help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-1065
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rautanen, A.
Right arrow Articles by Kajantie, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rautanen, A.
Right arrow Articles by Kajantie, E.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 11 4544-4551
Copyright © 2006 by The Endocrine Society

Associations of Body Size at Birth with Late-Life Cortisol Concentrations and Glucose Tolerance Are Modified by Haplotypes of the Glucocorticoid Receptor Gene

Anna Rautanen, Johan G. Eriksson, Juha Kere, Sture Andersson, Clive Osmond, Pentti Tienari, Heikki Sairanen, David J. P. Barker, David I. W. Phillips, Tom Forsén and Eero Kajantie

Departments of Medical Genetics (A.R., J.K.) and Neurology (P.T.), Biomedicum Helsinki, Finnish Genome Center (A.R.), and Department of Public Health (J.G.E.), University of Helsinki, FIN-00014 Helsinki, Finland; Department of Epidemiology and Health Promotion (A.R., J.G.E., T.F., E.K.), National Public Health Institute, FIN-00300 Helsinki, Finland; Department of Biosciences and Nutrition and Clinical Research Center (J.K.), Karolinska Institutet, SE-14157 Huddinge, Sweden; Hospital for Children and Adolescents (S.A., H.S., E.K.), Helsinki University Central Hospital, FIN-00029 HUS Helsinki, Finland; and Medical Research Council Epidemiology Resource Centre (C.O.) and Developmental Origins of Health and Disease Centre (D.J.P.B., D.I.W.P.), University of Southampton, Southampton SO16 6YD, United Kingdom

Address all correspondence and requests for reprints to: Eero Kajantie, M.D., Ph.D., Department of Epidemiology and Health Promotion, National Public Health Institute, Mannerheimintie 166, FIN-00300 Helsinki, Finland. E-mail: eero.kajantie{at}helsinki.fi.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Small body size at birth is associated with cardiovascular disease and type 2 diabetes in adult life. This link may be in part mediated by early-life programming of the hypothalamic-pituitary-adrenal axis (HPAA) function.

Objective: Our objective was to assess whether haplotypes of the glucocorticoid receptor (GR) gene modify this link.

Design and Participants: We conducted a birth cohort study that included 437 men and women born in Helsinki, Finland, during 1924–1933, whose birth measurements were recorded.

Main Outcome Measures: We studied how the oral glucose tolerance test and fasting plasma total and free cortisol concentrations and, in a subset of 162 women, a more detailed HPAA evaluation, are predicted by body size at birth and haplotypes of the GR locus. We also measured the haplotype-specific relative mRNA expression level for the haplotype of interest.

Results: One of the haplotypes was associated with lower birth weight and length and higher fasting plasma and mean 24-h salivary cortisol. Moreover, this haplotype modified the association of length at birth with adult phenotypes; in carriers, short length at birth was associated with increased fasting plasma cortisol, cortisol/corticosteroid-binding globulin ratio, impaired glucose tolerance or diabetes [1 cm decrease corresponded to 1.36-fold odds ratio; 95% confidence interval (CI), 1.09–1.70; P = 0.007], and higher 120-min glucose (5.8%; 95% CI, 2.5–9.1%; P = 0.0007), but no association was seen in noncarriers (P for interaction was 0.06, 0.01, 0.02, and 0.01, respectively). The mRNA expression level of this haplotype was 93.7% (95% CI, 90.5–96.8%; P = 2.2 x 10–4) of the expression level of the other haplotypes.

Conclusions: A common GR haplotype may contribute to and modify the association of short length at birth with adult glucose tolerance and HPAA function by a mechanism that affects regulation of GR expression.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
SMALL BODY SIZE at birth is associated with a number of adverse late-life health outcomes including higher rates of cardiovascular disease (1, 2) and type 2 diabetes (3, 4). Evidence from animal experiments (5, 6) and epidemiological studies (7, 8) has suggested that lifelong programming of the hypothalamic-pituitary-adrenal axis (HPAA) by intrauterine glucocorticoid excess is likely to play a key role in mediating this association. However, the relationship of body size and gestational age at birth, commonly used markers of fetal environment in epidemiological studies, with indicators of adult HPAA function has not been consistent in all birth cohort studies (9, 10, 11, 12). Moreover, animal studies suggest that the late-life consequences depend largely on the timing and nature of the stimulus and the species involved (13). Because of the significant heritability of type 2 diabetes-related traits (14) as well as fetal growth (15), it would be valuable to incorporate both the genetic factors and these recognized markers of fetal environment in the studies of glucose regulation; this has so far been largely neglected.

Glucocorticoids that are produced in response to signals from the HPAA have an important role in the regulation of glucose metabolism and fetal development. Glucocorticoids, including cortisol, mediate their cellular action by complexing with the cytoplasmic glucocorticoid receptor (GR), which then translocates to the nucleus and functions as a transcription factor. Therefore, GR is an attractive candidate gene to be involved in the link between HPAA function and early-life conditions resulting in later-life metabolic diseases.

Response to glucocorticoids varies greatly between individuals, which has in part been attributed to variation in the GR gene, although the exact causative polymorphisms have not been confirmed. Such polymorphisms could influence the amount of intrauterine glucocorticoid exposure on fetal growth and, perhaps, glucocorticoid metabolism later in life. The following three polymorphisms in the GR gene locus have been studied extensively: BclI restriction site and N363S polymorphisms have been associated with increased glucocorticoid sensitivity (16, 17) and consequently with unfavorable cardiovascular and metabolic profiles, whereas the ER22/23EK seems to show the opposite associations, including lower fasting insulin and serum total and low-density lipoprotein cholesterol concentrations in elderly subjects (18) and even lower all-cause mortality (19). The N363S variant has been associated with increased salivary cortisol responses to psychosocial stress (20) and in several studies with obesity (16, 21, 22), although these associations have been questioned by a number of negative reports (23, 24, 25). Similarly, the BclI polymorphism has been associated with abdominal obesity, higher systolic blood pressure, and higher cortisol levels (26), but also negative studies have been published (27, 28). BclI has also been associated with a lower cortisol response to psychosocial stress (20). Thus far, none of these polymorphisms has been associated with type 2 diabetes or impaired glucose tolerance (21, 22).

We are unaware of any earlier studies incorporating early-life factors in assessing the effects of genetic variations in the GR gene. We have examined within the Helsinki Birth Cohort, with detailed birth measurements available, whether the relationship of size at birth with adult HPAA function and glucose tolerance is dependent on different haplotypes of the GR gene. We focused on the haplotype structure, instead of individual rare polymorphisms, to consider major common variation within the GR gene locus.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The Helsinki Birth Cohort Study includes 7086 men and women who were born as singletons at Helsinki University Central Hospital during 1924–1933. From this cohort, a total of 473 randomly selected subjects whose birth records included dates of birth and last menstrual period and weight and length at birth attended a clinical study, including anthropometry, a 75-g oral glucose tolerance test (4), measurement of serum cortisol and corticosteroid-binding globulin (CBG) concentrations (9), and a blood sample for DNA extraction. Free cortisol index (FCI) was calculated by the following formula: FCI = [cortisol (µmol/liter)/CBG (mg/ml) x 100]. There were 16 sibling pairs within the study sample. To ensure that possible associations were attributable to the GR gene locus, one randomly chosen subject from each sibling pair was excluded. Of these 457 individuals, we were able to assess the GR haplotype for 437 subjects (163 men and 274 women). Of these subjects, 93 (21%) had type 2 diabetes and 123 (28%) impaired glucose tolerance according to the criteria recommended by the World Health Organization (29), American Diabetes Association (30), and International Diabetes Federation (global guideline for type 2 diabetes, available at www.idf.org). The prevalence is similar to that previously described in elderly Finnish people (31). The 24 subjects receiving medication for diabetes were included in the study but excluded from the analyses of glucose and insulin concentrations because these may be affected by the medication.

Of these 437 subjects, 162 women had in addition taken part in a more detailed evaluation of HPAA function consisting of an overnight 0.25-mg dexamethasone test followed by a low-dose (1 µg) ACTH1–24 test (10) and a 24-h collection of salivary cortisol samples in their normal daily environment at awakening, 15 and 30 min thereafter, and at 1200, 1700, and 2200 h and the following morning (11). This relatively labor-intensive protocol allowed us to assess the association of the GR genotype with HPAA function in more detail, although the sample size was not sufficient for a meaningful analysis of interactive effects with size at birth. Compared with the rest of the women, those who took part in the more detailed HPAA examination had similar size and gestational age at birth (all P > 0.3) and similar height, body mass index (BMI), fasting cortisol, and CBG concentrations at examination, although they were slightly younger at the time of the baseline examination (69.3 vs. 70.0 yr, P = 0.05).

Genotyping

Fifteen single-nucleotide polymorphism (SNP) markers, located in the GR gene locus on chromosome 5q31, were selected from the public Ensembl human genome browser database (http://www.ensembl.org/Homosapiens/). The selected SNPs were evaluated by genotyping 91 individuals with a single-nucleotide primer extension (SNuPe)-based method. Uninformative markers (minor allele frequency < 0.05) were discarded and the rest of the samples were genotyped with six polymorphic SNPs. PCR assays were performed as described (32), followed by the allelic discrimination reactions by using the MegaBACE SNuPe genotyping kit (Amersham Biosciences, Piscataway, NJ) as described (33). All primers were designed by using the Primer3 program (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and are available upon request. Genotypes followed Hardy-Weinberg equilibrium.

Haplotype construction

SNP rs6188 was in complete linkage disequilibrium with rs258813 and was therefore excluded. Haplotypes were inferred with SNPHAP software (http://www-gene.cimr.cam.ac.uk/clayton/software/snphap.txt/) by using the genotypes of the following five SNPs: rs6196, rs258813, rs4986593, rs852984, and rs6195 (Fig. 1Go). Haplotypes with confidence values over 0.9 were accepted in the association analysis.


Figure 1
View larger version (58K):
[in this window]
[in a new window]
 
FIG. 1. Structure of the GR gene locus on chromosome 5q31 and linkage disequilibrium between SNPs according to HapMap (data release no. 19) and Haploview. A, SNPs that we used to create the haplotypes are shown by the reference SNP ID numbers (beginning with rs). In addition, the locations of ER22/23EK (R23K) and BclI polymorphisms are shown by arrows. Light gray boxes represent untranslated exons (exon 1 and part of exon 9{alpha}). Multiple alternative first exons are known, which are not shown. Also, 9{alpha} and 9ß are alternative exons, 9{alpha} being the transcriptionally active form. B, Common haplotypes and their frequencies according to HapMap (H), the present study (R), and a study by Stevens et al. (34 ) (S). Green boxes represent SNPs that differ from the most common, type 1 haplotype. Orange/red boxes represent SNPs that we have used to generate the haplotypes. Haplotype frequencies are shown in the far right boxes.

 
Data analysis

Log transformation was used to symmetrize the distributions of glucose, insulin, and salivary cortisol concentrations. Where variables were adjusted, e.g. for age, sex, and BMI, this was done by adding the mean value of the unadjusted variable to the residuals from a multiple regression analysis with age, sex, and BMI as the predictor variables. Interactions between a binary haplotype and a continuous predictor were tested by including in a regression analysis both terms and their product. The product term measures directly the difference in slope of the outcome variable on the continuous predictor in the two subgroups defined by the genotype. All analyses were performed with SPSS version 12.0.1.

Expression analysis

Because haplotype 3, which was consistently associated with the phenotypic data, does not include any known amino acid changing SNPs, we measured the relative haplotype-3-specific mRNA expression level. DNA samples were screened to find three heterozygous individuals for a silent coding SNP that tags haplotype 3 (rs6196). RNA of these three heterozygous individuals was extracted from frozen human thymus tissue by TRIzol (Invitrogen, Carlsbad, CA). The extracted RNA was further purified using the RNAeasy total RNA isolation kit (QIAGEN, Chatsworth, CA), followed by DNase (QIAGEN) treatment to eliminate genomic DNA contamination. First-strand cDNA was synthesized from 0.5 µg total RNA in a 25-µl reaction volume by RT using random hexamers (Promega, Madison, WI) and M-MLV reverse transcriptase (Promega). A transcript containing rs6196 in exon 9{alpha} was PCR amplified by using 2 µl cDNA as a template and forward primer in exon 7 (TGAAAACCTTACTGCTTCTCTCTTC) and reverse primer in exon 9 (CGACTTTCTTTAAGGCAACCA). This prevents the amplification of remaining genomic DNA because the two introns are too long to be amplified by PCR. After the quality check by agarose gel electrophoresis, RT-PCR products were purified enzymatically with Exo-SAPit (Amersham Biosciences) by incubating at 37 C for 60 min and heat inactivated at 72 C for 15 min. Genomic DNA of the same individuals was PCR amplified by using the forward primer in intron 8 (TGAGATGTTCCCACTGACCA) and the reverse primer shown above. Purified products were then sequenced using the forward primers. RT was performed twice for each three individual RNA samples, each cDNA sample was PCR amplified twice, and each RT-PCR product was sequenced twice, producing finally eight measurements for each individual RNA sample. Each genomic DNA sample was PCR amplified four times, followed by sequencing in duplicate, giving eight independent measurements altogether. Allele peak height ratio of allele C (tags haplotype 3) and allele T was measured, and values of genomic DNA were used as a reference value to compensate for the unequal amplification of the alternative alleles. The C/T allele peak height ratios of genomic DNA were compared with cDNA measurements by using linear regression where dummy variables for individual samples were used as covariates (SPSS version 12.0.1).

The study protocol was approved by the ethics committees of Helsinki University Central Hospital and the National Public Health Institute, and informed written consent was obtained from each participant.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Haplotype frequencies

Four common haplotypes covered 96.5% of the observed haplotypes. Table 1Go shows the distribution of the haplotypes numbered from 1–6 by decreasing frequency. The whole GR gene is located within a single linkage disequilibrium block, as assessed from the HapMap data (HapMap data release no. 19) using the Haploview software (Fig. 1Go). We were able to match our haplotypes to those shown by HapMap and by Stevens et al. (34).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Haplotype frequencies

 
Size at birth

Mean birth weight of men was 3454 g (range, 1980–4620 g) and length at birth 50.3 cm (44.0–54.5 cm), and those of women were 3289 g (1770–5070 g) and 49.7 cm (43.0–57.0 cm). Haplotype 3 of the GR locus was associated with size at birth; carriers of this haplotype had lower birth weight and length at birth compared with noncarriers (Table 2Go). GR haplotype was unrelated to ponderal index, which is a measure of newborn thinness, and gestational age at birth.


View this table:
[in this window]
[in a new window]
 
TABLE 2. The relationship of GR haplotype 3 with size and gestational age at birth and fasting cortisol concentration and free cortisol index in all study subjects (163 men and 274 women) and with detailed assessment of HPAA function performed in 162 women

 
HPAA function

GR gene haplotype 3 was weakly associated with increased fasting serum total cortisol concentrations and free cortisol index (Table 2Go) but not with CBG concentration. More detailed assessment of HPAA function performed in 162 women showed that haplotype 3 was associated with increased morning salivary cortisol (awakening response and a single measurement next morning) and mean salivary cortisol concentration during a 24-h follow-up and, by marginal significance, with increased cortisol concentration after 1 µg ACTH1–24 stimulation (Table 2Go). No relationship was seen with overnight 0.25 mg dexamethasone suppression.

Interactive effects with size at birth on HPAA function

Table 3Go shows that the relationship between GR haplotype and cortisol concentrations was dependent on length at birth. Because of the small number of haplotype 3 homozygotes (22), we present combined data for all haplotype 3 carriers. Haplotype 3 was associated with high fasting total and free cortisol only in subjects who were short at birth. Conversely, short length at birth predicted high cortisol only in carriers of haplotype 3. In these subjects, a 1-cm decrease in length at birth corresponded to 15.2 [95% confidence interval (CI), 0.3–30.2] nmol/liter increase in total cortisol, whereas in noncarriers, no relationship was seen (1 cm corresponding to –1.5; 95% CI, –8.5 to 11.5 nmol/liter change). The P values for interaction between the effects of length at birth and haplotype 3 were 0.06 for total cortisol and 0.01 for free cortisol index.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Serum fasting total cortisol concentration and free cortisol index in 65 to 75-year-old subjects according to length at birth and glucocorticoid receptor gene (GR) haplotype

 
Interactive effects with size at birth on glucose tolerance

Within the total study group, GR haplotype was unrelated to the prevalence of diabetes, impaired glucose tolerance, or glucose concentrations during an oral glucose tolerance test. Because we have previously shown in this cohort that small body size at birth predicts impaired/reduced glucose tolerance and type 2 diabetes (4), we assessed whether this relationship is different in subjects with different GR haplotypes (Table 4Go). In subjects with GR haplotype 3, 1 cm of decrease in length at birth was associated with a 1.36-fold odds ratio (95% CI, 1.09–1.70; P = 0.007) for developing impaired glucose tolerance or type 2 diabetes and 5.8% (95% CI, 2.5–9.1%; P = 0.0007) higher 120-min glucose at an oral glucose tolerance test, whereas in noncarriers of this haplotype, there was no association, corresponding odds ratio being 0.99 (95% CI, 0.85–1.16; P = 0.9) and change in 120-min glucose –0.2% (–3.2 to 2.8%; P = 0.9). Interaction between the effects of length at birth and haplotype 3 were significant for impaired glucose tolerance or type 2 diabetes (P = 0.02) and 120-min glucose (P = 0.01). Also, higher fasting glucose concentrations were associated with short length at birth in haplotype 3 carriers (P = 0.03) but not in noncarriers (P = 0.8) (P for interaction = 0.07).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Glucose tolerance in 65- to 75-yr-old subjects according to length at birth and GR haplotype

 
Allele-specific expression

As calculated from sequencing electropherogram (Fig 2Go), the average C/T allele peak height ratios were 0.831 (SD, 0.043) for genomic DNA and 0.778 (SD, 0.047) for cDNA samples. Therefore, the expression level of allele C, which tags haplotype 3, is 93.7% (95% CI, 90.5–96.8%; P = 2.2 x 10–4) of the expression level of allele T, which refers to the other haplotypes.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2. Relative haplotype-3-specific mRNA expression levels. Genomic DNA sequencing was carried out in parallel with cDNA sequencing of three individuals, and each measurement was repeated eight times. A, Electropherogram of sequencing reactions. Arrows show the heterozygous SNP rs6196; allele C (blue) tags the risk haplotype 3. B, Boxplot (median, range, and 25th and 75th percentiles) of allele peak height ratios in DNA and cDNA samples.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
We found that a common haplotype (haplotype 3) in the GR gene is associated with short length and low weight at birth and higher indices of HPAA function in later life. This finding supports the hypothesis that common variation in the GR gene may act as a mediator of the relationship between size at birth and adult HPAA function. Our findings were, however, not limited to these direct associations. Relationships of short length at birth with adult HPAA function and impaired glucose regulation were confined to carriers of haplotype 3, suggesting that these individuals are more susceptible to early-life programming of these adult phenotypes. Furthermore, haplotype 3 was associated with reduced expression of the GR gene, supporting a causative role of this haplotype in explaining these relationships.

The search for genes underlying multifactorial diseases has been unrewarding. One of the major critiques concerning the large-scale genetic association studies has been their inability to incorporate environmental factors. The developmental origins of health and disease hypothesis proposes that environmental factors during early life cause lifelong alterations in the functions of different organs that have large impact on disease risk, i.e. susceptibility to adult diseases is programmed during early life (1, 35). Attempts have also been made to explain the association between small size at birth and adult disease by the genetic hypothesis suggesting that these phenotypes are merely two independent outcomes of the same genotype. Originally, this hypothesis was presented as the fetal insulin hypothesis, which proposes that genetic factors determine insulin resistance, which results in low birth weight (36). In the current study, we propose a synthesis of these hypotheses suggesting that an individual’s susceptibility to specific mechanism of programming is affected by his/her genetic make-up.

Our present findings add to our previous observations in the Helsinki Birth Cohort Study that have shown interactions between the effects of body size at birth and certain well-established genetic variants on late-life glucose tolerance and related phenotypes. These variants include Pro12Ala polymorphism of the peroxisome proliferator-activated receptor {gamma} (PPAR-{gamma}2) (4), K121Q polymorphism in plasma cell glycoprotein 1 (PC-1) (37), and the insertion/deletion polymorphism of the angiotensin-converting enzyme (ACE) (32) genes. These findings can be interpreted as examples of interactions between genotype and intrauterine environment with resulting changes in gene expression.

Previous studies of GR gene have focused primarily on the following three polymorphisms: N363S (rs6195), ER22/23EK (two SNPs in complete linkage disequilibrium, rs6189 and rs6190), and intronic BclI restriction site polymorphism formerly known as 2.3- and 4.5-kb alleles, but recently identified to constitute a C to G substitution in intron 2 (17). Locations for these polymorphisms are shown in Fig. 1AGo. Instead of these individual polymorphisms, we chose to study the haplotype structure of the GR gene to encompass a major proportion of common variation in the gene. Furthermore, we excluded very rare polymorphisms because they have potential to explain only a very small fraction of variation in response to glucocorticoids seen between individuals.

Rs6195 (N363S) resides in the haplotype (haplotype 5) that differs from the most common haplotype only by this one SNP. In our material, rs6195 did not associate with any measured phenotype (data not shown), although the power of the present study was not sufficient to assess the correlates of this relatively rare polymorphism. SNPs rs6189 and rs6190 (ER22/23EK) have been reported to be relatively rare (1.6%) (34). In our pilot genotyping of 91 individuals, they were monomorphic and were therefore discarded from the current study. According to a recent comprehensive analysis of haplotype structure of the GR locus by Stevens et al. (34), the haplotype including the ER22/23EK polymorphism differs from our haplotype 4 only by these two SNPs. Although these researchers used a largely different set of SNPs in their haplotype analysis, we were able to match our haplotypes to theirs (shown in Fig. 1BGo in addition to haplotypes according to HapMap). Our observed haplotype frequencies correspond well to those shown by Stevens et al. (34) and HapMap data (Fig. 1BGo). We did not genotype the BclI polymorphism, but all carriers of haplotype 2 and haplotype 3 have been reported to carry also the BclI 4.5-kb allele (34) (see Fig. 1BGo). We are unaware of any studies assessing the effect of the noncoding BclI polymorphism on gene expression. It is possible that this polymorphism and haplotype 3 in the present study may reflect the same causative variant.

The rs6196 (N766N) polymorphism, which tags our haplotype 3, has not been studied as extensively as the above mentioned three polymorphisms. It has, however, been associated with systemic lupus erythematosus in the Japanese population (38). In the study by Stevens et al. (34), the haplotype that corresponds to our haplotype 3 was associated with low post-dexamethasone cortisol. Although we did not observe this association, our results are difficult to compare because no other assessment of HPAA function was performed in their study (34). As Fig. 1Go shows, haplotype 3 is the most diverged one from the most common haplotype 1, which makes it even more interesting as a risk haplotype.

Because haplotype 3 does not include any known coding nonsynonymous SNPs, we assumed that its phenotypic effects are most probably based on the altered allele-specific expression level of GR. Indeed, we found that the mRNA expression level of haplotype 3 in human thymus was consistently lower than that of the other haplotypes. The expression level of GR is critical for cell function; a 30–50% reduction of GR expression level has been shown to result in severe neuroendocrine, metabolic, and immunological abnormalities in transgenic mice (39). Our findings suggest that even a lesser reduction in the expression level could play a role in explaining normal phenotypic variation between individuals. That the association of body size at birth with adult glucose tolerance and HPAA function was confined to carriers of haplotype 3 implies an interaction between genotype and intrauterine environment. Whether this is explained by a more pronounced haplotype-specific decrease of GR expression level in individuals who were born small remains to be confirmed. The haplotype 3 tagging SNP (rs6196) resides in exon 9{alpha}; therefore, our expression studies exclude the GR-ß splice variant, which is transcriptionally inactive but serves as a dominant-negative inhibitor of the GR-{alpha} isoform (40).

Because the negative feedback mechanism of the HPAA is dependent on GRs, decreased GR expression could lead to higher cortisol levels as a result of impaired feedback control. Superficially, this may seem to be in contrast with our finding of no difference in dexamethasone-suppressed cortisol and a previous finding of augmented dexamethasone suppression (34) associated with haplotype 3. However, the dexamethasone suppression test is mostly an indicator of suppression at the pituitary level because dexamethasone does not pass freely through the blood-brain barrier (41). Reduced GR expression at the higher levels of the axis such as hypothalamus or hippocampus could as well lead to increased HPAA activity, although this remains speculative because specific assessment of negative feedback at these levels is difficult by any functional HPAA tests. Similarly, for obvious reasons, we were unable to measure the haplotype-3-specific GR expression in these sites. Although we cannot exclude tissue-specific differences, thymus, which we used, is expected to be as valid as any other tissue, because GR is ubiquitously expressed. Moreover, we found that other measures of HPAA function, such as cortisol after ACTH stimulation and 24-h salivary cortisol, were higher in haplotype 3 carriers than in noncarriers, indicating hyperactivity of the HPAA. Although the reduced GR expression in peripheral tissues could be expected to attenuate the effects of such hyperactivity, glucocorticoids are well known to induce insulin resistance in humans (42, 43), and impaired glucose tolerance and type 2 diabetes are key features of frank glucocorticoid excess caused by Cushing’s disease (44) or pharmacological treatment (43). Recent findings have suggested that normal individual variations in HPAA function are also associated with differences in glucose tolerance (9, 26, 45, 46), making variations in HPAA function, whether genetically or environmentally determined, plausible mechanisms to link early-life events with impaired glucose tolerance and type 2 diabetes in adult life.

We conclude that a common GR haplotype, which affects gene expression, modifies the association between short length at birth and HPAA function and glucose tolerance in adult life. The success of most large-scale genetic studies on type 2 diabetes and related traits has been limited. Our results illustrate the importance of incorporating both the genetic factors and determinants of early life in the studies aiming at understanding the etiology of glucose tolerance and related traits.


    Acknowledgments
 
We thank the personnel of the Finnish Genome Center and Hannele Pihlaja at the Department of Neurology, Helsinki University Central Hospital, for excellent technical assistance.


    Footnotes
 
This study was supported by Academy of Finland, British Heart Foundation, Finnish Foundation for Cardiovascular Research, Finnish Foundation for Diabetes Research, Finnish Foundation for Pediatric Research, Finnish Medical Societies (Duodecim and Finska Läkaresällskapet), Novo Nordisk Foundation, Päivikki and Sakari Sohlberg Foundation, Sigrid Jusélius Foundation, and Yrjö Jahnsson Foundation.

Disclosure statement: The authors have nothing to disclose.

First Published Online August 8, 2006

Abbreviations: BMI, Body mass index; CBG, corticosteroid-binding globulin; CI, confidence interval; GR, glucocorticoid receptor; HPAA, hypothalamic-pituitary-adrenal axis; SNP, single-nucleotide polymorphism.

Received May 17, 2006.

Accepted August 1, 2006.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Barker DJP, Osmond C, Winter PD, Margetts B, Simmonds SJ 1989 Weight in infancy and death from ischaemic heart disease. Lancet 2:577–580[Medline]
  2. Barker DJP, Osmond C, Forsén T, Kajantie E, Eriksson JG 2005 Trajectories of growth among children who later have coronary events. N Engl J Med 353:1802–1809[Abstract/Free Full Text]
  3. Lithell HO, McKeigue PM, Berglund L, Moshem R, Lithell UB, Leon DA 1996 Relation of size at birth to non-insulin dependent diabetes and insulin concentrations in men aged 50–60 years. BMJ 312:406–410[Abstract/Free Full Text]
  4. Eriksson JG, Forsen T, Tuomilehto J, Jaddoe VW, Osmond C, Barker DJ 2002 Effects of size at birth and childhood growth on the insulin resistance syndrome in elderly individuals. Diabetologia 45:342–348[CrossRef][Medline]
  5. Levitt NS, Lindsay RS, Holmes MC, Seckl JR 1996 Dexamethasone in the last week of pregnancy attenuates hippocampal glucocorticoid receptor gene expression and elevates blood pressure in the adult offspring in the rat. Neuroendocrinology 64:412–418[Medline]
  6. Nyirenda MJ, Lindsay RS, Kenyon CJ, Burchell A, Seckl JR 1998 Glucocorticoid exposure in late gestation permanently programs rat hepatic phosphoenolpyruvate carboxykinase and glucocorticoid receptor expression and causes glucose intolerance in adult offspring. J Clin Invest 101:2174–2181[Medline]
  7. Phillips DI, Walker BR, Reynolds RM, Flanagan DE, Wood PJ, Osmond C, Barker DJ, Whorwood CB 2000 Low birth weight predicts elevated plasma cortisol concentrations in adults from 3 populations. Hypertension 35:1301–1306[Abstract/Free Full Text]
  8. Reynolds RM, Walker BR, Syddall HE, Andrew R, Wood PJ, Phillips DI 2005 Is there a gender difference in the associations of birthweight and adult hypothalamic-pituitary-adrenal axis activity? Eur J Endocrinol 152:249–253[Abstract/Free Full Text]
  9. Kajantie E, Phillips DI, Andersson S, Barker DJ, Dunkel L, Forsen T, Osmond C, Tuominen J, Wood PJ, Eriksson J 2002 Size at birth, gestational age and cortisol secretion in adult life: foetal programming of both hyper- and hypocortisolism? Clin Endocrinol (Oxf) 57:635–641[CrossRef][Medline]
  10. Kajantie E, Eriksson J, Barker DJ, Forsen T, Osmond C, Wood PJ, Andersson S, Dunkel L, Phillips DI 2003 Birth size, gestational age and adrenal function in adult life: studies of dexamethasone suppression and ACTH1–24 stimulation. Eur J Endocrinol 149:569–575[Abstract]
  11. Kajantie E, Eriksson J, Osmond C, Wood PJ, Forsen T, Barker DJ, Phillips DI 2004 Size at birth, the metabolic syndrome and 24-h salivary cortisol profile. Clin Endocrinol (Oxf) 60:201–207[CrossRef][Medline]
  12. Ward AM, Syddall HE, Wood PJ, Chrousos GP, Phillips DI 2004 Fetal programming of the hypothalamic-pituitary-adrenal (HPA) axis: low birth weight and central HPA regulation. J Clin Endocrinol Metab 89:1227–1233[Abstract/Free Full Text]
  13. Welberg LA, Seckl JR 2001 Prenatal stress, glucocorticoids and the programming of the brain. J Neuroendocrinol 13:113–128[CrossRef][Medline]
  14. Kaprio J, Tuomilehto J, Koskenvuo M, Romanov K, Reunanen A, Eriksson J, Stengard J, Kesaniemi YA 1992 Concordance for type 1 (insulin-dependent) and type 2 (non-insulin-dependent) diabetes mellitus in a population-based cohort of twins in Finland. Diabetologia 35:1060–1067[CrossRef][Medline]
  15. Clausson B, Lichtenstein P, Cnattingius S 2000 Genetic influence on birthweight and gestational length determined by studies in offspring of twins. BJOG 107:375–381[Medline]
  16. Huizenga NA, Koper JW, De Lange P, Pols HA, Stolk RP, Burger H, Grobbee DE, Brinkmann AO, De Jong FH, Lamberts SW 1998 A polymorphism in the glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo. J Clin Endocrinol Metab 83:144–151[Abstract/Free Full Text]
  17. van Rossum EF, Koper JW, van den Beld AW, Uitterlinden AG, Arp P, Ester W, Janssen JA, Brinkmann AO, de Jong FH, Grobbee DE, Pols HA, Lamberts SW 2003 Identification of the BclI polymorphism in the glucocorticoid receptor gene: association with sensitivity to glucocorticoids in vivo and body mass index. Clin Endocrinol (Oxf) 59:585–592[CrossRef][Medline]
  18. van Rossum EF, Koper JW, Huizenga NA, Uitterlinden AG, Janssen JA, Brinkmann AO, Grobbee DE, de Jong FH, van Duyn CM, Pols HA, Lamberts SW 2002 A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes 51:3128–3134[Abstract/Free Full Text]
  19. van Rossum EF, Feelders RA, van den Beld AW, Uitterlinden AG, Janssen JA, Ester W, Brinkmann AO, Grobbee DE, de Jong FH, Pols HA, Koper JW, Lamberts SW 2004 Association of the ER22/23EK polymorphism in the glucocorticoid receptor gene with survival and C-reactive protein levels in elderly men. Am J Med 117:158–162[CrossRef][Medline]
  20. Wüst S, Van Rossum EF, Federenko IS, Koper JW, Kumsta R, Hellhammer DH 2004 Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. J Clin Endocrinol Metab 89:565–573[Abstract/Free Full Text]
  21. Lin RC, Wang XL, Dalziel B, Caterson ID, Morris BJ 2003 Association of obesity, but not diabetes or hypertension, with glucocorticoid receptor N363S variant. Obes Res 11:802–808[Medline]
  22. Dobson MG, Redfern CP, Unwin N, Weaver JU 2001 The N363S polymorphism of the glucocorticoid receptor: potential contribution to central obesity in men and lack of association with other risk factors for coronary heart disease and diabetes mellitus. J Clin Endocrinol Metab 86:2270–2274[Abstract/Free Full Text]
  23. Echwald SM, Sorensen TI, Andersen T, Pedersen O 2001 The Asn363Ser variant of the glucocorticoid receptor gene is not associated with obesity or weight gain in Danish men. Int J Obes Relat Metab Disord 25:1563–1565[CrossRef][Medline]
  24. Rosmond R, Bouchard C, Bjorntorp P 2001 Tsp509I polymorphism in exon 2 of the glucocorticoid receptor gene in relation to obesity and cortisol secretion: cohort study. BMJ 322:652–653[Free Full Text]
  25. Marti A, Ochoa MC, Sanchez-Villegas A, Martinez JA, Martinez-Gonzalez MA, Hebebrand J, Hinney A, Vedder H 2006 Meta-analysis on the effect of the N363S polymorphism of the glucocorticoid receptor gene (GRL) on human obesity. BMC Med Genet 7:50
  26. Rosmond R, Chagnon YC, Holm G, Chagnon M, Perusse L, Lindell K, Carlsson B, Bouchard C, Björntorp P 2000 A glucocorticoid receptor gene marker is associated with abdominal obesity, leptin, and dysregulation of the hypothalamic-pituitary-adrenal axis. Obes Res 8:211–218[Medline]
  27. Panarelli M, Holloway CD, Fraser R, Connell JM, Ingram MC, Anderson NH, Kenyon CJ 1998 Glucocorticoid receptor polymorphism, skin vasoconstriction, and other metabolic intermediate phenotypes in normal human subjects. J Clin Endocrinol Metab 83:1846–1852[Abstract/Free Full Text]
  28. Koper JW, Stolk RP, de Lange P, Huizenga NA, Molijn GJ, Pols HA, Grobbee DE, Karl M, de Jong FH, Brinkmann AO, Lamberts SW 1997 Lack of association between five polymorphisms in the human glucocorticoid receptor gene and glucocorticoid resistance. Hum Genet 99:663–668[CrossRef][Medline]
  29. Alberti KG, Zimmet PZ 1998 Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15:539–553[CrossRef][Medline]
  30. American Diabetes Association 2006 Diagnosis and classification of diabetes mellitus. Diabetes Care 29:S43–S48
  31. Hiltunen L 2005 Ten year mortality and glucose tolerance status in an elderly Finnish population. Diabet Res Clin Pract 69:81–87[CrossRef][Medline]
  32. Kajantie E, Rautanen A, Kere J, Andersson S, Yliharsila H, Osmond C, Barker DJ, Forsen T, Eriksson J 2004 The effects of the ACE gene insertion/deletion polymorphism on glucose tolerance and insulin secretion in elderly people are modified by birth weight. J Clin Endocrinol Metab 89:5738–5741[Abstract/Free Full Text]
  33. Rautanen A, Zucchelli M, Makela S, Kere J 2005 Gene mapping with pooled samples on three genotyping platforms. Mol Cell Probes 19:408–416[CrossRef][Medline]
  34. Stevens A, Ray DW, Zeggini E, John S, Richards HL, Griffiths CE, Donn R 2004 Glucocorticoid sensitivity is determined by a specific glucocorticoid receptor haplotype. J Clin Endocrinol Metab 89:892–897[Abstract/Free Full Text]
  35. Gillman MW 2005 Developmental origins of health and disease. N Engl J Med 353:1848–1850[Free Full Text]
  36. Hattersley AT, Tooke JE 1999 The fetal insulin hypothesis: an alternative explanation of the association of low birthweight with diabetes and vascular disease. Lancet 353:1789–1792[CrossRef][Medline]
  37. Kubaszek A, Markkanen A, Eriksson JG, Forsen T, Osmond C, Barker DJ, Laakso M 2004 The association of the K121Q polymorphism of the plasma cell glycoprotein-1 gene with type 2 diabetes and hypertension depends on size at birth. J Clin Endocrinol Metab 89:2044–2047[Abstract/Free Full Text]
  38. Lee YM, Fujiwara J, Munakata Y, Ishii T, Sugawara A, Kaku M, Kokubun S, Sasaki T, Funato T 2004 A mutation of the glucocorticoid receptor gene in patients with systemic lupus erythematosus. Tohoku J Exp Med 203:69–76[CrossRef][Medline]
  39. Pepin MC, Pothier F, Barden N 1992 Impaired type II glucocorticoid-receptor function in mice bearing antisense RNA transgene. Nature 355:725–728[CrossRef][Medline]
  40. Zhou J, Cidlowski JA 2005 The human glucocorticoid receptor: one gene, multiple proteins and diverse responses. Steroids 70:407–417[CrossRef][Medline]
  41. Meijer OC, de Lange EC, Breimer DD, de Boer AG, Workel JO, de Kloet ER 1998 Penetration of dexamethasone into brain glucocorticoid targets is enhanced in mdr1A P-glycoprotein knockout mice. Endocrinology 139:1789–1793[Abstract/Free Full Text]
  42. Perley M, Kipris DM 1964 Effect of glucocorticoids on plasma insulin. N Engl J Med 274:1237–1241
  43. Pagano G, Cavallo-Perin P, Cassader M, Bruno A, Ozzello A, Masciola P, Dall’omo AM, Imbimbo B 1983 An in vivo and in vitro study of the mechanism of prednisone-induced insulin resistance in healthy subjects. J Clin Invest 72:1814–1820[Medline]
  44. Newell-Price J, Trainer P, Besser M, Grossman A 1998 The diagnosis and differential diagnosis of Cushing’s syndrome and pseudo-Cushing’s states. Endocr Rev 19:647–672[Abstract/Free Full Text]
  45. Phillips DIW, Barker DJP, Fall CHD, Seckl JR, Whorwood CB, Wood PJ, Walker BR 1998 Elevated plasma cortisol concentrations: a link between low birth weight and the insulin resistance syndrome? J Clin Endocrinol Metab 83:757–760[Abstract/Free Full Text]
  46. Björntorp P, Rosmond R 1999 Hypothalamic origin of the metabolic syndrome X. Ann NY Acad Sci 892:297–307[CrossRef][Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
F. Schreiner, M. Tozakidou, R. Maslak, U. Holtkamp, M. Peter, B. Gohlke, and J. Woelfle
Functional glucocorticoid receptor gene variants do not underlie the high variability of 17-hydroxyprogesterone screening values in healthy newborns
Eur. J. Endocrinol., April 1, 2009; 160(4): 667 - 673.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Kajantie, K. Feldt, K. Raikkonen, D. I. W. Phillips, C. Osmond, K. Heinonen, A.-K. Pesonen, S. Andersson, D. J. P. Barker, and J. G. Eriksson
Body Size at Birth Predicts Hypothalamic-Pituitary-Adrenal Axis Response to Psychosocial Stress at Age 60 to 70 Years
J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4094 - 4100.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rautanen, A.
Right arrow Articles by Kajantie, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rautanen, A.
Right arrow Articles by Kajantie, E.
Related Collections
Right arrow Adrenal and Hypertension
Right arrow Neuroendocrinology and Pituitary
Right arrow Pediatric Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals