help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism, doi:10.1210/jc.2005-1231
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/3/1001    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hermann, T. S.
Right arrow Articles by Torp-Pedersen, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hermann, T. S.
Right arrow Articles by Torp-Pedersen, C.
Related Collections
Right arrow Cardiovascular Endocrinology
Right arrow Diabetes and Insulin
Right arrow Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 3 1001-1008
Copyright © 2006 by The Endocrine Society

Quinapril Treatment Increases Insulin-Stimulated Endothelial Function and Adiponectin Gene Expression in Patients with Type 2 Diabetes

Thomas S. Hermann, Weijie Li, Helena Dominguez, Nikolaj Ihlemann, Christian Rask-Madsen, Atheline Major-Pedersen, Dorthe Baunbjerg Nielsen, Kaj Winther Hansen, Meredith Hawkins, Lars Kober and Christian Torp-Pedersen

Department of Cardiology Y, Bispebjerg Hospital (T.S.H., H.D., N.I., A.M.-P., D.B.N., C.T.-P.), 2400 Copenhagen, Denmark; Division of Endocrinology and Diabetes Research and Training Center, Albert Einstein College of Medicine (W.L., M.H.), Bronx, New York 10461; Section on Vascular Cell Biology and Complications, Joslin Diabetes Center (C.R.-M.), Boston, Massachusetts 02215; Department of Clinical Biochemistry, Gentofte University Hospital (K.W.H.), DK-2900 Gentofte, Denmark; and Department of Cardiology B, Rigshospitalet Heart Center (L.K.), DK-2100 Copenhagen, Denmark

Address all correspondence and requests for reprints to: Dr. Thomas S. Hermann, Bispebjerg University Hospital, Y-forskning, bygning 40, Bispebjerg Bakke 23, 2400 Copenhagen, Denmark. E-mail: th{at}heart.dk.


    Abstract
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Objective: Angiotensin-converting enzyme inhibitors reduce cardiovascular mortality and improve endothelial function in type 2 diabetic patients. We hypothesized that 2 months of quinapril treatment would improve insulin-stimulated endothelial function and glucose uptake in type 2 diabetic subjects and simultaneously increase the expression of genes that are pertinent for endothelial function and metabolism.

Methods: Twenty-four type 2 diabetic subjects were randomized to receive 2 months of quinapril 20 mg daily or no treatment in an open parallel study. Endothelium-dependent and -independent vasodilation was studied during serotonin or sodium nitroprusside infusion in the diabetic patients and in 15 healthy subjects. Endothelial function, insulin-stimulated endothelial function, and insulin-stimulated glucose uptake were measured before and after quinapril treatment. Blood flow was measured by venous occlusion plethysmography. Gene expression was measured by real-time PCR.

Results: Quinapril treatment increased insulin-stimulated endothelial function in the type 2 diabetic subjects (P = 0.005), whereas forearm glucose uptake was unchanged. Endothelial function was also increased by quinapril (P = 0.001). Systolic and diastolic blood pressures were reduced by quinapril (P < 0.001). Quinapril increased adiponectin gene expression in vascular tissue obtained from sc adipose biopsies.

Conclusions: Quinapril treatment increases insulin-stimulated endothelial function in patients with type 2 diabetes. Increased vascular adiponectin gene expression may contribute to this beneficial effect.


    Introduction
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
INHIBITORS OF ANGIOTENSIN-converting enzyme (ACE) reduce the incidence of cardiovascular disease in patients with type 2 diabetes (1). Endothelial dysfunction, an early marker of cardiovascular disease, is present in patients with insulin resistance and type 2 diabetes, and these patients also have impaired insulin-stimulated endothelial function, compared with lean healthy subjects (2, 3). Consequently, reversal of endothelial dysfunction may be important for the prevention of cardiovascular events. ACE inhibition improves endothelial function in patients with types 1 and 2 diabetes by a nitric oxide-dependent mechanism (4, 5). In vivo studies have demonstrated that ACE inhibition decreases the concentration of the vasoconstrictor endothelin-1 (6) and increases the gene expression of endothelial nitric oxide synthase in vascular tissue (7). ACE inhibition reduces the degree of atherosclerosis in a diabetic rat model with accelerated atherosclerosis (8) and inhibits atherosclerosis in type 2 diabetic patients, measured by reduced carotid intima-media thickness (9).

ACE inhibition is associated with a lower rate of new-onset type 2 diabetes in high-risk patients with cardiovascular disease (10, 11). Some physiological studies support the concept that ACE inhibition might prevent type 2 diabetes by improving whole-body insulin sensitivity (12, 13, 14), whereas others have shown that ACE inhibition has no effect on insulin sensitivity (15, 16).

Angiotensin II is suggested to induce insulin resistance (17), whereas antagonism of angiotensin II ameliorates insulin resistance (18). The beneficial effects of ACE inhibition on both endothelial function and insulin resistance could be explained by increased plasma levels of adiponectin (19). Indeed, this adipose-derived circulating protein improves insulin action in conscious mice, and its levels are tightly correlated with insulin sensitivity in animals and humans (20). Hypoadiponectinemia is associated with endothelial dysfunction (21), and adiponectin increases nitric oxide production in endothelial cells (22, 23). Given these observations, we hypothesized that treatment with quinapril would increase insulin stimulated forearm glucose uptake and insulin-stimulated endothelial function. Furthermore, because ACE inhibitors increase adiponectin levels and the latter have favorable effects on insulin action, we examined the impact of quinapril on adiponectin gene expression in patients with type 2 diabetes.


    Patients and Methods
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Twenty-four patients with type 2 diabetes and no previous history of cardiovascular disease, retinopathy, or nephropathy were included. All participants underwent a screening, which included measurement of blood pressure, body weight, fasting glucose, fasting cholesterol, and a 2-h oral glucose challenge (75 g glucose). Patients were randomized (computer-generated random numbers in sealed envelopes) to receive 2 months tablet treatment with 20 mg quinapril daily (Accupro, Pfizer, Copenhagen, Denmark) or no treatment in an open parallel group study. The allocation ratio (of patients receiving quinapril to patients receiving no treatment) was 2:1. Measurement of endothelium-dependent vasodilation, endothelium-independent vasodilation, insulin-stimulated endothelium-dependent vasodilation, insulin-stimulated forearm glucose uptake, and an oral glucose challenge (on a separate day) was performed before and after 2 months in each group. One type 2 diabetic subject in the treatment group was excluded due to noncompliance and a change in smoking status from nonsmoker to heavy smoking shortly after the first examination. During quinapril treatment one subject developed a rash and three subjects developed a dry cough. Fifteen healthy subjects matched with regard to age and smoking status were used as a healthy control group. The three groups are designated in the following groups: 1) type 2 diabetic treatment group (type 2 diabetic patients randomized to quinapril treatment); 2) type 2 diabetic control group (type 2 diabetic patients randomized to no treatment); and 3) healthy control group (healthy control population).

The study was approved by the local ethical committee and the Danish Medicines Agency. Participants gave their written informed consent. All measurements in this study were performed blinded to the treatment protocol.

All studies were started at 0800 h after an 8-h overnight fast, which included abstinence from smoking. Experimental procedures and measurement of blood flow was performed as previously described (3). Blood flow was measured by venous occlusion plethysmography. Assessment of forearm vascular function was performed by separately stimulation of endothelium-dependent vasodilation and endothelium-independent vasodilation. Both measures are necessary for the measurement of vascular function and are also suitable for the evaluation of action and effect of cardiovascular drugs. In the current study, endothelial nitric oxide (NO) production was stimulated by infusion of serotonin. Serotonin is an agonist of endothelial NO production and is highly NO specific. Endothelium-independent vasodilation (vascular smooth muscle relaxation) was tested by infusion of sodium nitroprusside, which acts as an external NO donor in vascular smooth muscle cells. Local insulin infusion in the brachial artery for 60 min was used. Blood flow was expressed as (milliliters per 100 ml forearm per minute). Insulin stimulation of endothelium-dependent vasodilation was calculated as percent increase in blood flow from the serotonin response.

For the study of gene expression of ACE, adiponectin, insulin receptor substrate (IRS)-1, phosphatidylinositol 3 (PI 3)-kinase, and Akt-1 during quinapril treatment, vascular tissue was isolated from sc fat biopsies, obtained from the study subjects before and after the 2 months. The isolation of vascular tissue from adipose tissue was performed as described by Jiang (24). After isolation, the vascular tissue was immediately frozen in liquid nitrogen and stored at –80 C.

From the biopsy samples obtained as described above, total RNA was extracted and gene expression was measured by real-time PCR as previously described (25). Primers used were as follows: glyceraldehyde-3-phosphate dehydrogenase forward, TCGGAGTCAACGGATTTG, reverse, GCATCGCCCCACTTGATT; adiponectin forward, GGTGGGCTCCTTACAGAACA, reverse, TTCAAAGCATCACAGGACCA; IRS-1 forward, AGTCCCAGCACCAACAGAAC, reverse, TCATCCGAGGAGATGAAACC; Akt-1 forward, CCCTTCTACAACCAGGACCA, reverse, ACACGATACCGGCAAAGAAG; PI 3-kinase forward, TCATATTGACTTCGGGCACA, reverse, TCAGCATCATGGAGAACAGG; and ACE forward, TTGACAAGATCGCCTTTATCC, reverse, GTAAGGCACGCTAGAAGGAAT.

Results are expressed as fold change in gene expression by determining the ratio of copy number of the gene of interest in a given individual after quinapril vs. placebo treatment, corrected for expression of glyceraldehyde-3-phosphate dehydrogenase in the samples. Vascular tissue was obtained from six subjects in the type 2 diabetic treatment group and two subjects in the type 2 diabetic control group. The purity of the isolated vascular stroma was assessed by light microscopy after staining with hematoxylin and eosin and also immunohistochemical staining with CD34.

Infusion protocol

In the study of endothelium-dependent vasodilation, incremental doses of serotonin (7, 21, and 70 ng/min; Clinalfa, Läufelfingen, Switzerland) were infused (Fig. 1Go). Each dose was infused for 5 min to obtain a stable blood flow. After at least 30 min washout of serotonin, when blood flow had returned to baseline, the effect of insulin on endothelium-independent vasodilation was assessed by infusion of the NO donor sodium nitroprusside (Nitropress, Abbott Laboratories, North Chicago, IL) in doses of 0.5, 1, and 1.5 µg/min. The doses were chosen from previous experience in attempt to match flow levels induced by serotonin. The sodium nitroprusside studies were performed in all study subjects. Insulin-stimulated endothelial function was assessed by intraarterial insulin infusion [Actrapid (Novo Nordisk Scandinavia, Malmö, Sweden) in 1% human albumin solution (vehicle)] at a rate of 0.05 mU x kg body weight–1 x min–1. Insulin was continuously infused for 60 min, and a dose response study of serotonin was subsequently performed immediately afterward.


Figure 1
View larger version (8K):
[in this window]
[in a new window]
 
FIG. 1. Infusion protocol. The infusion protocol shows the infusion schedule of serotonin (5-HT), sodium nitroprusside (SNP), L-NMMA, and insulin.

 
The fraction of NO-mediated vasodilation during serotonin-insulin infusion at 60 min forearm hyperinsulinemia was determined in 11 subjects in the type 2 diabetic treatment group and five subjects in the type 2 diabetic control group after 10 min intraarterial infusion of NG-monomethyl-L-arginine (L-NMMA; Clinalfa) in a dose of 3.3 mg/min, followed by a serotonin dose-response study.

Glucose uptake and measurement of insulin concentration

Blood samples were drawn simultaneously from the artery and vein in the infused arm. The plasma concentration of glucose was determined by the glucose oxidase method (Vitros; Johnson & Johnson, New Brunswick, NJ), and serum insulin concentration was determined by a microparticle enzyme immunoassay (Axsym Insulin B2D010; Abbott). Insulin-stimulated glucose uptake in the forearm was calculated as previously described (26). Glucose uptake was assessed every 10 min during insulin infusion. During the oral glucose challenge, blood samples for measurement of plasma glucose and serum insulin were collected at time 0, 15, 30, 60, and 120 after digestion of 75 g glucose.

The concentration of adiponectin was determined by RIA (human adiponectin RIA kit, Linco Research, St. Charles, MO).

Statistical analyses

Comparison of blood flow values were performed with mixed models using the PROC MIXED procedure in the Statistical Analysis Software (version 8.2; SAS Institute, Cary, NC). For studies of blood flow, logarithmic transformation of flow was used to satisfy the model assumption (homogeneity of variance). The dose-response studies entered the model as fixed effects as did the interaction between dose-response study and dose of vasodilator. Study subject and the interaction between study subject and dose of vasodilator entered the model as random effects. The level of statistical significance was chosen as P ≤ 0.05 (two-sided test). Continuous variables were normally distributed and are presented as means ± SD (in figures as mean and SEM).


    Results
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Characteristics of the study population

Characteristics are shown in Table 1Go. Type 2 diabetic subjects had significant higher fasting plasma glucose, fasting serum insulin, C-reactive protein (CRP) concentration, and systolic blood pressure than the healthy controls. No significant change in the CRP or adiponectin concentration was seen in the type 2 diabetic treatment group or the type 2 diabetic control group during the study.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characteristics of the quinapril-treated group, the time control group, and the healthy controls

 
Systolic and diastolic blood pressure and heart rate

Systolic and diastolic blood pressure was reduced significantly (systolic blood pressure: P < 0.0001 after vs. before; diastolic blood pressure P < 0.0001 after vs. before) in the type 2 diabetic treatment group (Fig. 2Go). In the type 2 diabetic control subjects, systolic blood pressure was not altered, whereas a significant reduction in diastolic blood pressure was observed (P < 0.0001; Fig. 2Go). Dose-response studies of serotonin and sodium nitroprusside did not cause significant changes in systolic blood pressure or diastolic blood pressure. Heart rate was not changed in the type 2 diabetic treatment group or the type 2 diabetic control group (Table 1Go), and the heart rate was also unchanged during dose-response studies of serotonin and sodium nitroprusside and during insulin infusion.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2. Systolic and diastolic blood pressure in the type 2 diabetic treatment group and the type 2 diabetic control group. Systolic and diastolic blood pressure was significantly reduced in the treatment group. Systolic blood pressure after treatment (white circles) was reduced by 7 mm Hg, compared with systolic blood pressure before treatment (black circles) (P < 0.001), and diastolic blood pressure after treatment (white triangles) was reduced by 4 mm Hg, compared with diastolic blood pressure before quinapril (black triangles) (P < 0.001). In the type 2 diabetic control group, no significant change in systolic blood pressure was seen (black squares before and white squares after), whereas a change of 3.5 mm Hg in diastolic blood pressure was seen (P = 0.001). No change in blood pressure was seen during dose-response studies of serotonin (5-HT) and sodium nitroprusside (SNP). T2DM, Type 2 diabetes; INS, insulin.

 
Oral glucose challenge

Fasting plasma glucose was not altered in the type 2 diabetic treatment group (before = 10.8 ± 2.7 mM vs. after = 9.8 ± 1.9 mM, NS). Fasting serum insulin concentration did not change (before = 18.5 ± 12.8 mU/liter vs. after = 16.7 ± 9.3 mU/liter, NS). In the type 2 diabetic control group, no significant change in fasting plasma glucose (before = 9.5 ± 3.4 mM vs. after = 8.3 ± 1.7 mM, NS) or fasting serum insulin (before = 15.0 ± 9.6 mU/liter vs. after = 14.5 ± 10.2 mU/liter, NS) was seen.

Quinapril treatment changed neither the plasma glucose concentration (before = 17.2 ± 2.7 mM vs. after = 17.2 ± 2.2 mM, NS) nor the serum insulin concentration (before = 41.8 ± 25.7 mU/liter vs. after = 42.4 ± 23.8 mU/liter, NS) at 2 h after the challenge. Quinapril treatment did not cause significant changes in plasma glucose or serum insulin concentration 15, 30, or 60 min after the challenge. In the type 2 diabetic control group, no significant changes were seen in the postchallenge values of glucose or insulin during the 2 months.

Endothelium-dependent and -independent vasodilation

Subjects with type 2 diabetes had a significantly lower serotonin response than healthy controls (Fig. 3AGo). Baseline blood flow was not increased by quinapril treatment (before = 1.75 ± 0.40 vs. after = 1.89 ± 0.71 ml per 100 ml per minute, P = 0.4). The serotonin response was increased significantly, by an average of 16.5% at all three dose levels, P = 0.001 vs. pretreatment (Fig. 3AGo). Endothelium-independent vasodilation, assessed during sodium nitroprusside infusion (Fig. 3BGo), was lower in the type 2 diabetic subjects than the healthy controls but the sodium nitroprusside response was unchanged by quinapril treatment (P = 0.8 before vs. after treatment). The sodium nitroprusside response was also unchanged in the type 2 diabetic control group. At the beginning the sodium nitroprusside response was 2.31 ± 0.72 (dose 1), 5.00 ± 1.73 (dose 2), and 7.41 ± 3.04 (dose 3), and after the 2 months, the response was 2.03 ± 0.71 (dose 1), 5.60 ± 3.00 (dose 2), and 7.95 ± 2.06 (dose 3).


Figure 3
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. A, Serotonin response in 15 patients with type 2 diabetes before (black squares) and after 2 months of quinapril treatment (black triangles) and in 15 healthy control subjects (black circles). The serotonin response in the patients with type 2 diabetes was significantly increased after 2 months of quinapril treatment (P = 0.001). The serotonin response in the subjects with type 2 diabetes was significantly lower than in the healthy subjects (P < 0.001). The L-NMMA response in the quinapril group before treatment (white squares) was not changed after quinapril treatment (white triangles) (P = 0.5). B, Sodium nitroprusside response in the healthy controls (black squares) and the type 2 diabetic subjects before (black circles) and after (white circles) 2 months of quinapril treatment. No significant change in the sodium nitroprusside response was seen (P = 0.8). T2DM, Type 2 diabetes.

 
Insulin-stimulated endothelial function

The insulin-stimulated serotonin response was markedly reduced in the subjects with type 2 diabetes, compared with the healthy control group (Fig. 4AGo). Quinapril treatment increased the insulin-stimulated serotonin response significantly (Fig. 4AGo; P < 0.001 vs. pretreatment). To correct for the increase in endothelium-dependent vasodilation during treatment, we calculated the percentage increase in serotonin response by insulin. After this correction, insulin-stimulated endothelial function was still significantly increased after 2 months of quinapril treatment (Fig. 4BGo; P = 0.005 after treatment vs. before treatment). The degree of NO-mediated vasodilation during insulin-serotonin infusion was assessed during coinfusion of L-NMMA. The blood flow increase induced by serotonin-insulin coinfusion was abolished by L-NMMA infusion. Before quinapril, blood flow during the serotonin-insulin-L-NMMA coinfusion was 1.55 ± 0.42 (dose 1), 1.83 ± 0.52 (dose 2), and 1.83 ± 0.65 (dose 3), which was not altered after quinapril treatment: 1.85 ± 0.25 (dose 1), 1.86 ± 0.16 (dose 2), and 1.93 ± 0.26 (dose 3) (P = 0.4 after treatment vs. before treatment).


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. A, Insulin enhanced serotonin response in healthy subjects (white circles) and type 2 diabetic subjects (T2DM) before (white squares) and after (upward-slanting white triangles) 2 months of quinapril treatment and in the control group before (white diamonds) and after 2 months (downward-slanting white triangles). The serotonin response in the healthy subjects (black circles) and type 2 diabetic subjects before quinapril (black squares) and after 2 months of quinapril treatment (black squares) and in the type 2 diabetic control group before (black diamonds) and after 2 months (downward-slanting black triangles) is shown for comparison. Insulin-enhanced serotonin response was significantly increased by quinapril (P < 0.001), and the type 2 diabetic subjects had a lower insulin enhancement of the serotonin response than the healthy controls. In the type 2 diabetic control group, the serotonin response was increased to some extent after the 2 months, but the change was not significant (P = 0.2). The insulin-enhanced serotonin response in the type 2 diabetic control group was not significantly increased during the 2 months. The percent enhancement of the serotonin response by insulin is shown (B). After quinapril treatment the enhancement of the serotonin response by insulin was significantly increased (white squares), compared with before quinapril treatment (white triangles) (P = 0.005).

 
In the type 2 diabetic control group, the serotonin response was slightly but not significantly increased (P = 0.2), and the insulin-stimulated serotonin response was unchanged after 2 months.

Insulin-stimulated forearm glucose uptake

Forearm glucose uptake was assessed during 60 min of intraarterial insulin infusion. Local serum insulin was increased from 9.8 ± 6.0 to 251.2 ± 86.2 mU/liter after 10 min of insulin infusion (P < 0.0001). Local serum insulin concentration at 30 min infusion was 252.1 ± 77.7, and after 60 min insulin infusion concentration was 259.7 ± 85.8 mU/liter. During the 60 min intraarterial insulin infusion, no change in systemic insulin was seen. In the type 2 diabetic treatment group, systemic serum insulin was 11.2 ± 7.2 mU/liter before insulin infusion and was 12.6 ± 8.3 mU/liter after 60 min insulin (P = 0.6) Baseline and insulin-stimulated forearm glucose uptake was not altered by quinapril treatment (Fig. 5Go).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. Forearm uptake during 60 min of insulin infusion. No significant change in glucose uptake was seen in the type 2 diabetic (T2DM) treatment group or the type 2 diabetic time control group.

 
Effect of quinapril on adiponectin, IRS-1, PI 3-kinase, Akt-1, and ACE gene expression in vascular and adipose tissue

Quinapril treatment increased the gene expression ratio of adiponectin in the vascular tissue by 2-fold, from 0.150 ± 0.058 before to 0.350 ± 0.205 after treatment (P = 0.048 before vs. after). In the control group, samples from only two subjects were available. In this group adiponectin expression was 0.153 ± 0.118 before and 0.191 ± 0.159 after 2 months. Gene expression of IRS-1 (before = 0.060 ± 0.054 vs. after quinapril = 0.030 ± 0.004, NS), Akt-1 (before = 0.069 ± 0.044 vs. after quinapril = 0.043 ± 0.035, NS), and PI 3-kinase (before = 0.0011 ± 0.0007 vs. after quinapril = 0.0010 ± 0.0008, NS) was unchanged by quinapril. The expression of the ACE gene was not significantly changed (before = 0.031 ± 0.027 vs. after quinapril = 0.021 ± 0.008, NS).

In adipose tissue, relative gene expression of adiponectin was 25-fold higher than the expression ratio seen in vascular tissue. Adiponectin gene expression was unchanged by quinapril in adipose tissue, from 3.69 ± 0.57 before quinapril to 3.45 ± 0.68 after quinapril (NS).


    Discussion
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 
We report that 2 months of quinapril treatment improved insulin-stimulated endothelial function without changing insulin-stimulated glucose uptake in the forearm or postchallenge glucose or insulin levels in patients with type 2 diabetes. Furthermore, adiponectin gene expression was increased in vascular tissue from the quinapril-treated patients. To our knowledge, we are the first to demonstrate a positive effect of ACE inhibition on insulin-stimulated endothelial function in patients with type 2 diabetes, and the observed increase in adiponectin gene expression could be one possible underlying mechanism. The observations in the current study are not regarded as being specific to quinapril but are also expected to be reproduced with other nonsulfhydryl-containing ACE inhibitors.

The vascular system in patients with insulin resistance and type 2 diabetes is characterized by endothelial dysfunction (2). The improvement in endothelial function with ACE inhibition in our study is consistent with observations in diverse patient populations, including type 1 or type 2 diabetes, coronary heart disease, or heart failure (4, 5, 27, 28). Type 2 diabetic patients have increased plasma concentration and also increased endogenous activity of the potent vasoconstrictor endothelin-1 (29, 30). There is existing evidence that endothelin-1 is reduced by ACE inhibition (6, 29), which could be one explanation for the observed increase in endothelial function. Also, ACE inhibition reduces the concentration of the endogenous NO synthase inhibitor asymmetric dimethylarginine in type 2 diabetic patients (31), which could facilitate NO-dependent vasodilation. In our study we did not observe any change in endothelium-independent vasodilation, suggesting that the smooth muscle cell sensitivity to NO was not increased.

We studied the effect of quinapril in subjects with type 2 diabetes with a high incidence of smoking. Patients with type 2 diabetes have increased oxidant stress, which is also present in smokers. Because ACE inhibitors are known to reduce oxidant stress (32), this could also mediate some beneficial effect on NO-mediated endothelial function in the current study. However, we did not measure markers of oxidative stress.

In this study the insulin-stimulated serotonin response was significant increased and was also significant increased after adjustment for the enhancement of the serotonin response by quinapril. Furthermore, blood flow during insulin-serotonin coinfusion was inhibited by L-NMMA before and after quinapril treatment, which indicates that insulin-stimulated vasodilation was mediated by NO and that the observed increase in insulin-stimulated vasodilation during quinapril treatment was also mediated by NO.

It is well acknowledged that insulin causes enhancement of endothelial-dependent vasodilation in resistance vessels (33) and increases capillary recruitment in healthy subjects (34). In resistance vessels, insulin stimulates vasodilation by stimulating IRS-1-associated PI 3-kinase activity, which is followed by activation of Akt and an increase in the activity of endothelial nitric oxide synthase (35). This pathway is blunted in vascular tissue in an animal model of insulin resistance (24). In type 2 diabetic subjects receiving hypoglycemic drug therapy, improvement of whole-body insulin sensitivity and insulin-stimulated vasodilation occurs within the same time range (3, 36), and therefore, a relation is suggested to exist. In our study no change in forearm glucose uptake or whole-body glucose uptake was seen, whereas insulin-stimulated vasodilation was significantly increased. This indicates that a change in insulin-stimulated vasodilation is not necessarily preceded or accompanied by an increase in whole-body insulin sensitivity. Of note, our studies did not include a euglycemic hyperinsulinemic clamp, and therefore, it is possible that we may not have been able to detect subtle changes in whole-body glucose uptake. However, because both the forearm glucose uptake and the glucose and insulin responses to the oral glucose challenge remained unchanged during quinapril treatment, further intensive studies of glucose metabolism do not appear to be warranted. The lack of an effect on glucose metabolism by quinapril could be due to the dosage or an insufficient duration of treatment. In a study with captopril, the effect on glucose metabolism was seen already after 2 d of treatment (12). However, the dosage used in the current study may have permitted the detection of a discrepancy among responses by tissue type.

Adiponectin gene expression was increased in vascular biopsies from the quinapril-treated subjects, whereas no change was seen in gene expression of IRS-1, PI 3-kinase, or Akt-1. Adiponectin is abundantly expressed in adipose tissue in humans and is present in a high concentration in plasma. Subjects with obesity and type 2 diabetes have a lower plasma level of adiponectin than healthy subjects (37). A low concentration of adiponectin is closely correlated to impairment of endothelial function in healthy humans (21) and patients with diabetes (38). The effect of adiponectin on the endothelium is suggested to be mediated by its ability to stimulate NO (22). Disruption of the adiponectin gene causes disruption of IRS-1-associated PI 3-kinase activity, whereas viral-mediated reconstitution of adiponectin expression is able to reverse insulin resistance (39). ACE inhibition increases plasma levels of adiponectin in insulin-resistant subjects (19). One study has shown that adiponectin gene expression is not exclusively confined to adipose tissue but is also inducible in muscle cells (40).

We therefore suggest that the increase in adiponectin gene expression in vascular tissue may contribute to the observed increase in insulin-stimulated endothelial function in our study because the increased availability of adiponectin may enhance endothelial nitric oxide synthase activation in the endothelium. We observed a 25-fold higher relative expression of adiponectin in adipose tissue than in the vascular tissue, yet no change was seen with quinapril. Because adipose tissue is the predominant source of circulating adiponectin, the change in vascular adiponectin gene expression in our study is therefore not suggested to affect the systemic adiponectin concentration, which was also confirmed. Of note, enhanced expression of adiponectin in adipose tissue has been correlated with an increased concentration of circulating adiponectin and improved systemic insulin action (25).

Another possible mechanism for the effect of ACE inhibition could be inhibition of angiotensin II. Angiotensin II increases serine phosphorylation of the insulin receptor and could impair insulin’s effect on endothelial nitric oxide synthase. This mechanism may collaborate the beneficial effects of ACE inhibition on insulin-stimulated endothelial function in our study and whole-body insulin sensitivity shown by other groups (12, 13).

In conclusion, this study demonstrates that quinapril increases endothelial function and insulin-stimulated endothelial function without changing insulin-stimulated muscle glucose uptake in patients with type 2 diabetes. These observations, in the absence of effects on systemic insulin action, indicate tissue-specific insulin sensitizing actions of quinapril.


    Footnotes
 
First Published Online December 13, 2005

Abbreviations: ACE, Angiotensin-converting enzyme; CRP, C-reactive protein; IRS, insulin receptor substrate; L-NMMA, NG-monomethyl-L-arginine; NO, nitric oxide; PI 3, phosphatidylinositol 3.

This work was supported by The Danish Heart Foundation and the Danish Diabetes Association.

Received June 1, 2005.

Accepted December 1, 2005.


    References
 Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Heart Outcomes Prevention Evaluation Study Investigators 2000 Effects of ramipril on cardiovascular and microvascular outcomes in people with diabetes mellitus: results of the HOPE study and MICRO-HOPE substudy. Lancet 355:253–259[CrossRef][Medline]
  2. Steinberg HO, Chaker H, Leaming R, Johnson A, Brechtel G, Baron AD 1996 Obesity/insulin resistance is associated with endothelial dysfunction. Implications for the syndrome of insulin resistance. J Clin Invest 97:2601–2610[Medline]
  3. Rask-Madsen C, Ihlemann N, Krarup T, Christiansen E, Kober L, Nervil Kistorp C, Torp-Pedersen C 2001 Insulin therapy improves insulin-stimulated endothelial function in patients with type 2 diabetes and ischemic heart disease. Diabetes 50:2611–2618[Abstract/Free Full Text]
  4. O’Driscoll G, Green D, Rankin J, Stanton K, Taylor R 1997 Improvement in endothelial function by angiotensin converting enzyme inhibition in insulin-dependent diabetes mellitus. J Clin Invest 100:678–684[Medline]
  5. O’Driscoll G, Green D, Maiorana A, Stanton K, Colreavy F, Taylor R 1999 Improvement in endothelial function by angiotensin-converting enzyme inhibition in non-insulin-dependent diabetes mellitus. J Am Coll Cardiol 33:1506–1511[Abstract/Free Full Text]
  6. Desideri G, Ferri C, Bellini C, De Mattia G, Santucci A 1997 Effects of ACE inhibition on spontaneous and insulin-stimulated endothelin-1 secretion: in vitro and in vivo studies. Diabetes 46:81–86[Abstract]
  7. Zhuo JL, Mendelsohn FA, Ohishi M 2002 Perindopril alters vascular angiotensin-converting enzyme, AT(1) receptor, and nitric oxide synthase expression in patients with coronary heart disease. Hypertension 39:634–638[Abstract/Free Full Text]
  8. Candido R, Jandeleit-Dahm KA, Cao Z, Nesteroff SP, Burns WC, Twigg SM, Dilley RJ, Cooper ME, Allen TJ 2002 Prevention of accelerated atherosclerosis by angiotensin-converting enzyme inhibition in diabetic apolipoprotein E-deficient mice. Circulation 106:246–253[Abstract/Free Full Text]
  9. Hosomi N, Mizushige K, Ohyama H, Takahashi T, Kitadai M, Hatanaka Y, Matsuo H, Kohno M, Koziol JA 2001 Angiotensin-converting enzyme inhibition with enalapril slows progressive intima-media thickening of the common carotid artery in patients with non-insulin-dependent diabetes mellitus. Stroke 32:1539–1545[Abstract/Free Full Text]
  10. Yusuf S, Gerstein H, Hoogwerf B, Pogue J, Bosch J, Wolffenbuttel BH, Zinman B 2001 Ramipril and the development of diabetes. JAMA 286:1882–1885[Abstract/Free Full Text]
  11. Braunwald E, Domanski MJ, Fowler SE, Geller NL, Gersh BJ, Hsia J, Pfeffer MA, Rice MM, Rosenberg YD, Rouleau JL 2004 Angiotensin-converting-enzyme inhibition in stable coronary artery disease. N Engl J Med 351:2058–2068[Abstract/Free Full Text]
  12. Torlone E, Rambotti AM, Perriello G, Botta G, Santeusanio F, Brunetti P, Bolli GB 1991 ACE-inhibition increases hepatic and extrahepatic sensitivity to insulin in patients with type 2 (non-insulin-dependent) diabetes mellitus and arterial hypertension. Diabetologia 34:119–125[CrossRef][Medline]
  13. Seghieri G, Yin W, Boni C, Sanna G, Anichini R, Bartolomei G, Ferrannini E 1992 Effect of chronic ACE inhibition on glucose tolerance and insulin sensitivity in hypertensive type 2 diabetic patients. Diabet Med 9:732–738[Medline]
  14. Galletti F, Strazzullo P, Capaldo B, Carretta R, Fabris F, Ferrara LA, Glorioso N, Semplicini A, Mancini M 1999 Controlled study of the effect of angiotensin converting enzyme inhibition versus calcium-entry blockade on insulin sensitivity in overweight hypertensive patients: Trandolapril Italian Study (TRIS). J Hypertens 17:439–445[CrossRef][Medline]
  15. Petrie JR, Morris AD, Ueda S, Small M, Donnelly R, Connell JM, Elliott HL 2000 Trandolapril does not improve insulin sensitivity in patients with hypertension and type 2 diabetes: a double-blind, placebo-controlled crossover trial. J Clin Endocrinol Metab 85:1882–1889[Abstract/Free Full Text]
  16. Heise T, Heinemann L, Kristahn K, Berger M, Sawicki PT 1999 Insulin sensitivity in patients with essential hypertension: no influence of the ACE inhibitor enalapril. Horm Metab Res 31:418–423[Medline]
  17. Rao RH 1994 Effects of angiotensin II on insulin sensitivity and fasting glucose metabolism in rats. Am J Hypertens 7:655–660[Medline]
  18. Henriksen EJ, Jacob S, Kinnick TR, Teachey MK, Krekler M 2001 Selective angiotensin II receptor antagonism reduces insulin resistance in obese Zucker rats. Hypertension 38:884–890[Abstract/Free Full Text]
  19. Furuhashi M, Ura N, Higashiura K, Murakami H, Tanaka M, Moniwa N, Yoshida D, Shimamoto K 2003 Blockade of the renin-angiotensin system increases adiponectin concentrations in patients with essential hypertension. Hypertension 42:76–81[Abstract/Free Full Text]
  20. Pajvani UB, Scherer PE 2003 Adiponectin: systemic contributor to insulin sensitivity. Curr Diab Rep 3:207–213[Medline]
  21. Shimabukuro M, Higa N, Asahi T, Oshiro Y, Takasu N, Tagawa T, Ueda S, Shimomura I, Funahashi T, Matsuzawa Y 2003 Hypoadiponectinemia is closely linked to endothelial dysfunction in man. J Clin Endocrinol Metab 88:3236–3240[Abstract/Free Full Text]
  22. Chen H, Montagnani M, Funahashi T, Shimomura I, Quon MJ 2003 Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem 278:45021–45026[Abstract/Free Full Text]
  23. Hattori Y, Suzuki M, Hattori S, Kasai K 2003 Globular adiponectin upregulates nitric oxide production in vascular endothelial cells. Diabetologia 46:1543–1549[CrossRef][Medline]
  24. Jiang ZY, Lin YW, Clemont A, Feener EP, Hein KD, Igarashi M, Yamauchi T, White MF, King GL 1999 Characterization of selective resistance to insulin signaling in the vasculature of obese Zucker (fa/fa) rats. J Clin Invest 104:447–457[Medline]
  25. Tonelli J, Li W, Kishore P, Pajvani UB, Kwon E, Weaver C, Scherer PE, Hawkins M 2004 Mechanisms of early insulin-sensitizing effects of thiazolidinediones in type 2 diabetes. Diabetes 53:1621–1629[Abstract/Free Full Text]
  26. Zierler K 1961 Theory of the use of arterioveneous concentration differences for measuring metabolism in steady and non-steady states. J Clin Invest 40:2111–2125
  27. Hornig B, Landmesser U, Kohler C, Ahlersmann D, Spiekermann S, Christoph A, Tatge H, Drexler H 2001 Comparative effect of ACE inhibition and angiotensin II type 1 receptor antagonism on bioavailability of nitric oxide in patients with coronary artery disease: role of superoxide dismutase. Circulation 103:799–805[Abstract/Free Full Text]
  28. Hornig B, Arakawa N, Haussmann D, Drexler H 1998 Differential effects of quinaprilat and enalaprilat on endothelial function of conduit arteries in patients with chronic heart failure. Circulation 98:2842–2848[Abstract/Free Full Text]
  29. Ferri C, Carlomagno A, Coassin S, Baldoncini R, Cassone Faldetta MR, Laurenti O, Properzi G, Santucci A, De Mattia G 1995 Circulating endothelin-1 levels increase during euglycemic hyperinsulinemic clamp in lean NIDDM men. Diabetes Care 18:226–233[Abstract]
  30. Cardillo C, Campia U, Bryant MB, Panza JA 2002 Increased activity of endogenous endothelin in patients with type II diabetes mellitus. Circulation 106:1783–1787[Abstract/Free Full Text]
  31. Ito A, Egashira K, Narishige T, Muramatsu K, Takeshita A 2002 Angiotensin-converting enzyme activity is involved in the mechanism of increased endogenous nitric oxide synthase inhibitor in patients with type 2 diabetes mellitus. Circ J 66:811–815[CrossRef][Medline]
  32. Wiemer G, Linz W, Hatrik S, Scholkens BA, Malinski T 1997 Angiotensin-converting enzyme inhibition alters nitric oxide and superoxide release in normotensive and hypertensive rats. Hypertension 30:1183–1190[Abstract/Free Full Text]
  33. Taddei S, Virdis A, Mattei P, Natali A, Ferrannini E, Salvetti A 1995 Effect of insulin on acetylcholine-induced vasodilation in normotensive subjects and patients with essential hypertension. Circulation 92:2911–2918[Abstract/Free Full Text]
  34. Dawson D, Vincent MA, Barrett EJ, Kaul S, Clark A, Leong-Poi H, Lindner JR 2002 Vascular recruitment in skeletal muscle during exercise and hyperinsulinemia assessed by contrast ultrasound. Am J Physiol Endocrinol Metab 282:E714–E720
  35. Zeng G, Nystrom F, Ravichandran L 2000 Roles for insulin receptor, PI3-kinase, and Akt in insulin-signaling pathways related to production of nitric oxide in human vascular endothelial cells. Circulation 101:1539–1545[Abstract/Free Full Text]
  36. Vehkavaara S, Makimattila S, Schlenzka A, Vakkilainen J, Westerbacka J, Yki-Jarvinen H 2000 Insulin therapy improves endothelial function in type 2 diabetes. Arterioscler Thromb Vasc Biol 20:545–550[Abstract/Free Full Text]
  37. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, Tataranni PA 2001 Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 86:1930–1935[Abstract/Free Full Text]
  38. Tan KC, Xu A, Chow WS, Lam MC, Ai VH, Tam SC, Lam KS 2004 Hypoadiponectinemia is associated with impaired endothelium-dependent vasodilation. J Clin Endocrinol Metab 89:765–769[Abstract/Free Full Text]
  39. Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y, Komuro R, Ouchi N, Kihara S, Tochino Y, Okutomi K, Horie M, Takeda S, Aoyama T, Funahashi T, Matsuzawa Y 2002 Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med 8:731–737[CrossRef][Medline]
  40. Staiger H, Kausch C, Guirguis A, Weisser M, Maerker E, Stumvoll M, Lammers R, Machicao F, Haring HU 2003 Induction of adiponectin gene expression in human myotubes by an adiponectin-containing HEK293 cell culture supernatant. Diabetologia 46:956–960[CrossRef][Medline]



This article has been cited by other articles:


Home page
Eur Heart JHome page
S. Patel, A. Flyvbjerg, M. Kozakova, J. Frystyk, I. M. Ibrahim, J. R. Petrie, P. J. Avery, E. Ferrannini, M. Walker, and the RISC Investigators
Variation in the ADIPOQ gene promoter is associated with carotid intima media thickness independent of plasma adiponectin levels in healthy subjects
Eur. Heart J., February 1, 2008; 29(3): 386 - 393.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
R. Muniyappa, M. Montagnani, K. K. Koh, and M. J. Quon
Cardiovascular Actions of Insulin
Endocr. Rev., August 1, 2007; 28(5): 463 - 491.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. K. Koh, M. J. Quon, Y. Lee, S. H. Han, J. Y. Ahn, W.-J. Chung, J.-a Kim, and E. K. Shin
Additive beneficial cardiovascular and metabolic effects of combination therapy with ramipril and candesartan in hypertensive patients
Eur. Heart J., June 2, 2007; 28(12): 1440 - 1447.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. T. Lely, J. A. Krikken, S. J. L. Bakker, F. Boomsma, R. P. F. Dullaart, B. H. R. Wolffenbuttel, and G. Navis
Low Dietary Sodium and Exogenous Angiotensin II Infusion Decrease Plasma Adiponectin Concentrations in Healthy Men
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1821 - 1826.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. A. Potenza, F. L. Marasciulo, M. Tarquinio, M. J. Quon, and M. Montagnani
Treatment of Spontaneously Hypertensive Rats With Rosiglitazone and/or Enalapril Restores Balance Between Vasodilator and Vasoconstrictor Actions of Insulin With Simultaneous Improvement in Hypertension and Insulin Resistance
Diabetes, December 1, 2006; 55(12): 3594 - 3603.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
91/3/1001    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hermann, T. S.
Right arrow Articles by Torp-Pedersen, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hermann, T. S.
Right arrow Articles by Torp-Pedersen, C.
Related Collections
Right arrow Cardiovascular Endocrinology
Right arrow Diabetes and Insulin
Right arrow Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals