| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institut National de la Santé et de la Recherche Médicale (INSERM) Unite 413 (E.L., V.C., D.C., C.D., H.V., H.L.), Laboratory of Cellular and Molecular Neuroendocrinology, European Institute for Peptide Research (IFRMP 23), University of Rouen, 76821 Mont-Saint-Aignan, France; Department of Endocrinology (L.G., J.B.), Centre Hospitalier Universitaire Cochin & Institut Cochin, INSERM Unite 567, Centre National de la Recherche Scientifique UMR8104, Institut Fédératif de Recherche 116, Université Paris V, René Descartes, 75014 Paris, France; and Department of Endocrinology (G.B.), Centre Hospitalier dOrléans, 45067 Orléans, France
Address all correspondence and requests for reprints to: Dr. Hervé Lefebvre, IFRMP 23, Institut National de la Santé et de la Recherche Médicale (INSERM) Unite 413, Department of Endocrinology, Hospital of Boisguillaume, Centre Hospitalier Universitaire of Rouen, 76031 Rouen Cedex, France. E-mail: herve.lefebvre{at}chu-rouen.fr.
| Abstract |
|---|
|
|
|---|
Objective: The aim of the present study was to characterize the pharmacological properties and the transduction mechanisms of illegitimate receptors, i.e. receptors for serotonin (5-HT), gastric inhibitory polypeptide (GIP), and LH/human chorionic gonadotropin (hCG), expressed by AIMAH tissues to evaluate the role of ectopic receptors in the physiopathology of Cushings syndrome.
Design: We used in vitro studies on cultured adrenal hyperplasia cells.
Setting: The setting was a university research laboratory.
Patients: AIMAH tissues (H1H3) were removed from three patients previously screened for illegitimate receptors.
Main Outcome Measure(s): The main outcome measures were steroidogenic and electrical activities of cultured adrenal hyperplasia cells.
Results: In vitro studies showed that the corticotropic effect of 5-HT was mediated by ectopic 5-HT7 receptors in H1 and H2. GIP and hCG stimulated cortisol production via activation of cAMP-dependent protein kinase A in H2. On the contrary, the protein kinase A inhibitor H-89 did not affect hCG-induced cortisol production in H3. Activation of 5-HT7 or GIP receptors enhanced T-type calcium current in H1 or H2 and H3, respectively. In addition, GIP reduced the amplitude of transient and sustained potassium currents in H2. Conversely, hCG did not modify T-type calcium current in H3.
Conclusions: These data show that, besides their coupling to the cAMP pathway, illegitimate adrenal receptors can activate additional transduction mechanisms, including modulation of membrane channels.
| Introduction |
|---|
|
|
|---|
Like the ACTH receptor, the majority of illegitimate receptors detected in adrenocortical tumors or hyperplasias belong to the family of adenylyl cyclase (AC)-coupled receptors (1, 6). On the other hand, activating mutations of Gs
and/or the ACTH receptor have been recently described in AIMAHs causing Cushings syndrome (7, 8), suggesting that chronic stimulation of AC in adrenocortical cells is able to promote cell proliferation and steroidogenesis. Thus, it appears likely that activation of the cAMP/protein kinase A (PKA) pathway by illegitimate receptors may be involved in the development of hyperplasia and cortisol hypersecretion. However, the capacity of ectopic receptors to activate cAMP production in adrenocortical tissues has only been demonstrated in two lesions, i.e. one adenoma and one AIMAH expressing ectopic GIP and ß-adrenergic receptors, respectively (6, 9). In normal adrenocortical cells, stimulation of cAMP production by ACTH and 5-HT modulates the activities of voltage-sensitive membrane channels (10, 11, 12, 13, 14) and steroidogenic enzymes (14, 15). The majority of rat, bovine, and human adrenocortical cells express T-type calcium channels, and some cells also possess L-type calcium channels (10, 11, 12, 13, 16, 17, 18). Gating of calcium channels is controlled by membrane potential underlain by activation of transient and sustained potassium currents (19, 20). In bovine zona fasciculata cells, potassium currents have been identified as voltage-activated rapidly inactivating A-type current and ATP-sensitive background current, respectively (20). It is well established that, in bovine cortisol-secreting cells, ACTH-induced cAMP production facilitates calcium influx through T-type calcium channels (21) and inhibits potassium efflux through ATP-sensitive background channels (20). The reduction of potassium current then triggers membrane depolarization, reinforcing calcium entry via voltage-gated T-type calcium channels (14). The resulting increase in cytosolic calcium concentration enhances hormone production (10, 11, 12, 16). Consequently, it is possible that adrenal cAMP-coupled illegitimate receptors can generate calcium influx, which in turn stimulates cortisol secretion, in cells derived from adrenocortical hyperplasia.
The aim of the present study was to investigate in vitro the pharmacological properties and the transduction mechanisms of illegitimate receptors, i.e. receptors for 5-HT, GIP, and LH/hCG expressed by three AIMAH tissues causing Cushings syndrome.
| Patients and Methods |
|---|
|
|
|---|
Three patients with AIMAH causing overt Cushings syndrome were studied. The diagnosis of ACTH-independent Cushings syndrome was based on the results of hormonal investigations (Table 1
). Potentially illegitimate receptors were searched for after informed consent of the patients was obtained by using a clinical protocol previously described (22). The study was approved by the regional ethics committee. In all cases, at least one abnormal cortisol response was observed (Table 1
), whereas plasma ACTH levels remained undetectable throughout the study.
|
Cell culture
Cell culture experiments were conducted as previously described (22). Briefly, hyperplasia explants and fragments of six normal adrenal glands free of fat and medullary tissues were enzymatically dispersed. Adrenocortical cells were cultured at 37 C in 5% CO2. Incubation experiments of cells were conducted for 24 h after 2 d in culture with fresh DMEM (control experiments) or DMEM with either 5-HT (Sigma, St. Louis, MO), cisapride (Sigma), metoclopramide (Sigma), GIP (Bachem, Bubendorf, Switzerland), or hCG (Organon, Eragny-sur-Epte, France) in the absence or presence of SB 269970 (Sigma), GR 113808 (Glaxo Group Research, Greenford, UK), LY 215840 (Lilly Research Laboratories, Indianapolis, IN), and H-89 (Sigma). Cells were incubated with each secretagogue for 24 h at 37 C. Cortisol concentration in culture medium was measured using RIA procedure (23). Results are expressed as mean ± SE, and statistical significance was assessed by Bonferroni test after one-way ANOVA.
RNA extraction and RT-PCR
Expression of genes encoding 5-HT4 and 5-HT7 receptors in the three hyperplasia tissues and two normal adrenals was analyzed by RT-PCR. Total RNA from adrenocortical explants free of fat and medullary tissues was extracted by using Tri Reagent and converted to single stranded cDNA by SuperScript II (Life Technologies, Eragny, France) with oligo(dT)1218 primer. PCR reactions performed in duplicate were carried out using gene-specific primers designed on both sides of an intron for 5-HT4 (nucleotides 691713, GGGCAGGAGCCTCCTCCGAGAG and 10141037, CAAGGGACAGTCTGGCCCAGAATG), 5-HT7 (nucleotides 13301349, CTGTGGGTGGAGAGGACATT and 17451766, GAGAAGTCACCATCTCCCTCAT) receptors, and glyceraldehyde-3-phosphate dehydrogenase (nucleotides 297317, TGCTGAGTAYGTCGTGGAGTC and 467488, TTGGTGGTGCAGGAKGCATTGC). The PCR products were separated on agarose gels, blotted on nylon membranes, and hybridized with [32P]ATP-labeled internal gene specific probes for 5-HT4 (nucleotides 867887, CCCTGGGCAGGTGTGGACTGC) and 5-HT7 (nucleotides 16531672, TTGCTGAGTCTGCAGAATGG) receptors.
Immunohistochemistry
At least two deparaffinized sections from the three hyperplasias and two normal adrenal tissues were incubated overnight at 4 C with rabbit polyclonal antibody (1:100) directed against the rat 5-HT7 receptor (8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23), a sequence conserved in isoforms (a), (b), and (d) of the human 5-HT7 receptor. The sections were then incubated with a streptavidin-biotin-peroxidase complex (Dako Corporation, Carpinteria, CA), and the enzymatic activity was revealed with diaminobenzidine. The tissue sections were counterstained with hematoxylin.
Electrophysiological studies
Electrical recordings were performed on 20 cultured adrenocortical cells derived from the three hyperplasias by using the patch-clamp technique in the whole-cell configuration. Calcium currents were recorded by using an extracellular solution containing 50 mM NaCl, 85 mM tetraethylammonium chloride, 10 mM CaCl2, 5 mM CsCl, 1 mM MgCl2, and 5 mM HEPES (pH 7.4). Potassium currents were recorded by using an extracellular solution containing 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 2 mM MgCl2, and 5 mM HEPES (pH 7.4). Patch pipettes were filled with a solution containing 130 mM KCl or 130 mM CsCl, 20 mM NaCl, 5 mM EGTA, 2 mM ATP, 0.2 mM GTP, and 5 mM HEPES (pH 7.3). The bathing medium was renewed continuously with fresh extracellular solution at a flow rate of 2 ml/min. Test substances were mixed with the extracellular solution and administered for 5 to 20 min. The electrical signals were amplified with an Axopatch 200B (Axon Instruments, Foster City, CA). The currents were filtered at 5 kHz and sampled at 2 kHz with a Digidata 1320 interface and pClamp 8 software (Axon Instruments). Leak was subtracted by a P/4 protocol.
| Results |
|---|
|
|
|---|
Incubation of cultured cells derived from a normal adrenal gland with graded concentrations of 5-HT (1010 to 105 M) caused a dose-related increase in cortisol production (pEC50 = 6.7 ± 0.1; Emax = +73.3 ± 3.5%; n = 6; Fig. 1A
). The stimulatory effect of 5-HT, which is known to be abolished by the 5-HT4 receptor antagonist GR 113808 (24), was not affected by the 5-HT1/5-HT2/5-HT5/5-HT6/5-HT7 receptor antagonist methiothepin (107 M) (pEC50 = 6.3 ± 0.4; n = 4; P > 0.05) or the selective 5-HT7 receptor antagonist SB 269970 (107 M) (pEC50 = 6.7 ± 0.4; n = 4; P > 0.05). 5-HT also induced a concentration-related stimulation of cortisol secretion (pEC50 = 7.0 ± 0.1; Emax = +173.7 ± 6.2%; n = 4; Fig. 1B
) by cultured cells (H1) derived from patient 1, who responded in vivo to the 5-HT4 receptor agonists cisapride and metoclopramide. Surprisingly, cisapride (1010 to 105 M; n = 4) did not modify cortisol secretion by cultured H1 cells, and GR 113808 (107 M) did not alter the response of H1 cells to 5-HT (pEC50 = 6.5 ± 0.3; n = 4; P > 0.05). In contrast, the corticotropic action of 5-HT was inhibited by methiothepin (107 M) (Emax = +37.2 ± 10.1%; n = 4; P < 0.001) and the 5-HT2/5-HT7 receptor antagonist LY 215840 (107 M) (Emax = +35.6 ± 7.8%; n = 4; P < 0.001). Administration of 5-HT (1010 to 105 M) to cultured cells (H2) derived from patient 2, who was not sensitive in vivo to 5-HT4 receptor agonists, provoked a significant increase in cortisol production (pEC50 = 8.2 ± 0.3; Emax = +156.3 ± 16.1%; n = 8; Fig. 1C
). Cisapride (1010 to 105 M; n = 4) or metoclopramide (1010 to 105 M; n = 4) did not modify cortisol production in H2 cells. The stimulatory effect of 5-HT on H2 cells was not modified by GR 113808 (107 M; n = 4) but was suppressed by methiothepin (107 M; n = 4) and inhibited by LY 215840 (107 M) (pEC50 = 7.1 ± 0.2; n = 4; P < 0.05). Neither 5-HT (1010 to 105 M; n = 4) nor cisapride (1010 to 105 M; n = 4), in the absence or presence of GR113808 (107 M; n = 4) and SB 269970 (107 M; n = 4), significantly modified cortisol secretion by cultured cells (H3) derived from patient 3, who was insensitive in vivo to 5-HT4 receptor agonists (Fig. 1D
).
|
Incubation of H1 and H2 tissue slices with anti-5-HT7 receptor antibodies produced intense labeling in the subcapsular region of the cortex (Fig. 2
, A and B). Clusters of immunoreactive cells were also observed in the central zones of the hyperplastic nodules (Fig. 2
, CF). 5-HT7 receptor-like immunoreactivity was detected in the two subpopulations of cells usually observed in AIMAHs, i.e. spongiocytic cells with abundant cytoplasm and lipid droplets, and small compact cells. Immunolabeling was present in the cytoplasm and at the periphery of the cells (Fig. 2
, G and I). In addition, immunostaining was visualized in arterial walls of hyperplasia H1 and H2 (Fig. 2
, H and J). In contrast, the H3 tissue did not display 5-HT7 receptor immunoreactivity (Fig. 2K
). 5-HT7 receptor immunolabeling was not detected in the cortex but was observed in blood vessels of two normal adrenal glands (Fig. 2
, L and M).
|
Involvement of the AC/PKA pathway in the transduction mechanism of illegitimate receptors expressed by the three hyperplasias was investigated by incubating cultured cells with the PKA inhibitor H-89 (Fig. 3
). Treatment with H-89 (105 M) reduced the spontaneous production of cortisol in cultured H1 and H2 cells by 64.6 ± 8.7% (n = 4; P < 0.001) and 81.0 ± 14% (n = 4; P < 0.01), respectively, but did affect basal cortisol secretion in H3 cells (Fig. 3A
). In addition, H-89 blocked the corticotropic action of 5-HT (106 M; n = 4; P < 0.001) in cultured H1 and H2 cells (Fig. 3B
). Similarly, H-89 (105 M) suppressed the stimulatory effects of hCG (107 M; n = 4; P < 0.001) and GIP (107 M; n = 4; P < 0.001) on cortisol secretion by H2 cells (Fig. 3
, C and D). In H3 cells, H-89 (105 M) significantly reduced the GIP-induced steroidogenesis (42.7 ± 17.8%; n = 4; P < 0.01) but had no influence on the stimulatory effect of hCG (Fig. 3
, C and D).
|
Electrophysiological recordings were performed to investigate the coupling of illegitimate receptors to voltage-activated ionic channels in cultured cells derived from the three hyperplasias. Voltage-activated Ca2+ currents generated by depolarizing pulses were recorded in the whole-cell configuration from a holding potential of 80 mV. Representative superimposed current traces obtained on H1, H2, and H3 cells show that test potentials at 40 and 30 mV evoked inward Ca2+ currents that inactivated within 100 ms (Fig. 4A
). Stronger depolarizations elicited faster rising and inactivating Ca2+ currents but did not activate sustained inward current (data not shown). To illustrate the voltage dependency of Ca2+ currents, the data from each cell were normalized to their maximal peak current. The current-voltage (I-V) relationships showed that the Ca2+ currents emitted by H1, H2, and H3 cells displayed activation thresholds around 50 mV and maximum amplitudes between 30 mV (H1 and H2) and 20 mV (H3) (Fig. 4B
). The hyperplasia cells generated Ca2+ currents that exhibited the typical biophysical properties of T-type Ca2+ currents, i.e. low-voltage-activated transient Ca2+ currents. In addition, as shown in Fig. 4C
, the T-type calcium channel blocker mibefradil (106 M; 6 min) suppressed the transient Ca2+ currents generated by H1 cells in response to 30 mV pulses (Fig. 4C
).
|
Fig. 5
illustrates the effect of GIP on the potassium currents expressed by H2 cells. In response to increasing voltage pulses from 70 to +10 mV, H2 cells displayed rapidly rising and inactivating currents, followed by sustained outward currents at potentials higher than 50 mV (Fig. 5A
). These outward currents have not been observed in the presence of the potassium channels blockers Cs+ and TEA, indicating they were generated by potassium channel gating. The I-V relationships of the currents showed that the potassium currents measured at the peak current displayed more pronounced voltage-dependent activation than the currents measured at the end of the pulses (Fig. 5B
). Application of GIP (107 M) reduced the amplitude of both early and delayed potassium currents. The inhibitory effect of GIP on the maximal transient current occurred without modification of the activation threshold and reached 25.5 ± 1.5% at +10 mV (n = 5, Fig. 5B
).
|
| Discussion |
|---|
|
|
|---|
An abnormal plasma cortisol response to the 5-HT4 receptor agonist cisapride was observed in patient 1 (22). Surprisingly, the present in vitro studies revealed that cisapride had no effect on cortisol production from H1 cells. These results indicate that the abnormal in vivo cortisol response to cisapride was not the consequence of a direct effect of the drug on corticosteroidogenic cells but rather resulted from an indirect mechanism. Consistent with the lack of action of cisapride on cultured H1 cells, our in vitro experiments revealed that the stimulatory effect of 5-HT on cortisol secretion was not inhibited by the specific 5-HT4 receptor antagonist GR 113808. Similarly, we noticed that cisapride or metoclopramide had no influence on the secretory activity of H2 and H3 cells. These results demonstrate the absence of functional 5-HT4 receptors in H1, H2, and H3 steroidogenic cells despite the occurrence of 5-HT4 receptor mRNAs in the 3 hyperplastic tissues. It can be proposed that 5-HT4 receptor mRNAs may not be translated into proteins, or the receptors may not be addressed to the plasmic membrane of steroidogenic cells in the three tissues. Our data also indicate that, in H1 and H2 cells, the action of 5-HT is mediated by an illegitimate 5-HT receptor. In the rat adrenal gland, 5-HT has been shown to stimulate aldosterone production through activation of 5-HT7 receptors positively coupled to AC and calcium influx (12, 25). Several observations indicate that, in H1 and H2 tissues, the cortisol response to 5-HT is mediated by 5-HT7 receptors: 1) the corticotropic effect of 5-HT was completely blocked by the 5-HT1/5-HT2/5-HT5/5-HT6/5-HT7 receptor antagonist methiothepin; 2) the stimulatory action of 5-HT was inhibited by the 5-HT2/5-HT7 receptor antagonist LY 215840; 3) 5-HT-induced cortisol secretion was inhibited by the PKA inhibitor H-89, excluding the possible involvement of 5-HT2 receptors that are not positively coupled to AC (26); 4) RT-PCR analyses showed the occurrence of mRNAs encoding the 5-HT7a and 5-HT7b receptor variants in hyperplasia extracts; and 5) 5-HT7 receptor-like immunoreactivity was visualized in a subpopulation of steroidogenic cells, as well as in blood vessels of the tissues. Finally, we have tested, on a normal adrenal gland, the effect of the novel specific 5-HT7 receptor antagonist SB 269970 (27), which was not available at the time our studies on hyperplastic tissues were conducted. Consistent with the absence of 5-HT7 receptor immunoreactivity in steroidogenic cells, we observed that SB 269970 had no influence on the cortisol response of normal adrenocortical cells to 5-HT. Collectively, these data provide the first demonstration of the presence of functional illegitimate 5-HT7 receptors in adrenocortical hyperplasias causing Cushings syndrome (Table 2
). Because numerous cells producing 5-HT were seen in the hyperplastic cortex of patient 1 (22), we have hypothesized that 5-HT7 receptors may mediate a direct intraadrenal serotonergic tone involving paracrine and autocrine mechanisms. The occurrence of 5-HT7 receptors in blood vessels of AIMAH also argues in favor of an indirect control of steroidogenic cells by 5-HT through an increase in blood flow. In view of these observations, a potential therapeutic use of 5-HT7 receptor antagonists can be envisaged in some AIMAH to inhibit both direct and indirect stimulatory effects of 5-HT on corticosteroidogenesis.
|
We have also investigated the possible involvement of voltage-activated currents in the response of AIMAH cells to activation of ectopic receptors. In agreement with previous studies conducted in rat, bovine, and human adrenocortical cells (12, 13, 18, 19), we characterized the presence of rapidly inactivating low-voltage-activated T-type calcium currents in AIMAH cells. Stimulation of calcium influx through T-type calcium channels in response to ACTH has been described in bovine adrenocortical cells (13, 14, 32). By contrast, it has been reported that L-type calcium channels are not involved in basal and ACTH-induced cortisol secretion in humans (33). We have also demonstrated that T-type, but not L-type and N-type, calcium channels are involved in the steroidogenic response to 5-HT in frog, rat, and human adrenocortical cells (12, 34, 35). Here, we show that activation of the ectopic AC-coupled 5-HT7 or GIP receptors enhanced T-type calcium currents in AIMAH cells (Table 2
). In addition, the lack of effect of nifedipine on GIP-stimulated cortisol production in H2 cells reinforces the idea that the ectopic GIP receptors are not coupled to L-type calcium channels. It has been shown that, in adrenocortical cells, ACTH-induced calcium entry through T-type calcium channels results from activation of the cAMP pathway (14). The fact that H-89 significantly decreased the GIP-evoked enhancement of calcium currents in H2 cells indicates that PKA mediated the effect of GIP on the calcium conductance. By contrast, activation of hCG receptors, which were not coupled to AC in H3 cells, did not modify the T-type calcium current in this lesion. Altogether, these data reveal the contribution of T-type calcium channels in the transduction mechanism associated with ectopic receptors in AIMAH. Because calcium is known to play an important role in the steroidogenic response to ligands of AC-coupled receptors (12, 13, 14, 32, 34), it is likely that calcium mediates in part the stimulatory effects of 5-HT and GIP on cortisol production in AIMAHs.
Numerous potassium channel types control the resting potential of the plasma membrane and thereby regulate cellular electrical activity. The present electrophysiological study revealed that AIMAH cells generate transient and sustained potassium currents, as previously reported for rat, bovine, and human adrenocortical cells (18, 19, 20, 36). Patch-clamp recordings performed on H2 cells demonstrated that activation of AC-coupled GIP receptors reduced the amplitude of the two potassium current types (Table 2
). Consistent with the stimulus-secretion coupling concept, the present results suggest that, in AIMAH cells, potassium channels function as sensors, coupling activation of illegitimate receptors to membrane depolarization, which in turn may stimulate calcium entry through T-type calcium channels, which consequently stimulates cortisol secretion.
In conclusion, the present study has shown that, in AIMAH tissues, the steroidogenic response to 5-HT can be mediated by ectopic 5-HT7 receptors. The results also indicate that illegitimate receptors for 5-HT, GIP, and hCG control cortisol secretion through activation of the AC/PKA and/or alternative pathways. Our data demonstrate for the first time that activation of illegitimate adrenal receptors, i.e. 5-HT7 and GIP receptors, is able to enhance T-type calcium current via activation of the PKA pathway and/or decrease transient and sustained potassium currents. Reciprocal modulation of voltage-activated calcium and potassium currents might induce a calcium influx responsible for an increase in cortisol secretion. Finally, the characterization of the pharmacological profiles of ectopic receptors in AIMAH provides opportunities for development of new pharmacological therapies. Because numerous adrenal hyperplastic tissues express more than one type of illegitimate receptor, drugs targeted to common transduction mechanisms of illegitimate receptors, including T-type calcium channel blockers, may prove useful for reducing cortisol synthesis and/or cellular proliferation in AIMAH.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online September 5, 2006
1 This work is dedicated to the memory of Vincent Contesse, a brilliant researcher and a beloved friend. ![]()
Abbreviations: AC, Adenylyl cyclase; AIMAH, ACTH-independent macronodular adrenal hyperplasia; GIP, gastric inhibitory polypeptide; hCG, human chorionic gonadotropin; 5-HT, serotonin; I-V, current-voltage; PKA, protein kinase A.
Received March 9, 2006.
Accepted August 30, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E Louiset, V Contesse, L Groussin, D Cartier, C Duparc, V Perraudin, J Bertherat, and H Lefebvre Expression of vasopressin receptors in ACTH-independent macronodular bilateral adrenal hyperplasia causing Cushing's syndrome: molecular, immunohistochemical and pharmacological correlates J. Endocrinol., January 1, 2008; 196(1): 1 - 9. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |