR function contributing to the early appearance of pubic hair are present in children with PP, CAG length and AR gene methylation patterns in PBLs and hair follicles of PP patients were analyzed. The same parameters were examined in prepubertal children (PBLs only) and in girls with Tanner stage II pubertal development.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Patients and normal subjects

Twenty-five girls with PP (age, 6.4 ± 2.4 yr; mean ± SD), 23 prepubertal children (age, 6.1 ± 3.4 yr), and 10 girls with Tanner stage II pubertal development (age, 11.7 ± 1.5 yr) with similar body mass indexes were studied. All subjects included in the study were Caucasian of Italian origin. Patients with PP underwent an ACTH stimulation test, to rule out nonclassic 21-hydroxylase deficiency. Baseline dihydrotestosterone (DHT), DHEA-S, and estradiol (E2) serum concentrations were measured in all subjects. At least four pubic hairs were collected from all PP patients and Tanner II subjects and were used for DNA extraction. This study was approved by the Clinical Research Committee of the Department of Pediatrics at the University of Parma (Parma, Italy), and informed consent was obtained from the children’s parents.

Microsatellite size determination: CAG repeats

Genomic DNA was extracted from PBLs obtained from a total of 58 individuals, using a rapid extraction protocol (QIAamp kit; QIAGEN, Chatsworth, CA), according to the instructions provided by the manufacturer. PCR amplification of the AR CAG repeat was first carried out with a fluorescent-based PCR using primers flanking the region of interest [AR PCR 1.1 (sense), 5'TCCAGAATCTGTTCCAGAGCGTGC 3'; and AR PCR 1.2 (antisense), 5' GCTGTGAAGGTTGCTGTTCCTCAT 3']. About 100 ng of DNA was amplified in a 15-µl vol containing 1x PCR reaction buffer, 2.5 mM of MgCl2, 0.2 mM of deoxynucleotides, 10 pmol of each primer, and 1 U of Ampli Taq Gold Polymerase (Applied Biosystems, Foster City, CA). The amplification was performed using a GeneAmp PCR System 9700 (Applied Biosystems) under the following conditions: initial denaturation at 95 C for 5 min, amplification for 35 cycles with denaturation at 95 C for 45 sec, annealing at 60 C for 45 sec, and extension at 72 C for 1 min; final extension at 72 C for 10 min. Products were run on ABI PRISM 310 Genetic Analyzer (Applied Biosystems) and were analyzed using Genescan to determine the sizes of the repeated length. CAG length was also validated by direct sequencing, using the sense (5'-GTGCGCGAAGTGATCCAGAA-3') and antisense (5'-TCTGGGACGCAACCTCTCTC-3') primers. Amplification conditions consisted of an initial denaturing step at 95 C for 5 min, followed by 40 cycles at 95 C for 1 min, at 57 C for 1 min, and at 72 C for 1 min. Extension was carried out at 72 C for 5 min. In all cases, the size obtained from both methods was the same.

DNA methylation analysis

DNA extraction. Genomic DNA was isolated from PBLs as previously described. Genomic DNA was also extracted from a minimum of two to a maximum of four pubic hairs from each subject. Pubic hair was kept in nylon bags for up to 1 month. Each hair sample was first washed in water with soap, rinsed in distilled H2O, then cut in small pieces and introduced into an Eppendorf tube. Samples were incubated with 1 ml 0.85% NaCl, 100 µl buffer K (25 mM MgCl2; 20 mM Tris, pH 8.5; 0.5% Tween 20), and 10 µl proteinase K (10 mg/ml) at 65 C overnight. After incubation, the supernatant was removed and dispensed into another Eppendorf tube, while the pieces of hair were rinsed with 500 µl of 0.85% NaCl before being added to the supernatant. The solution was then centrifuged at 13,000 rpm for 15 min, the supernatant discarded, and the pellet air-dried.

Bisulfite modification. DNA (1 µg) from PBLs and the amount of DNA obtained from two to four pubic hairs was used for the bisulfite modification. For hair samples, 1 µg of salmon sperm (Sigma, St. Louis, MO) was added as carrier before modification. Each sample in a volume of 50 µl was denatured by NaOH (final concentration, 0.2 M) for 10 min at 37 C. Thirty microliters of 10 mM hydroquinone (Sigma) and 520 µl of 3 M sodium bisulfite (Sigma) at pH 5, both freshly prepared, were added and mixed, and samples were incubated at 50 C for 16 h. Modified DNA was purified using the Wizard DNA purification resin according to the manufacturer (Promega, Madison, WI) and eluted into 50 µl of diethyl pyrocarbonate water. Modification was completed by NaOH (final concentration, 0.3 M) treatment for 5 min at room temperature, followed by ethanol precipitation. DNA samples from PBLs were resuspended in 50 µl of diethyl pyrocarbonate water (to have 20 ng/µl), while hair DNA in 25 µl to be used entirely in real-time PCR.

Real-time quantitative methylation-specific PCR

For the detection and quantitation of DNA methylation, we developed a real-time methylation-specific PCR system for the AR gene promoter region. For this purpose, we designed two different fluorogenic probes (minor groove binder) recognizing the bisulfite-converted unmethylated and methylated DNA, respectively. A set of specific primers flanking the region of interest was also used. The choice of the two probes was done after sequencing our control groups to check for their methylation pattern, and they were tested using unmethylated and methylated AR DNA controls. Following the TaqMan protocol, the reactions were prepared in triplicate using 100 ng of each DNA obtained from PBLs or two to four pubic hair samples and adding the following reagents at the following concentrations: 1x TaqMan Universal PCR Master Mix (Applied Biosystems), 150 nM of primers, and 100 nM of methylated and unmethylated probes. Reactions were started at 95 C for 10 min to activate AmpliTaq Gold DNA Polymerase (Promega) and were run for 50 cycles at 95 C for 15 sec and 60 C for 1 min. Multiple negative water blanks were included in every analysis. PCR amplification was performed using the ABI PRISM 7700 Sequence Detection System, and methylation percentage was calculated.

Hormone assays

Commercial kits were used for the measurement of serum DHT (RIA; Diagnostic Systems Laboratories, Webster, TX), DHEA-S (RIA; Diagnostic Products Corp., Los Angeles, CA), and E2 (RIA; Diagnostic Systems Laboratories). The latter is a third-generation, ultra-sensitive RIA with a sensitivity of 2.2 pmol/liter. Mean intra- and interassay coefficients of variation were 4.6% and 6.4% for DHT, 4.6% and 8.2% for DHEA-S, and 3.6% and 6.0% for E2, respectively. The sensitivity of the DHT and DHEA-S assays were 0.01 nmol/liter and 0.029 µmol/liter, respectively.

Statistical analysis

A power analysis was performed, and a sample size of 10 per group was found to be sufficient to detect a difference of 15 U between groups with a power greater than 0.80. All experiments were repeated on at least three independent occasions. Values are reported as mean ± SD. A test for normality was performed on all data. Statistical significance within each group was determined by the paired t test or the Mann-Whitney rank sum test, as appropriate. Comparisons among groups were performed using the one-way ANOVA followed by Scheffè’s multiple comparisons tests. The association between two variables was analyzed by Pearsons correlation coefficient. To test a cause-effect relationship between the percentage of the AR gene methylation and the age of the subjects, a linear regression analysis with the methylation as the dependent and the age as the independent variable was performed.


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Hormone serum levels

Hormone serum levels of the subjects studied are reported in Table 1Go. DHT blood concentrations in PP patients were significantly lower than in Tanner II girls, whereas DHEA-S blood levels were not different from those detected in both prepubertal and Tanner II girls. No differences in E2 serum levels were found among the groups of children studied.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Hormone serum levels in PP patients and in control children

 
CAG microsatellite analysis

The number of CAG repeats ranged from 16 to 26 and from 16 to 25 in normal children and PP patients, respectively (Fig. 1Go). The mean number of CAG repeats was significantly lower in PP patients than in normal children (prepubertal and Tanner stage II girls) (20.5 ± 2.1 vs. 21.4 ± 2.0, mean ± SD, P < 0.05), although it remained within the normal range for the general population (11–31) (6) in both groups. Examination of the allele distribution revealed that this difference was due to an excess of alleles with 20 repeats or less in the PP group (47% and 25% in PP and normal children, respectively), whereas the proportion of alleles longer than 23 repeats was higher in normal children than in PP patients (34% vs. 15%, respectively). The CAG repeats length was homozygous in 70% and 59% of PP patients and normal children, respectively, and heterozygous in 30% and 41% of PP patients and normal children, respectively.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. CAG repeats number PP patients and in normal children. A, Number of CAG repeats, including the short and long alleles of the AR gene from peripheral blood of PP patients and normal children. B, AR gene CAG repeats in peripheral blood of PP patients and normal children. Range and mean ± SD; *, P < 0.05.

 
DNA methylation analysis

PP patients exhibited an AR gene methylation in PBLs similar to that of Tanner stage II girls (47.9 ± 12.8 vs. 55.7 ± 12.6, PP patients vs. TII girls) (Fig. 2Go) and significantly lower than that of prepubertal children (47.9 ± 12.8 vs. 70.8 ± 8.1, PP patients vs. prepubertal children, P < 0.01). A negative correlation between the AR gene methylation status in PBLs and age of the normal subjects was found (r = –0.58, P < 0.005) (Fig. 3Go).


Figure 2
View larger version (10K):
[in this window]
[in a new window]
 
FIG. 2. Androgen receptor gene methylation in PBLs from prepubertal children, girls with Tanner stage II of pubertal development (TII), and PP patients. Mean ± SD; *, P < 0.01 vs. TII girls and PP patients. Methylation (%), Percentage of the methylated over the total amount of DNA.

 

Figure 3
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Linear regression analysis of AR methylation in PBLs and age of the normal children studied.

 
AR gene methylation in the hair follicles of the distinct subject groups showed that PP patients exhibit a methylation pattern similar to that of Tanner stage II girls (Fig. 4Go). No correlation between AR gene methylation status and age of the subjects was found in pubic hairs. Furthermore, no correlation between the methylation status, both in PBLs and hair follicles, and the hormonal levels was observed.


Figure 4
View larger version (8K):
[in this window]
[in a new window]
 
FIG. 4. Androgen receptor gene methylation in pubic hair from PP patients and girls with Tanner stage II of pubertal development (TII). Mean ± SD. Methylation (%), Percentage of the methylated over the total amount of DNA.

 
In all study groups, AR gene methylation pattern in PBLs was not different from that detected in the hair follicles. However, there was no correlation between PBLs and hair follicle AR gene methylation.


    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
PP is a condition characterized by the premature appearance of pubic hair without other signs of pubertal development whose precise etiology is still unknown (21, 22). Several pathogenetic theories have been proposed including early maturation of the zona reticularis (23, 24) and the preferential hyperphosphorylation of the enzyme P450c17 leading to increased androgen biosynthesis (25). We now show that an additional mechanism that may contribute to the development of PP is the higher androgen receptor sensitivity as indicated by shorter AR CAG repeat alleles and low AR gene methylation.

Exon 1 of AR, located on the X-chromosome, encodes for the transactivation domain and contains a large variable-length CAG repeat polymorphism encoding for glutamine residues in the amino terminus of the AR (11, 12). In vitro studies showed that progressive expansion of the repeat length in the AR was associated with a linear decrease in its transactivation function (13), and the resulting variation in androgen activity was related to a number of clinical consequences (14). In a recent study, shorter AR gene CAG number was reported in a Spanish female population with PP compared with normal women from the same area (19). Despite the wide population differences in AR CAG repeat distribution reported in the literature, the results of the present study in Italian PP patients and normal girls showing shorter AR gene CAG number in the patient group are similar to those reported in the Spanish patients, confirming the common Mediterranean origin of the two populations studied.

Methylation at regulatory regions, especially promoters, correlates with transcriptional activity: sequences near silent genes generally are methylated, whereas those near active regions are not. AR genes from patients with PP were less methylated, and thus more active, than those of prepubertal children of the same age and with the same serum steroid hormone levels and were similar to those of older children with the same degree of pubic hair development and higher steroid hormone concentrations. It can therefore be hypothesized that, in the presence of similar hormonal milieu, the presence of a more active receptor can be instrumental in the precocious appearance of pubic hair. This is in accordance with previous data on patients with idiopathic hirsutism in whom a preferential methylation of the longer AR allele, and thus inactivation of the functionally weaker gene, was demonstrated by a methylation analysis far less sensitive than the one used in the present study (18). In addition, in the present stud, AR gene methylation was also estimated, for the first time to our knowledge, in an androgen target tissue, such as the hair follicles. Obviously, such an analysis was performed only in the patient and Tanner II groups, as prepubertal children are devoid of pubic hair. The results obtained from the hair follicles confirmed what was shown in PBLs: that the AR gene in patients with PP is methylated to the same degree as in normal girls with Tanner II stage of pubertal development. Despite the similarities between the PBLs and the hair follicle data, the absence of a significant association between the AR gene methylation in PBLs and hair follicles indicates that the AR gene activity in PBLs does not necessarily represent the one at the target tissue, and methylation patterns in the two tissues are not constitutionally the same. Therefore, the results obtained in different tissues are not directly comparable.

The negative correlation between the age of the children and the methylation pattern in PBLs detected in the present study suggests an age-dependent modulation of the gene methylation that seems independent of steroid hormone levels, as a correlation between AR gene methylation and circulating steroid hormone levels was not found. An age-specific variation of X-chromosome inactivation was previously described in a group of normal women from various age groups (27). The causes of age-related methylation are still unknown, although evidence points to an interplay between local predisposing factors in DNA (methylation centers), levels of gene expression, and environmental exposure (28). Recently it was shown that AR mRNA expression and its promoter methylation are inversely regulated by sex steroid hormones in the adult mice brain cortex (29). A correlation between AR gene methylation and circulating steroid hormone levels was not found in the present study, suggesting that AR gene methylation might be independent of steroid levels. However, such a conclusion must be validated by a full spectrum of hormone values. Regardless of the pathogenetic mechanism, the presence of an AR gene less active in prepubertal than in pubertal children suggests that a change in the methylation pattern of the gene may be one of the factors involved in the normal development of pubic hair. The different gene methylation in the PP group compared with normal children of the same age corroborates this hypothesis.

In conclusion, because methylation at regulatory regions correlates negatively with transcriptional activity, the reduced AR gene methylation pattern observed in PP patients indicates that the AR gene is more active in the patients than in normal prepubertal children. The increased AR gene activity together with the presence of shorter CAG repeats number in PP patients might lead to hypersensitivity of the hair follicles and therefore to the premature development of pubic hair. The causes for the distinct AR gene methylation pattern are presently unknown and deserve further investigation.


    Acknowledgments
 
We are grateful to Dr. Maurizio Rossi from the "Dipartimento di Scienze della Formazione e del Territorio" for statistical assistance. We also thank Mrs. Loredana Arvasi, Cristina Colombini, and Aurelia Pantaleo for their technical support.


    Footnotes
 
First Published Online January 10, 2006

1 A.V. and M.C. contributed equally to the study. Back

Abbreviations: AR, Androgen receptor; DHEA, dehydroepiandrosterone; DHEA-S, DHEA-sulfate; DHT, dihydrotestosterone; E2, estradiol; PBL, peripheral blood leukocyte; PP, premature pubarche.

A.V., M.C., S.G., I.V., M.Z., T.M.N., S.B., and L.G. have nothing to declare.

Received October 26, 2005.

Accepted December 27, 2005.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  2. Kremer EJ, Pritchard M, Lynch M, Yu S, Holman K, Baker E, Warren ST, Schlessinger D, Sutherland GR, Richards RI 1991 Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CCG)n. Science 252:1711–1714[Abstract/Free Full Text]
  3. Verkerk AJ, Pieretti M, Sutcliffe JS, Fu YH, Kuhl DP, Pizzuti A, Reiner O, Richards S, Victoria MF, Zhang FP 1991 Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell 65:905–914[CrossRef][Medline]
  4. Fu YH, Pizzuti A, Fenwick RGJ, King J, Rajnarayan S, Dunne PW, Dubel J, Nasser GA, Ashizawa T, de Jong P 1992 An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science 255:1256–1258[Abstract/Free Full Text]
  5. Choong CS, Wilson EM 1998 Trinucleotide repeats in the human androgen receptor: a molecular basis for disease. J Mol Endocrinol 21:235–257[CrossRef][Medline]
  6. Schoenberg MP, Hakimi JM, Wang S, Bova GS, Epstein JI, Fischbeck KH, Isaacs WB, Walsh PC, Barrack ER 1994 Microsatellite mutation (CAG24->18) in the androgen receptor gene in human prostate cancer. Biochem Biophys Res Commun 198:74–80[CrossRef][Medline]
  7. Hardy DO, Scher HI, Bogenreider T, Sabbatini P, Zhang ZF, Nanus DM, Catterall JF 1996 Androgen receptor CAG repeat lengths in prostate cancer: correlation with age of onset. J Clin Endocrinol Metab 81:4400–4405[Abstract]
  8. Coetzee GA, Ross RK 1994 Re: Prostate cancer and the androgen receptor. J Natl Cancer Inst 86:872–873[Free Full Text]
  9. Irvine RA, Yu MC, Ross RK, Coetzee GA 1995 The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Res 55:1937–1940[Abstract/Free Full Text]
  10. Gelmann EP 2002 Molecular biology of the androgen receptor. J Clin Oncol 20:3001–3015[Abstract/Free Full Text]
  11. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH 1991 Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352:77–79[CrossRef][Medline]
  12. Lee DK, Chang C 2003 Endocrine mechanisms of disease: Expression and degradation of androgen receptor: mechanism and clinical implication. J Clin Endocrinol Metab 88:4043–4054[Abstract/Free Full Text]
  13. Chamberlain NL, Driver ED, Miesfeld RL 1994 The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Res 22:3181–3186[Abstract/Free Full Text]
  14. Beilin J, Ball EM, Favaloro JM, Zajac JD 2000 Effect of the androgen receptor CAG repeat polymorphism on transcriptional activity: specificity in prostate and non-prostate cell lines. J Mol Endocrinol 25:85–96[Abstract]
  15. Bird A 1992 The essentials of DNA methylation. Cell 70:5–8[CrossRef][Medline]
  16. Rizwana R, Hahn PJ 1999 CpG methylation reduces genomic instability. J Cell Sci 112:4513–4519[Abstract]
  17. Esteller M, Corn PG, Baylin SB, Herman JG 2001 A gene hypermethylation profile of human cancer. Cancer Res 61:3225–3229[Abstract/Free Full Text]
  18. Vottero A, Stratakis CA, Ghizzoni L, Longui CA, Karl M, Chrousos GP 1999 Androgen receptor-mediated hypersensitivity to androgens in women with nonhyperandrogenic hirsutism: skewing of X-chromosome inactivation. J Clin Endocrinol Metab 84:1091–1095[Abstract/Free Full Text]
  19. Ibanez L, Ong KK, Mongan N, Jaaskelainen J, Marcos MV, Hughes IA, de Zegher F, Dunger DB 2003 Androgen receptor gene CAG repeat polymorphism in the development of ovarian hyperandrogenism. J Clin Endocrinol Metab 88:3333–3338[Abstract/Free Full Text]
  20. Calvo RM, Asuncion M, Sancho J, San Millan JL, Escobar-Morreale HF 2000 The role of the CAG repeat polymorphism in the androgen receptor gene and of skewed X-chromosome inactivation, in the pathogenesis of hirsutism. J Clin Endocrinol Metab 85:1735–1740[Abstract/Free Full Text]
  21. Ghizzoni L, Mastorakos G, Vottero A 1999 Adrenal hyperandrogenism in children. J Clin Endocrinol Metab 84:4431–4435[Free Full Text]
  22. Saenger P, Dimartino-Nardi J 2001 Premature adrenarche. J Endocrinol Invest 24:724–733[Medline]
  23. Pang SY 1984 Premature pubarche. Pediatr Adolesc Endocrinol 13:173–184
  24. Voutilainen R, Perheentupa J, Apter D 1983 Benign premature adrenarche: clinical features and serum steroid levels. Acta Paediatr Scand 72:707–711[Medline]
  25. Zhang LH, Rodriguez H, Ohno S, Miller WL 1995 Serine phosphorylation of human P450c17 increases 17,20-lyase activity: implications for adrenarche and the polycystic ovary syndrome. Proc Natl Acad Sci USA 92:10619–10623[Abstract/Free Full Text]
  26. Rosenfield RL 1996 The ovary and female sexual maturation. In: Sperling MA, ed. Pediatric endocrinology. 1st ed. Philadelphia: W.B. Saunders Co.; 330–385
  27. Sharp A, Robinson D, Jacobs P 2000 Age- and tissue-specific variation of X chromosome inactivation ratios in normal women. Hum Genet 107:343–349[CrossRef][Medline]
  28. Ahuja N, Issa JP 2000 Aging, methylation and cancer. Histol Histopathol 15:835–842[Medline]
  29. Kumar RC, Thakur MK 2004 Androgen receptor mRNA is inversely regulated by testosterone and estradiol in adult mouse brain. Neurobiol Aging 25:925–933[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
H. H Ortega, N. R Salvetti, and V. Padmanabhan
Developmental programming: prenatal androgen excess disrupts ovarian steroid receptor balance
Reproduction, May 1, 2009; 137(5): 865 - 877.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
P. Utriainen, R. Voutilainen, and J. Jaaskelainen
Continuum of phenotypes and sympathoadrenal function in premature adrenarche
Eur. J. Endocrinol., April 1, 2009; 160(4): 657 - 665.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Lappalainen, P. Utriainen, T. Kuulasmaa, R. Voutilainen, and J. Jaaskelainen
Androgen Receptor Gene CAG Repeat Polymorphism and X-Chromosome Inactivation in Children with Premature Adrenarche
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1304 - 1309.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vottero, A.
Right arrow Articles by Ghizzoni, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vottero, A.
Right arrow Articles by Ghizzoni, L.
Related Collections
Right arrow Male Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals