| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Shanghai Institute of Endocrine and Metabolism, Shanghai Second Medical University, Rui-Jin Hospital, Shanghai 200025, Peoples Republic of China
Address all correspondence and requests for reprints to: Yin Xiao, Department of Endocrinology and Metabolism, Central Hospital of Jinan, Shandong 250013, Peoples Republic of China. E-mail: xysq74{at}hotmail.com; or Han Junfeng, Shanghai Institute of Endocrine and Metabolism, Shanghai Second Medical University, Rui-Jin Hospital, 197 Rui-Jin Road II, Shanghai 200025, Peoples Republic of China; or Luo Min, Shanghai Institute of Endocrine and Metabolism, Shanghai Second Medical University, Rui-Jin Hospital, 197 Rui-Jin Road II, Shanghai 200025, Peoples Republic of China.
| Abstract |
|---|
|
|
|---|
Objective: The aim of the present study was to uncover proteins differentially expressed in the WAT of overweight/obese subjects and study the role of the identified proteins in adipocyte differentiation.
Design and Setting: Two-dimensional electrophoresis and matrix-assisted laser desorption ionization-time of flight-mass spectrometry were used to identify proteins differentially expressed in WAT between obese/overweight and control groups. Cathepsin K (CTSK), one of the proteins identified by the above methods, was highlighted to assess its effects on adipocyte differentiation through 3T3-L1 cell line.
Results: Human visceral adipose tissue of overweight/obese subjects displayed a differential protein expression profile, compared with that of normal-weight controls. CTSK was up-regulated in the WAT of overweight/obese subjects, and it had a significant positive correlation with body mass index. In vitro study showed that CTSK expression and its enzyme activity gradually increased in the process of adipocyte differentiation. Moreover, E-64, an inhibitor of CTSK, could prevent adipocyte differentiation in a dose-dependent manner, which was characterized by the absence of triglyceride accumulation and glycerol contents.
Conclusions: CTSK, a cysteine protease involved in extracellular matrix remodeling, could be one of the determinants of adipocyte differentiation. CTSK may be involved in the pathogenesis of obesity by promoting adipocyte differentiation.
| Introduction |
|---|
|
|
|---|
Currently a promising strategy to uncover obesity-related genes is being used to examine differential gene expression in adipose tissues of animal models and in obese patients. So far, many studies have been carried out to search for the obesity-related genes by gene expression profiling (2, 3, 4). However, regulation of translation and posttranslational editing may have a big impact on proteins function and activity, which may result in different phenotypes in cells, tissues, and humans. To clarify the difference in protein expression profiles between the WAT of obese patients and normal-weight controls, we combined two-dimensional polyacrylamide gel electrophoresis (2-DE) and matrix-assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS) analysis in this study.
Among these proteins differentially displaying in 2-DE, we particularly focused on the characteristics of cathepsin K (CTSK), a cysteine protease involved in the degradation of extracellular matrix. In the present study, we report that CTSK may play an essential role in the differentiation of adipocytes and have a critical impact on the onset of obesity.
| Subjects and Methods |
|---|
|
|
|---|
Forty-five participants from Yuhuangding Hospital (Shandong, China) were enrolled in this study. The study was approved by the local ethical committee, and all participants gave written informed consent. All participants had normal glucose tolerance, and they did not have any known underlying metabolic, autoimmune, infectious, or malignant disorders. Participants were divided into two subgroups according to their body mass index (BMI): overweight/obese group (12 males, 11 females, BMI
27 kg/m2) and normal-weight control group (10 males, 12 females, BMI
23 kg/m2). Each individual from both the overweight/obese and normal-weight control groups underwent a planned surgical intervention (cholecystectomy or hernioplasty). Before the intervention, each individual underwent a 75-g oral glucose tolerance test with measurement of fasting and postchallenge (120 min) C-peptide determinations. In addition, waist circumference, blood pressure, and fasting serum cholesterol and triglyceride concentrations were measured. Clinical, anthropometric, and laboratory parameters of the participants are summarized in Table 1
.
|
Isolation and identification of differentially expressed proteins with 2-DE and MALDI-TOF-MS
Omental adipose tissues of four overweight/obese patients and four normal-weight controls were subjected to 2-DE analysis. The fat pads were weighed and thawed in multiple chaotropic agent solution and disrupted with a homogenizer. The purified sample was obtained after centrifugation at 13,000 x g for 30 min.
Isoelectric focus (IEF), the first step of 2-DE, was carried out using the PROTEAN IEF CELL 2-D apparatus (Bio-Rad, Hercules, CA); 350 µg of the whole soluble proteins were mixed with the rehydration solution (Bio-Rad) to a total volume of 380 µl in which the immobilized pH gradient dry strips were rehydrated for 14 h (50 V). IEF was carried out in the following steps: 1) 250 V, 30 min; 2) 500 V, 1 h; 3) 1,000 V, 1 h; 4) 2,000 V, 1 h; 5) 3,000 V, 1 h; 6) 5,000 V, 3 h; 7) 7,000 V, 2 h; 8) 10,000 V, 2 h; 9) 10,000 V, 8 h; 10) holder 250 V, 24 h. After the IEF run, the strips were equilibrated with equilibration buffer twice followed by electrophoresis on 12% SDS-PAGE gels. After electrophoresis, silver stains of the gels were performed.
Image scanning of the silver-stained gels was performed with the molecular imager FX Pro Fluorescent imaging system (Bio-Rad). PDQuest 6.2.0 software (Bio-Rad) was used to detect spots in the gel images according to the manufacturers instructions.
The protein spots of interest were excised from the 2-DE gels. For sequence-specific digestion, the gel pieces were reswollen in minimal volumes of 50 mM NH4HCO3 containing 2 ng/µl Trypsin (Promega Corp., Madison, WI) and incubated at 37 C overnight. After successive extraction, 1 µl of the peptide extracts was loaded onto a Teflon-masked MALDI-TOF target. The molecular mass of the trypsinized peptides was determined in the reflector mode on the Voyager system mass spectrometer (Applied Biosystems, Framingham, MA).
Peptide mass fingerprintings obtained from MALDI-TOF MS analysis were used for protein identification in the public sequence database. The Mascot program was used to analyze the MALDI data using the public databases NCBInr and SWISS-PROT/TrEMBL.
Immunoblotting
Seventy micrograms of total protein were separated on 12% SDS-PAGE and transferred onto nitrocellulose filters by electroblotting. Filters were incubated with anti-CTSK antibody raised in goat (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000 dilution in Tris-buffered saline and Tween 20 (TBST) and 5% milk. After being washed three times in TBST, filters were incubated for 1 h in the horseradish peroxidase-conjugated antigoat IgG antibody (Cell Signal Technology, Beverly, MA) at 1:2000 dilution in TBST 2% milk. Specific protein expression was visualized by using a chemiluminescent assay kit followed by exposure to x-ray film for 115 min.
Quantitative RT-PCR
Total RNAs were isolated from adipose tissues using RNeasy lipid tissue mini kit (QIAGEN, Valencia, CA), following the manufacturers instructions. The quantity and quality of the isolated RNA was determined by agarose gel electrophoresis. One microgram of total RNA was reverse transcribed using random hexamers and SuperScript II reverse transcriptase (Invitrogen, Cergy Pontoise, France). Ten nanograms of cDNA were amplified with the Absolute QPCR mixes (ABgene House, Epsom, Surrey, UK) plus gene-specific upstream and downstream primers during 55 cycles on the ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City, CA). Each cycle consisted of denaturation at 94 C for 20 sec, annealing at 58 C for 20 sec, and extension at 72 C for 20 sec. The specific primer sequences were as follows: CTSK forward primer, ccgcagtaatgacacccttt; reverse primer, ggaaccacactgaccctgat; ß-actin forward primer, ctgggacgatatggagaaga; reverse primer, agaggcatacagggacaaca. For each sample, ß-actin was amplified separately as internal control to normalize the differences between samples. The relative expression of mRNAs among specimens was calculated using the comparative threshold cycle method as described previously (5).
3T3-L1 cell culture and CTSK inhibition experiment
3T3-L1 cells (American Type Culture Collection, Manassas, VA) were grown in DMEM supplemented with 10% fetal bovine serum (Life Technologies, Carlsbad, CA), 100 U/ml penicillin, and 100 mg/ml streptomycin at 37 C with 5% CO2. The date when cells were at confluence was set as d 0. Treatment for inducing preadipocyte differentiation was started on d 2 by adding a hormonal cocktail containing 1.7 µM insulin, 1 µM dexamethasone, and 0.5 mM isobutylmethylxanthine. On d 4, cell growth medium was replaced by DMEM supplemented with 1.7 µM insulin only. In general, by d 10, 95% of preadipocytes differentiated into adipocytes as determined by lipid accumulation visualized with Oil Red O staining. In inhibitor experiments, cells were treated for inducing differentiation by the same method as mentioned above in either the presence or absence of E-64 (Sigma, St. Louis, MO).
Location of CTSK in adipocyte
Adipocytes were incubated with 50 nM Red NDD-99 (Invitrogen) for 2 h and then fixed for 30 min in 4% paraformaldehyde containing 0.1% Triton X-100 followed by incubation with anti-CTSK antibody overnight. After being washed in PBS, adipocytes were incubated for 1 h with fluorescein-conjugated donkey antigoat IgG (Chemicon International, Temecula, CA). Signals were examined by fluorescence microscopy and photographed.
Assay of CTSK activity by confocal microscope
CTSK activity was measured with a CTSK detection kit (Calbiochem, San Diego, CA) according to the manufacturers instructions. Cells stained with CTSK fluorogenic substrate were observed using a laser-scanning confocal microscope (Leica TCS SP2 AOBS; Mannheim, Germany). Eight cells of each group at a specific time point (i.e. d 0, 2, 4, 6, 8, 10) were picked out randomly, and their fluorescences were measured for 30 min constantly. Fluorescence changes between groups were analyzed.
Intracellular triglycerides production assay
3T3-L1 cells were seeded at the density of 6 x 105 cells/well in 24-well plates until d 10 when intracellular lipid droplets had accumulated. Intracellular triglyceride production was measured by the cell lipid content assay kit (Calbiochem) according to the manufacturers instructions. Oil Red O was quantified by measuring the absorbance at 490 nm (model 680 microplate reader; Bio-Rad).
Lipolysis assay
3T3-L1 cells were seeded at the density of 6 x 105 cells/well in 24-well plates until d 10 when intracellular lipid droplets had accumulated. A total of 100 µl growth medium was taken from each well to measure the content of glycerol released into the media. Colorimetric analysis (Calbiochem) was used to measure the concentration of glycerol in each growth medium sample individually according to the manufacturers instruction.
Statistical analysis
The data are presented as mean ± SD. Correlation analysis and Students t test were used appropriately. P < 0.05 was accepted as the level of statistical significance.
| Results |
|---|
|
|
|---|
The protein expression profile of the WAT from overweight/obese patients was different from that of normal-weight controls. The representative protein expression profile of each group is shown in Fig. 1
, A and B, respectively. 2-DE gel data from the two groups were subjected to quantitative and qualitative comparison analysis with PDQuest 6.2 software (Bio-Rad). Ten spots showing distinct variation between groups (>5-fold, P < 0.05, Boolen analysis) were analyzed with MALDI-TOF-MS. Eventually differentially expressed proteins were identified by using public protein databases. With the combination of 2-DE analysis and MALDI-TOF-MS, we identified that the expression of CTSK protein in the WAT of overweight/obese patients was higher than that of controls.
|
This part of the study included 17 subjects who were divided into an overweight/obesity group (nine cases) and a normal-weight control group (eight cases). Immunoblotting analysis of samples from both groups showed bands around 38 kDa, as expected, which indicated the presence of CTSK protein in human WAT (Fig. 2A
). Figure 2A
shows that the expression of CTSK protein in the WAT of the overweight/obesity group was significantly higher than that in controls (0.73 ± 0.10 in the overweight/obesity group and 0.57 ± 0.11 in the normal-weight controls, P = 0.0067). As shown in Fig. 2
, B and C, in either the normal-weight group or overweight/obesity group, positive correlation was shown between CTSK protein expression in WAT and the individuals BMI (r = 0.80, P = 0.016 with the normal-weight group and r = 0.89, P = 0.001 with the overweight/obesity group). For all samples in this study, we found that CTSK protein expression in WAT was proportionally positive to an individuals waist circumference (r = 0.73, P = 0.03, Fig. 2D
). Besides BMI and waist circumference, we also checked the relationships between CTSK protein expression and other factors such as insulin, glucose, blood pressure, cholesterol, and triglycerides. No significant correlation was found in this present study (data not shown).
|
CTSK gene expression and enzyme activity during adipocyte differentiation and its subcellular localization
Further investigations were performed using the 3T3-L1 cell line. As shown in Fig. 3
, AC, in 3T3-L1 cells before differentiation as well as in the early stage of differentiation (d 0 and 2), the CTSK gene was expressed at a very low level. On d 2, cells began to be treated for inducing differentiation. Then, along with adipocyte conversion, the expression of the CTSK gene in cells was also up-regulated, finally reaching a plateau on d 10 when cells reached their terminal differentiation.
|
Confocal microscopy was used to detect the subcellular localization of CTSK. CTSK was identified by its fluorogenic substrate (Fig. 4A
), and the cellular nucleus was identified by Hoechst staining (Fig. 4B
). As shown in Fig. 4C
, most of the CTSK fluorescence sparkles were found in the cytoplasm. Because CTSK was reported as a lysosomal enzyme(6), we combined LysoTracker Red DND-99 (Invitrogen, Carlsbad, CA) (Fig. 4E
) and CTSK indicator in our colocalization study to map finely the subcellular localization of CTSK. CTSK was identified by a fluorescein secondary antibody (Fig. 4D
). As shown in Fig. 4F
, it was found that the foci-like staining of CTSK was colocalized with lysosomes.
|
To verify that CTSK is indispensable in adipocyte differentiation, we used CTSK inhibitor E-64 to keep blocking CTSK activities during adipocyte differentiation in 3T3-L1 cells. In brief, 3T3-L1 cells were continuously grown in medium containing E-64 at different concentrations (05.0 µM). The accumulation of cytoplasmic triglycerides was assessed. Our results indicated that CTSK inhibitor E-64 may block adipocyte conversion in a dosage-dependent manner (Fig. 5
, AC). In addition, microscopic examination and a Trypan Blue exclusion test were conducted on E-64-treated cells. No sign of cytotoxicity was revealed in any cases (results not shown).
|
| Discussion |
|---|
|
|
|---|
CTSK, a cysteine protease, also displays collagenase and gelatinase activities. CTSK expression has been reported in ovary (7), lung (8), thyroid (9), and particularly in osteoclasts (7), in which its enzymatic properties play a central role both in normal bone remodeling and pathological processes (10), such as osteoarthritis and osteoporosis. The expression of CTSK mRNA was first reported in WAT by Soukas et al. (11). CTSK is synthesized as a proenzyme of 38 kDa and subsequently enters acidic lysosomal compartments, in which the propeptide is cleaved and transformed into an active enzyme (12). In our study, CTSK was also localized in lysosomes in 3T3-L1 cells, similar to studies in osteoblasts and thyrocytes.
In the present study, we compared the expression of CTSK in the WAT of obese patients with that of normal-weight controls. Our results indicated that CTSK protein expression and mRNA expression in the WAT of overweight/obese patients were up-regulated, which was in consensus with the previous study in mice (13). In that study, Chiellini et al. (13) reported that CTSK mRNA expression in WAT in a variety of experimental models of mouse with obesity was higher than that in wild types. The positive correlation between CTSK and obesity was further confirmed by the data that CTSK protein expression in WAT was proportional to an individuals BMI. These data supported the finding that CTSK was a novel and reliable marker of adiposity.
CTSK is able to degrade several components of the extracellular matrix, including collagen types I and II, elastin, osteopontin, and osteonectin, which is the main target of CTSK. Osteonectin, also named SPARC (a protein-mediated cell-matrix interaction), plays a role in the modulation of cell adhesion, differentiation, and angiogenesis. Several extracellular ligands of osteonectin have been identified, including some collagen types and cytokines. A previous study has demonstrated that osteonectin is a newly identified factor secreted by adipocyte, and its expression is strongly elevated in animals (14) and human subjects with obesity (15). Thus, it is logical to say that more CTSK protein in WAT may cleave more osteonectin, which could result in increasing matrix plasticity in WAT and facilitating remodeling and angiogenesis of adipose.
Obesity is characterized by the increase of intracellular lipid accumulation, which shows a significant correlation with adipocyte differentiation. Interestingly, our in vitro study in 3T3-L1 cells (a useful model to study adipocyte differentiation) indicated that CTSK participated in the onset of obesity and might be a crucial factor in adipocyte differentiation. The expression of CTSK increased gradually along with the differentiation of 3T3-L1 cell into mature adipocyte, which was also concomitant with elevated enzyme activities. Furthermore, CTSK inhibitor E-64 was able to inhibit lipid storage as well as affect cell morphology during 3T3-L1 cell differentiation. The inhibition of adipocyte differentiation by E-64 was also confirmed through quantitating cellular triglyceride content and the amount of glycerol released into the culture medium.
It has been well accepted that adipocyte differentiation is accompanied by a notable shift in the profile of extracellular matrix protein expression. Some studies have indicated that these changes may have impact on the expression and function of peroxisome proliferator-activated receptors and/or CCAAT/enhancer-binding proteins, both of which play important roles in adipocyte differentiation. Some proteases participating in extracellular matrix remodeling, such as matrix metalloproteinase-2, -3, and -9 (16, 17, 18), have been reported to be involved in the adipocyte conversion. And CTSK, as a cysteine protease, is able to degrade several components of the extracellular matrix. The collagenolytic activity of CTSK is detected both on the outside of the helical region of the molecule and at various sites inside the helical region. Therefore, we postulated that CTSK may influence adipocyte differentiation through modifying extracellular matrix components. Adipocyte differentiation is a process of fat cell formation, which contributes to the accumulation of adipose tissue; therefore, CTSK may be involved in the onset of obesity. However, the underlying mechanism needs to be explored further.
In summary, our data suggested that CTSK may play an important role in adipocyte differentiation. The present study demonstrated that CTSK is a novel marker of obesity. Further exploration of the function of CTSK will reveal the pathogenesis of obesity. In addition, we also speculate that CTSK might be a promising therapeutic target in that inhibiting CTSK activity may arrest the growth of adipose mass.
| Footnotes |
|---|
Author disclosure summary: All the authors of this paper have nothing to declare.
First Published Online August 15, 2006
1 Y.X. and H.J. contributed equally to this work. ![]()
Abbreviations: BMI, Body mass index; CTSK, Cathepsin K; 2-DE, two-dimensional polyacrylamide gel electrophoresis; IEF, isoelectric focus; MALDI-TOF-MS, matrix-assisted laser desorption ionization-time of flight-mass spectrometry; TBST, Tris-buffered saline and Tween 20; WAT, white adipose tissue.
Received November 14, 2005.
Accepted August 4, 2006.
| References |
|---|
|
|
|---|
gene expression in white adipose tissue of lactating mice. Biochem Biophys Res Commun 296:458462[CrossRef][Medline]
C(T)] method. Methods 25:402408[CrossRef][Medline]This article has been cited by other articles:
![]() |
M. Yang, J. Sun, T. Zhang, J. Liu, J. Zhang, M. A. Shi, F. Darakhshan, M. Guerre-Millo, K. Clement, B. D. Gelb, et al. Deficiency and Inhibition of Cathepsin K Reduce Body Weight Gain and Increase Glucose Metabolism in Mice Arterioscler. Thromb. Vasc. Biol., December 1, 2008; 28(12): 2202 - 2208. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |