| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Cardiology Y, Bispebjerg Hospital (T.S.H., H.D., N.I., A.M.-P., D.B.N., C.T.-P.), 2400 Copenhagen, Denmark; Division of Endocrinology and Diabetes Research and Training Center, Albert Einstein College of Medicine (W.L., M.H.), Bronx, New York 10461; Section on Vascular Cell Biology and Complications, Joslin Diabetes Center (C.R.-M.), Boston, Massachusetts 02215; Department of Clinical Biochemistry, Gentofte University Hospital (K.W.H.), DK-2900 Gentofte, Denmark; and Department of Cardiology B, Rigshospitalet Heart Center (L.K.), DK-2100 Copenhagen, Denmark
Address all correspondence and requests for reprints to: Dr. Thomas S. Hermann, Bispebjerg University Hospital, Y-forskning, bygning 40, Bispebjerg Bakke 23, 2400 Copenhagen, Denmark. E-mail: th{at}heart.dk.
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Methods: Twenty-four type 2 diabetic subjects were randomized to receive 2 months of quinapril 20 mg daily or no treatment in an open parallel study. Endothelium-dependent and -independent vasodilation was studied during serotonin or sodium nitroprusside infusion in the diabetic patients and in 15 healthy subjects. Endothelial function, insulin-stimulated endothelial function, and insulin-stimulated glucose uptake were measured before and after quinapril treatment. Blood flow was measured by venous occlusion plethysmography. Gene expression was measured by real-time PCR.
Results: Quinapril treatment increased insulin-stimulated endothelial function in the type 2 diabetic subjects (P = 0.005), whereas forearm glucose uptake was unchanged. Endothelial function was also increased by quinapril (P = 0.001). Systolic and diastolic blood pressures were reduced by quinapril (P < 0.001). Quinapril increased adiponectin gene expression in vascular tissue obtained from sc adipose biopsies.
Conclusions: Quinapril treatment increases insulin-stimulated endothelial function in patients with type 2 diabetes. Increased vascular adiponectin gene expression may contribute to this beneficial effect.
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
ACE inhibition is associated with a lower rate of new-onset type 2 diabetes in high-risk patients with cardiovascular disease (10, 11). Some physiological studies support the concept that ACE inhibition might prevent type 2 diabetes by improving whole-body insulin sensitivity (12, 13, 14), whereas others have shown that ACE inhibition has no effect on insulin sensitivity (15, 16).
Angiotensin II is suggested to induce insulin resistance (17), whereas antagonism of angiotensin II ameliorates insulin resistance (18). The beneficial effects of ACE inhibition on both endothelial function and insulin resistance could be explained by increased plasma levels of adiponectin (19). Indeed, this adipose-derived circulating protein improves insulin action in conscious mice, and its levels are tightly correlated with insulin sensitivity in animals and humans (20). Hypoadiponectinemia is associated with endothelial dysfunction (21), and adiponectin increases nitric oxide production in endothelial cells (22, 23). Given these observations, we hypothesized that treatment with quinapril would increase insulin stimulated forearm glucose uptake and insulin-stimulated endothelial function. Furthermore, because ACE inhibitors increase adiponectin levels and the latter have favorable effects on insulin action, we examined the impact of quinapril on adiponectin gene expression in patients with type 2 diabetes.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The study was approved by the local ethical committee and the Danish Medicines Agency. Participants gave their written informed consent. All measurements in this study were performed blinded to the treatment protocol.
All studies were started at 0800 h after an 8-h overnight fast, which included abstinence from smoking. Experimental procedures and measurement of blood flow was performed as previously described (3). Blood flow was measured by venous occlusion plethysmography. Assessment of forearm vascular function was performed by separately stimulation of endothelium-dependent vasodilation and endothelium-independent vasodilation. Both measures are necessary for the measurement of vascular function and are also suitable for the evaluation of action and effect of cardiovascular drugs. In the current study, endothelial nitric oxide (NO) production was stimulated by infusion of serotonin. Serotonin is an agonist of endothelial NO production and is highly NO specific. Endothelium-independent vasodilation (vascular smooth muscle relaxation) was tested by infusion of sodium nitroprusside, which acts as an external NO donor in vascular smooth muscle cells. Local insulin infusion in the brachial artery for 60 min was used. Blood flow was expressed as (milliliters per 100 ml forearm per minute). Insulin stimulation of endothelium-dependent vasodilation was calculated as percent increase in blood flow from the serotonin response.
For the study of gene expression of ACE, adiponectin, insulin receptor substrate (IRS)-1, phosphatidylinositol 3 (PI 3)-kinase, and Akt-1 during quinapril treatment, vascular tissue was isolated from sc fat biopsies, obtained from the study subjects before and after the 2 months. The isolation of vascular tissue from adipose tissue was performed as described by Jiang (24). After isolation, the vascular tissue was immediately frozen in liquid nitrogen and stored at –80 C.
From the biopsy samples obtained as described above, total RNA was extracted and gene expression was measured by real-time PCR as previously described (25). Primers used were as follows: glyceraldehyde-3-phosphate dehydrogenase forward, TCGGAGTCAACGGATTTG, reverse, GCATCGCCCCACTTGATT; adiponectin forward, GGTGGGCTCCTTACAGAACA, reverse, TTCAAAGCATCACAGGACCA; IRS-1 forward, AGTCCCAGCACCAACAGAAC, reverse, TCATCCGAGGAGATGAAACC; Akt-1 forward, CCCTTCTACAACCAGGACCA, reverse, ACACGATACCGGCAAAGAAG; PI 3-kinase forward, TCATATTGACTTCGGGCACA, reverse, TCAGCATCATGGAGAACAGG; and ACE forward, TTGACAAGATCGCCTTTATCC, reverse, GTAAGGCACGCTAGAAGGAAT.
Results are expressed as fold change in gene expression by determining the ratio of copy number of the gene of interest in a given individual after quinapril vs. placebo treatment, corrected for expression of glyceraldehyde-3-phosphate dehydrogenase in the samples. Vascular tissue was obtained from six subjects in the type 2 diabetic treatment group and two subjects in the type 2 diabetic control group. The purity of the isolated vascular stroma was assessed by light microscopy after staining with hematoxylin and eosin and also immunohistochemical staining with CD34.
Infusion protocol
In the study of endothelium-dependent vasodilation, incremental doses of serotonin (7, 21, and 70 ng/min; Clinalfa, Läufelfingen, Switzerland) were infused (Fig. 1
). Each dose was infused for 5 min to obtain a stable blood flow. After at least 30 min washout of serotonin, when blood flow had returned to baseline, the effect of insulin on endothelium-independent vasodilation was assessed by infusion of the NO donor sodium nitroprusside (Nitropress, Abbott Laboratories, North Chicago, IL) in doses of 0.5, 1, and 1.5 µg/min. The doses were chosen from previous experience in attempt to match flow levels induced by serotonin. The sodium nitroprusside studies were performed in all study subjects. Insulin-stimulated endothelial function was assessed by intraarterial insulin infusion [Actrapid (Novo Nordisk Scandinavia, Malmö, Sweden) in 1% human albumin solution (vehicle)] at a rate of 0.05 mU x kg body weight–1 x min–1. Insulin was continuously infused for 60 min, and a dose response study of serotonin was subsequently performed immediately afterward.
|
Glucose uptake and measurement of insulin concentration
Blood samples were drawn simultaneously from the artery and vein in the infused arm. The plasma concentration of glucose was determined by the glucose oxidase method (Vitros; Johnson & Johnson, New Brunswick, NJ), and serum insulin concentration was determined by a microparticle enzyme immunoassay (Axsym Insulin B2D010; Abbott). Insulin-stimulated glucose uptake in the forearm was calculated as previously described (26). Glucose uptake was assessed every 10 min during insulin infusion. During the oral glucose challenge, blood samples for measurement of plasma glucose and serum insulin were collected at time 0, 15, 30, 60, and 120 after digestion of 75 g glucose.
The concentration of adiponectin was determined by RIA (human adiponectin RIA kit, Linco Research, St. Charles, MO).
Statistical analyses
Comparison of blood flow values were performed with mixed models using the PROC MIXED procedure in the Statistical Analysis Software (version 8.2; SAS Institute, Cary, NC). For studies of blood flow, logarithmic transformation of flow was used to satisfy the model assumption (homogeneity of variance). The dose-response studies entered the model as fixed effects as did the interaction between dose-response study and dose of vasodilator. Study subject and the interaction between study subject and dose of vasodilator entered the model as random effects. The level of statistical significance was chosen as P 
0.05 (two-sided test). Continuous variables were normally distributed and are presented as means ± SD (in figures as mean and SEM).
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Characteristics are shown in Table 1. Type 2 diabetic subjects had significant higher fasting plasma glucose, fasting serum insulin, C-reactive protein (CRP) concentration, and systolic blood pressure than the healthy controls. No significant change in the CRP or adiponectin concentration was seen in the type 2 diabetic treatment group or the type 2 diabetic control group during the study.
|
Systolic and diastolic blood pressure was reduced significantly (systolic blood pressure: P < 0.0001 after vs. before; diastolic blood pressure P < 0.0001 after vs. before) in the type 2 diabetic treatment group (Fig. 2). In the type 2 diabetic control subjects, systolic blood pressure was not altered, whereas a significant reduction in diastolic blood pressure was observed (P < 0.0001; Fig. 2). Dose-response studies of serotonin and sodium nitroprusside did not cause significant changes in systolic blood pressure or diastolic blood pressure. Heart rate was not changed in the type 2 diabetic treatment group or the type 2 diabetic control group (Table 1
), and the heart rate was also unchanged during dose-response studies of serotonin and sodium nitroprusside and during insulin infusion.
|
Fasting plasma glucose was not altered in the type 2 diabetic treatment group (before = 10.8 ± 2.7 mM vs. after = 9.8 ± 1.9 mM, NS). Fasting serum insulin concentration did not change (before = 18.5 ± 12.8 mU/liter vs. after = 16.7 ± 9.3 mU/liter, NS). In the type 2 diabetic control group, no significant change in fasting plasma glucose (before = 9.5 ± 3.4 mM vs. after = 8.3 ± 1.7 mM, NS) or fasting serum insulin (before = 15.0 ± 9.6 mU/liter vs. after = 14.5 ± 10.2 mU/liter, NS) was seen.
Quinapril treatment changed neither the plasma glucose concentration (before = 17.2 ± 2.7 mM vs. after = 17.2 ± 2.2 mM, NS) nor the serum insulin concentration (before = 41.8 ± 25.7 mU/liter vs. after = 42.4 ± 23.8 mU/liter, NS) at 2 h after the challenge. Quinapril treatment did not cause significant changes in plasma glucose or serum insulin concentration 15, 30, or 60 min after the challenge. In the type 2 diabetic control group, no significant changes were seen in the postchallenge values of glucose or insulin during the 2 months.
Endothelium-dependent and -independent vasodilation
Subjects with type 2 diabetes had a significantly lower serotonin response than healthy controls (Fig. 3A). Baseline blood flow was not increased by quinapril treatment (before = 1.75 ± 0.40 vs. after = 1.89 ± 0.71 ml per 100 ml per minute, P = 0.4). The serotonin response was increased significantly, by an average of 16.5% at all three dose levels, P = 0.001 vs. pretreatment (Fig. 3A). Endothelium-independent vasodilation, assessed during sodium nitroprusside infusion (Fig. 3B), was lower in the type 2 diabetic subjects than the healthy controls but the sodium nitroprusside response was unchanged by quinapril treatment (P = 0.8 before vs. after treatment). The sodium nitroprusside response was also unchanged in the type 2 diabetic control group. At the beginning the sodium nitroprusside response was 2.31 ± 0.72 (dose 1), 5.00 ± 1.73 (dose 2), and 7.41 ± 3.04 (dose 3), and after the 2 months, the response was 2.03 ± 0.71 (dose 1), 5.60 ± 3.00 (dose 2), and 7.95 ± 2.06 (dose 3).
|
The insulin-stimulated serotonin response was markedly reduced in the subjects with type 2 diabetes, compared with the healthy control group (Fig. 4A). Quinapril treatment increased the insulin-stimulated serotonin response significantly (Fig. 4A; P < 0.001 vs. pretreatment). To correct for the increase in endothelium-dependent vasodilation during treatment, we calculated the percentage increase in serotonin response by insulin. After this correction, insulin-stimulated endothelial function was still significantly increased after 2 months of quinapril treatment (Fig. 4B; P = 0.005 after treatment vs. before treatment). The degree of NO-mediated vasodilation during insulin-serotonin infusion was assessed during coinfusion of L-NMMA. The blood flow increase induced by serotonin-insulin coinfusion was abolished by L-NMMA infusion. Before quinapril, blood flow during the serotonin-insulin-L-NMMA coinfusion was 1.55 ± 0.42 (dose 1), 1.83 ± 0.52 (dose 2), and 1.83 ± 0.65 (dose 3), which was not altered after quinapril treatment: 1.85 ± 0.25 (dose 1), 1.86 ± 0.16 (dose 2), and 1.93 ± 0.26 (dose 3) (P = 0.4 after treatment vs. before treatment).
|
Insulin-stimulated forearm glucose uptake
Forearm glucose uptake was assessed during 60 min of intraarterial insulin infusion. Local serum insulin was increased from 9.8 ± 6.0 to 251.2 ± 86.2 mU/liter after 10 min of insulin infusion (P < 0.0001). Local serum insulin concentration at 30 min infusion was 252.1 ± 77.7, and after 60 min insulin infusion concentration was 259.7 ± 85.8 mU/liter. During the 60 min intraarterial insulin infusion, no change in systemic insulin was seen. In the type 2 diabetic treatment group, systemic serum insulin was 11.2 ± 7.2 mU/liter before insulin infusion and was 12.6 ± 8.3 mU/liter after 60 min insulin (P = 0.6) Baseline and insulin-stimulated forearm glucose uptake was not altered by quinapril treatment (Fig. 5).
|
Quinapril treatment increased the gene expression ratio of adiponectin in the vascular tissue by 2-fold, from 0.150 ± 0.058 before to 0.350 ± 0.205 after treatment (P = 0.048 before vs. after). In the control group, samples from only two subjects were available. In this group adiponectin expression was 0.153 ± 0.118 before and 0.191 ± 0.159 after 2 months. Gene expression of IRS-1 (before = 0.060 ± 0.054 vs. after quinapril = 0.030 ± 0.004, NS), Akt-1 (before = 0.069 ± 0.044 vs. after quinapril = 0.043 ± 0.035, NS), and PI 3-kinase (before = 0.0011 ± 0.0007 vs. after quinapril = 0.0010 ± 0.0008, NS) was unchanged by quinapril. The expression of the ACE gene was not significantly changed (before = 0.031 ± 0.027 vs. after quinapril = 0.021 ± 0.008, NS).
In adipose tissue, relative gene expression of adiponectin was 25-fold higher than the expression ratio seen in vascular tissue. Adiponectin gene expression was unchanged by quinapril in adipose tissue, from 3.69 ± 0.57 before quinapril to 3.45 ± 0.68 after quinapril (NS).
|
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The vascular system in patients with insulin resistance and type 2 diabetes is characterized by endothelial dysfunction (2). The improvement in endothelial function with ACE inhibition in our study is consistent with observations in diverse patient populations, including type 1 or type 2 diabetes, coronary heart disease, or heart failure (4, 5, 27, 28). Type 2 diabetic patients have increased plasma concentration and also increased endogenous activity of the potent vasoconstrictor endothelin-1 (29, 30). There is existing evidence that endothelin-1 is reduced by ACE inhibition (6, 29), which could be one explanation for the observed increase in endothelial function. Also, ACE inhibition reduces the concentration of the endogenous NO synthase inhibitor asymmetric dimethylarginine in type 2 diabetic patients (31), which could facilitate NO-dependent vasodilation. In our study we did not observe any change in endothelium-independent vasodilation, suggesting that the smooth muscle cell sensitivity to NO was not increased.
We studied the effect of quinapril in subjects with type 2 diabetes with a high incidence of smoking. Patients with type 2 diabetes have increased oxidant stress, which is also present in smokers. Because ACE inhibitors are known to reduce oxidant stress (32), this could also mediate some beneficial effect on NO-mediated endothelial function in the current study. However, we did not measure markers of oxidative stress.
In this study the insulin-stimulated serotonin response was significant increased and was also significant increased after adjustment for the enhancement of the serotonin response by quinapril. Furthermore, blood flow during insulin-serotonin coinfusion was inhibited by L-NMMA before and after quinapril treatment, which indicates that insulin-stimulated vasodilation was mediated by NO and that the observed increase in insulin-stimulated vasodilation during quinapril treatment was also mediated by NO.
It is well acknowledged that insulin causes enhancement of endothelial-dependent vasodilation in resistance vessels (33) and increases capillary recruitment in healthy subjects (34). In resistance vessels, insulin stimulates vasodilation by stimulating IRS-1-associated PI 3-kinase activity, which is followed by activation of Akt and an increase in the activity of endothelial nitric oxide synthase (35). This pathway is blunted in vascular tissue in an animal model of insulin resistance (24). In type 2 diabetic subjects receiving hypoglycemic drug therapy, improvement of whole-body insulin sensitivity and insulin-stimulated vasodilation occurs within the same time range (3, 36), and therefore, a relation is suggested to exist. In our study no change in forearm glucose uptake or whole-body glucose uptake was seen, whereas insulin-stimulated vasodilation was significantly increased. This indicates that a change in insulin-stimulated vasodilation is not necessarily preceded or accompanied by an increase in whole-body insulin sensitivity. Of note, our studies did not include a euglycemic hyperinsulinemic clamp, and therefore, it is possible that we may not have been able to detect subtle changes in whole-body glucose uptake. However, because both the forearm glucose uptake and the glucose and insulin responses to the oral glucose challenge remained unchanged during quinapril treatment, further intensive studies of glucose metabolism do not appear to be warranted. The lack of an effect on glucose metabolism by quinapril could be due to the dosage or an insufficient duration of treatment. In a study with captopril, the effect on glucose metabolism was seen already after 2 d of treatment (12). However, the dosage used in the current study may have permitted the detection of a discrepancy among responses by tissue type.
Adiponectin gene expression was increased in vascular biopsies from the quinapril-treated subjects, whereas no change was seen in gene expression of IRS-1, PI 3-kinase, or Akt-1. Adiponectin is abundantly expressed in adipose tissue in humans and is present in a high concentration in plasma. Subjects with obesity and type 2 diabetes have a lower plasma level of adiponectin than healthy subjects (37). A low concentration of adiponectin is closely correlated to impairment of endothelial function in healthy humans (21) and patients with diabetes (38). The effect of adiponectin on the endothelium is suggested to be mediated by its ability to stimulate NO (22). Disruption of the adiponectin gene causes disruption of IRS-1-associated PI 3-kinase activity, whereas viral-mediated reconstitution of adiponectin expression is able to reverse insulin resistance (39). ACE inhibition increases plasma levels of adiponectin in insulin-resistant subjects (19). One study has shown that adiponectin gene expression is not exclusively confined to adipose tissue but is also inducible in muscle cells (40).
We therefore suggest that the increase in adiponectin gene expression in vascular tissue may contribute to the observed increase in insulin-stimulated endothelial function in our study because the increased availability of adiponectin may enhance endothelial nitric oxide synthase activation in the endothelium. We observed a 25-fold higher relative expression of adiponectin in adipose tissue than in the vascular tissue, yet no change was seen with quinapril. Because adipose tissue is the predominant source of circulating adiponectin, the change in vascular adiponectin gene expression in our study is therefore not suggested to affect the systemic adiponectin concentration, which was also confirmed. Of note, enhanced expression of adiponectin in adipose tissue has been correlated with an increased concentration of circulating adiponectin and improved systemic insulin action (25).
Another possible mechanism for the effect of ACE inhibition could be inhibition of angiotensin II. Angiotensin II increases serine phosphorylation of the insulin receptor and could impair insulin’s effect on endothelial nitric oxide synthase. This mechanism may collaborate the beneficial effects of ACE inhibition on insulin-stimulated endothelial function in our study and whole-body insulin sensitivity shown by other groups (12, 13).
In conclusion, this study demonstrates that quinapril increases endothelial function and insulin-stimulated endothelial function without changing insulin-stimulated muscle glucose uptake in patients with type 2 diabetes. These observations, in the absence of effects on systemic insulin action, indicate tissue-specific insulin sensitizing actions of quinapril.
|
Footnotes |
|---|
Abbreviations: ACE, Angiotensin-converting enzyme; CRP, C-reactive protein; IRS, insulin receptor substrate; L-NMMA, NG-monomethyl-L-arginine; NO, nitric oxide; PI 3, phosphatidylinositol 3.
This work was supported by The Danish Heart Foundation and the Danish Diabetes Association.
Received June 1, 2005.
Accepted December 1, 2005.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  K. Kohlstedt, C. Gershome, C. Trouvain, W.-K. Hofmann, S. Fichtlscherer, and I. Fleming Angiotensin-Converting Enzyme (ACE) Inhibitors Modulate Cellular Retinol-Binding Protein 1 and Adiponectin Expression in Adipocytes via the ACE-Dependent Signaling Cascade Mol. Pharmacol., March 1, 2009; 75(3): 685 - 692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Muniyappa, G. Hall, T. L Kolodziej, R. J Karne, S. K Crandon, and M. J Quon Cocoa consumption for 2 wk enhances insulin-mediated vasodilatation without improving blood pressure or insulin resistance in essential hypertension Am. J. Clinical Nutrition, December 1, 2008; 88(6): 1685 - 1696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Patel, A. Flyvbjerg, M. Kozakova, J. Frystyk, I. M. Ibrahim, J. R. Petrie, P. J. Avery, E. Ferrannini, M. Walker, and the RISC Investigators Variation in the ADIPOQ gene promoter is associated with carotid intima media thickness independent of plasma adiponectin levels in healthy subjects Eur. Heart J., February 1, 2008; 29(3): 386 - 393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Muniyappa, M. Montagnani, K. K. Koh, and M. J. Quon Cardiovascular Actions of Insulin Endocr. Rev., August 1, 2007; 28(5): 463 - 491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Koh, M. J. Quon, Y. Lee, S. H. Han, J. Y. Ahn, W.-J. Chung, J.-a Kim, and E. K. Shin Additive beneficial cardiovascular and metabolic effects of combination therapy with ramipril and candesartan in hypertensive patients Eur. Heart J., June 2, 2007; 28(12): 1440 - 1447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J Hamilton, G. T Chew, and G. F Watts Therapeutic regulation of endothelial dysfunction in type 2 diabetes mellitus Diabetes and Vascular Disease Research, June 1, 2007; 4(2): 89 - 102. [Abstract] [PDF]
|
|
|
|
 |
|
 A. T. Lely, J. A. Krikken, S. J. L. Bakker, F. Boomsma, R. P. F. Dullaart, B. H. R. Wolffenbuttel, and G. Navis Low Dietary Sodium and Exogenous Angiotensin II Infusion Decrease Plasma Adiponectin Concentrations in Healthy Men J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1821 - 1826. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Potenza, F. L. Marasciulo, M. Tarquinio, M. J. Quon, and M. Montagnani Treatment of Spontaneously Hypertensive Rats With Rosiglitazone and/or Enalapril Restores Balance Between Vasodilator and Vasoconstrictor Actions of Insulin With Simultaneous Improvement in Hypertension and Insulin Resistance Diabetes, December 1, 2006; 55(12): 3594 - 3603. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
