| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Genetics (D.R.S., B.A.D., W.A., K.G.E., R.S.S.), Center for Research on Reproduction and Womens Health, and Department of Obstetrics and Gynecology (J.F.S., J.R.W.), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104; Division of Endocrinology, Metabolism, and Molecular Medicine (M.U., A.D.), Northwestern University Medical School, Chicago, Illinois 60611; and Department of Obstetrics and Gynecology (R.S.L.), Pennsylvania State University, Hershey, Pennsylvania 17033
Address all correspondence and requests for reprints to: Dr. Richard Spielman, Department of Genetics, University of Pennsylvania. School of Medicine, Philadelphia, Pennsylvania 19104-6145. E-mail: spielman{at}pobox.upenn.edu.
| Abstract |
|---|
|
|
|---|
Objective/Design: The objectives of the study were: 1) use the transmission/disequilibrium test (TDT) to assess linkage and association between PCOS and D19S884 (and nearby markers) in a third set of families; and 2) test D19S884 and surrounding DNA sequence for in vitro regulatory activity in lymphoblastoid cell lines (LCLs) and granulosa cells.
Setting/Subjects: We studied 98 new families with a PCOS proband, father, mother, and other available offspring. We analyzed data from these families separately and in combination with data obtained previously.
Interventions: Interventions were venipuncture.
Main Outcome Measures: Measures were transmission frequencies and in vitro functional studies.
Results: The first result we found was that in the 98 new families, the TDT was significant for allele 8 of D19S884 (P = 0.043). In the total collection of 465 families, the TDT evidence is very strong (nominal P < 7 x 105). Results for all other genetic markers near D19S884 were nonsignificant after correction for multiple testing. The second result was that an approximately 800-bp fragment containing various alleles of D19S884 showed modest but reproducible promoter activity in LCLs. However, no allelic differences were detected. No activity of this fragment was detected in granulosa cells.
Conclusions: This is the second independent confirmation of linkage and association of D19S884 with PCOS. We found in addition that some sequence in the region of D19S884 confers in vitro promoter activity in LCLs.
| Introduction |
|---|
|
|
|---|
Familial aggregation of PCOS has been recognized for many years, and evidence has recently been reviewed (3, 5). PCOS does not show clear Mendelian inheritance and is considered a complex trait, therefore posing a set of well-recognized difficulties for the geneticist (6, 7). In PCOS in particular, genetic analysis is hampered by low fecundity, lack of a male phenotype, absence of an animal model, and variation in diagnostic criteria. Some of these difficulties pose less severe problems for detecting association than for detecting linkage, so analyses often rely on tests to detect association of PCOS with variation at candidate genes.
However, the choice of candidate genes is often not simple (8). In PCOS, the pathogenesis likely stems in part from some mix of dysregulation of steroid hormone production, gonadotropin action, obesity, and energy regulation or insulin action (1, 9). For this reason, the majority of candidate genes tested in PCOS have been drawn from these pathways (5), and we previously used this approach (10, 11). In our studies (11, 12), we used the transmission/disequilibrium test (TDT) (13), which tests for the simultaneous presence of association and linkage, i.e. linkage disequilibrium (LD). In addition, we restricted the definition of PCOS to objective criteria (14) to reduce the heterogeneity of the PCOS phenotype.
We previously found LD between PCOS and a microsatellite marker (D19S884) on chromosome 19p13.2, located approximately 1 Mb centromeric to the insulin receptor gene (INSR) (11, 12), the candidate gene that led us to this region. The strongest association was with allele 8 (A8) (defined in Ref. 12). The association has been supported by some investigators (15, 16) but not by others (17); none of these investigators tested for genetic linkage. Here, with data from 98 additional families, we report further confirmatory evidence of linkage and association between D19S884 and PCOS. The analysis was extended to the total family collection, which is the largest available for study to our knowledge. We also describe the results of genotyping markers in the region around D19S884. Finally, we carried out experiments with a luciferase reporter construct to test for regulatory elements located near D19S884.
| Subjects and Methods |
|---|
|
|
|---|
We genotyped all the microsatellite and single-nucleotide polymorphism (SNP) markers in 465 families with PCOS; 98 of these were added since our previous report (12). In total, there were 96 multiplex families (two or more affected daughters) and 369 simplex families (parents and one affected daughter). The self-identified ethnicities of probands in the 465 families were: 90% white, 3% Hispanic, 2% black, and 5% other or unknown.
Diagnostic criteria have been described in detail elsewhere (11, 14). Probands were considered affected if they had six or fewer menses per year and elevated total testosterone (greater than 58 ng/dl) or elevated non-SHBG-bound testosterone (greater than 15 ng/dl); these thresholds are 2 SD greater than the mean of our normal controls (14). Sisters of probands were considered affected if they had elevated testosterone (by the criteria above), irrespective of oligomenorrhea. Ovarian morphology was not a diagnostic criterion. Other causes of hyperandrogenemia and anovulation were ruled out by appropriate tests (14, 18). Women were considered unaffected if they had normal menstrual cycles and normal androgen levels and were not taking medications known to affect reproductive hormones or insulin sensitivity. (For genetic analysis, women with the phenotype unaffected were not included.) Peri- or postmenopausal women or those not otherwise fulfilling criteria for affected or unaffected phenotypes were assigned the phenotype unknown, as were all men, because there is no known PCOS phenotype in males. This study was approved by the Institutional Review Boards of the Pennsylvania State University College of Medicine, Brigham and Womens Hospital, University of Pennsylvania, and Northwestern University. Written informed consent was obtained from all adult subjects and from a parent or guardian for minor subjects.
Genotyping
Genotypes of microsatellite markers D19S884 and D19S922 were determined for the majority of DNA samples as previously described (12) with a model 377 DNA sequencer (Applied Biosystems, Foster City, CA) and fluorescently labeled primers. In addition, approximately 90 samples were genotyped on a model 3130 capillary sequencer (Applied Biosystems). (About 300 samples were typed by both methods to ensure comparability.) Genescan Analysis and Genotyper software (Applied Biosystems) were used for genotype analysis. Allele designations and sizes were defined elsewhere (12).
Twenty-two SNPs were genotyped with TaqMan SNP genotyping assays and custom TaqMan SNP genotyping assay (Applied Biosystems). Twenty-one of these are available in dbSNP (http://www.ncbi.nlm.nih.gov/SNP/). The remaining SNP was found during sequencing of genomic DNA of 10 individuals [four unrelated Centre dEtude du Polymorphisme Humain (CEPH) individuals and six PCOS probands] and is identified as FBN36197 [ATGTGACCAGCAGTG(A/G)CATCAACAGGACTGG]. The SNPs all map within 182 kb of D19S884. For genotyping, 6.75 ng genomic DNA were amplified in a 384-well microtiter plate. PCR was performed as specified by the manufacturer. Allelic PCR products were analyzed with the Prism 7900HT sequence detection system (Applied Biosystems) using SDS 2.2 software (Applied Biosystems). Genotypes were autocalled by SDS 2.2 software with quality value set at 0.95. With this setting, we obtained genotypes for 94% of the DNA samples. Two CEPH individuals were typed on each of 25 96-well plates; no discrepancies were observed for any of the 22 SNPs.
Analysis of genetic markers
Error checking of genotypes was performed with Merlin software (19), and families with one or more Mendelian discrepancies for a marker were excluded in analysis of that marker. LD between SNPs and PCOS was tested with the TDT (13) and the pedigree disequilibrium test (PDT). The PDT (20, 21) was introduced as a family-based association test that is valid for sibships with two or more affected offspring, a family structure for which the TDT is not strictly valid as a test of association. Even in this situation, the TDT is entirely valid as a test of linkage, so we provide the results of both tests. Because we were concerned that some women might have the same disease determinants as their affected sisters but be unaffected, we carried out the PDT with only affected offspring, ignoring women designated unaffected. We chose the sum PDT alternative (see Ref. 20). The conditional TDT (22, 23, 24) was carried out with the program UNPHASED (22) to assess the relative contributions of the two closely linked markers, D19S884 and D19S922.
Promoter activity of D19S884
Forward direction: fragment 1 (F1) and fragment 2 (F2) clones in pGL3-basic (pGL3-B) vector. To study the regulatory activity of the region containing the (GT)n repeat of the marker D19S884, two genomic fragments of different sizes, both encompassing the (GT)n repeat (Fig. 1
), were subcloned into the firefly luciferase reporter system vector, GL3-basic (pGL3-B) (Promega Corp., Madison, WI). Primers were synthesized, which introduced an MluI restriction site at the 5' end and an XhoI restriction site at the 3' end of the resulting amplimer. F1 primers: GACTGACGCGTCCTCTGTCCCTTCTGTTAAA, CTGACCTCGAGGCTGGGATGACAGGTATGCT; F2 primers: GACTGACGCGTATGGCTCAGGCTACACTGCT, CTGACCTCGAGTTTTTAGCGATGGGGTCTTG (IDT, Coralville, IA). Primers and genomic DNA were PCR amplified with AccuPrime Pfx DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA). The pGL3-B vector and PCR amplimers were digested with restriction enzymes MluI and XhoI (New England BioLabs, Inc., Beverly, MA) and subsequently ligated. The inserts of the A8 clones, pA8-F1B (D19S884-A8-bearing fragment 1 in pGL3-B vector) and pA8-F2B (D19S884-A8-bearing fragment 2 in pGL3-B vector), contained (GT17) and were 837 and 2403 bp in length, respectively. The allele 9 (A9) clones, pA9-F1B and pA9-F2B, containing (GT)18, were 839 and 2405 bp in length. A fragment containing the (GT)22 repeat was also isolated; this corresponds to D19S884 allele 13 (A13) (pA13-F1B and pA13-F2B). The number of independent genomic fragments examined in the luciferase assay for each allele was as follows: 11 for A8, seven for A9, and one for A13. Insert sequences were verified.
|
Enhancer activity of D19S884
Forward direction: F1 and F2 clones in pGL3-promoter (pGL3-P) vector. To test putative enhancer activity, inserts from the F1-B clones (pA8-F1B, pA9-F1B, and pA13-F1B) as well as F2-B clones (pA8-F2B, pA9-F2B, and pA13-F2B) were also subcloned into the pGL3-P vector. To ensure the fidelity of the GT repeat length, the inserts were obtained by digestion of the corresponding pGL3-B clones with MluI and XhoI. The resulting products were separated by electrophoresis. The band corresponding to the insert was purified and ligated into the pGL3-P vector that had been linearized with MluI/XhoI. The resulting clones were identified as pA8-F1P, pA9-F1P, pA13-F1P, pA8-F2P, pA9-F2P, and pA13-F2P. Insert sequences were verified.
Oligo GT clones
Additional clones were prepared to determine whether the GT repeat alone could regulate luciferase activity. 5'-Phosphorylated oligos (CGCGGACTG(GT)nGACTG; IDT) containing 17, 18, and 22 GT repeats were hybridized to 5'-phosphorylated oligos [TCGACAGT(CA)nCCAGTC; IDT] containing 17, 18, and 22 CA repeats, respectively. In a 50-µl reaction volume, 2 x 106 moles of each oligo were hybridized at 68 C for 30 min. The temperature was then decreased to 37 C over 1 h and the reaction incubated for 15 min. The resulting double-stranded oligo contained overhangs that were complementary to a digested MluI restriction site at the 5' end and an XhoI site at the 3' end. The double-stranded oligos were ligated directly into the MluI/XhoI-digested pGL3-B vector.
Transient transfection of lymphoblastoid cell lines (LCLs)
A pool of three CEPH LCLs (GM12917, GM12918, GM12287) was maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum following standard procedures. Aliquots of 3 x 106 cells were transiently cotransfected with 5 µg of reporter vector and 500 ng of Renilla luciferase (pRL-TK, Promega) by electroporation (Amaxa, Gaithersburg, MD) following the manufacturers directions. Electroporated cultures were then grown for 24 h under standard conditions and harvested. Resulting cell lysates were assayed immediately or frozen at 20 C. All clones were transfected in duplicate. Empty vector was transfected during each experiment.
Transient transfection of granulosa cells
Human granulosa cells were obtained from the University of Pennsylvanias in vitro fertilization clinic and maintained in culture as previously described (25, 26). Granulosa cells were seeded in 12-well plates at a density of 50,000 cells/ml 16 h before transfection. The cells were cotransfected with 1 µg reporter vector and 50 ng pRL-TK vector by lipofection with FuGENE 6 (Roche Diagnostics, Indianapolis, IN) at a 3:1 DNA to reagent ratio. Both pGL3-B and pGL3-P vectors, with and without insert, were transfected. After the cells were incubated at 37 C in 5% CO2 for 24 h, lysates were collected. All transfections were performed in triplicate. In all, nine primary cultures were transfected: five from women with PCOS and four from women without PCOS.
Assay of lysates on luminometer
Cell lysates (20 µl) were assayed on an opaque 96-well microtiter plate using the dual-luciferase reporter assay system (Promega) on a Labsystems Luminoskan Ascent luminometer (Thermo Electron Corp., Franklin, MA). Samples were arrayed randomly on the plate. Injection volume of 100 µl LAR II and Stop-n-Glo was used (Promega). To determine the relative promoter activity of the vector, the ratio of firefly luciferase and Renilla luciferase activity was calculated and then divided by the luciferase to Renilla ratio from the appropriate empty vector.
| Results |
|---|
|
|
|---|
Table 1
summarizes the results of the TDT analysis. The result for A8 of D19S884 in the total collection of 465 families was very significant (
2 = 15.8, nominal P < 7 x 105). In previous studies, the results were
2 = 4.1 (P = 0.033) in the first sample (n = 150 families) and
2 = 7.3 (P = 0.007) in the second (n = 217). In the present sample (n = 98), we found
2 = 4.1 (P = 0.043). The present findings thus represent the second of two independent confirmations of TDT results for A8 of D19S884.
|
Genotyping of region around D19S884
The marker D19S884 is located in an intron near the 3' end of fibrillin-3 (FBN3), a large gene encoding an extracellular matrix protein highly homologous to FBN1 and FBN2 (27). The significant findings for D19S884 prompted us to genotype SNPs in and near FBN3. In the region surrounding D19S884, 22 SNPs were genotyped, with emphasis on those in FBN3. The SNPs span approximately 182 kb.
Figure 2
summarizes the results of the SNP genotyping and TDT analysis. Of the 22 SNPs genotyped, two (J and K in Fig. 2
) were nominally significant. Both were located within 2 kb of D19S884. When the Bonferroni correction was applied to the results, none remained significant.
|
2 = 7.7, P = 0.006]. D19S922 is located only 12.3 kb centromeric to D19S884. Although the results for D19S922 are not as significant as those for D19S884, they are based on a much smaller sample of transmissions. The degree of transmission distortion (37% or 10.63) is actually slightly greater than at D19S884 (62%); this led us to consider whether the effect seen at D19S884 might be secondary to that at D19S922, as a result of LD between the markers. To address this possibility, we carried out the conditional TDT (22, 23, 24). The effect of D19S884, after accounting for D19S922, is highly significant (P < 0.0006); that for D19S922, after accounting for D19S884, does not reach conventional significance (P = 0.06). We conclude that the principal effect is located closer to D19S884 than D19S922. Promoter activity of D19S884
We chose three alleles of D19S884 to test for possible allelic differences in regulation: A8 (overtransmitted to individuals with PCOS), A9 (slightly undertransmitted), and A13 (common allele, no significant association). We established that these three alleles contain 17, 18, and 22 GT repeats, respectively. Two overlapping fragments (F1 and F2), each containing the marker D19S884 (Fig. 1
), were tested independently for regulatory activity in cultured LCLs and granulosa cells. (For brevity, we refer to the entire fragment as A8, A9, or A13.) F1 and F2 clones were assayed for both promoter activity (using the pGL3-B vector) and enhancer activity (using the pGL3-P vector) by transient transfection. All possible combinations of insert (F1 and F2), vector (pGL3-B and pGL3-P), and cell type (LCLs and granulosa) were tested. Of these, the F1 promoter clones (pA8-, pA9-, and pA13-F1B) transfected into LCLs were the only combinations to exhibit luciferase activity different from that of the empty vector. In the LCLs under our conditions, both pA8-F1B and pA9-F1B clones demonstrated modest promoter activity. However, the activity of A8 and A9 clones did not differ significantly from each other. The relative luciferase activity of A8 clones ranged from 3.21 to 7.06 (mean 5.02) and that of the A9 clones ranged from 3.22 to 5.66 (mean 4.68) (Fig. 3
). The results were also analyzed with respect to SNP rs7260399 within F1 (indicated by asterisk in Fig. 1
and denoted C/T in Fig. 3
). Alleles of the SNP were not significantly associated with changes in promoter activity. In all experiments, the empty pGL3-P clone was used as a positive control to show that the Simian virus-40 promoter itself stimulated luciferase gene activity in LCLs (mean 30-fold) as well as granulosa cells (mean 95-fold).
|
To test the regulatory activity of the (GT)n repeat itself, we repeated the transient transfection experiments into LCLs using a pGL3-B vector with only the (GT)n repeat as the insert. Neither the (GT)17 nor (GT)18 repeat possessed significant promoter activity (data not shown). Taken together, these results suggest that the genomic DNA flanking the GT repeat, or the GT repeat in the context of the surrounding DNA, is responsible for the luciferase activity exhibited by the pA8-F1B, pA9-F1B, and pA13-F1B clones. However, the effect was not seen with any other fragment and cell combination tested: F1P clones in LCLs, F1B or F1P in granulosa cells.
| Discussion |
|---|
|
|
|---|
Although earlier studies (1, 8, 14, 28) have established that there is familial aggregation of PCOS, evidence for specific genes or regions has been difficult to confirm (1, 5, 29). With regard to linkage/association with D19S884, our original findings (11) were confirmed (12) and are now again confirmed in an independent sample. For the combined data from 465 families, the TDT results are the most significant (nominal P < 7 x 105) reported to date for linkage and/or association between PCOS and any gene or marker. The corresponding PDT test value is z = 3.54 (P = 0.0004).
A final assessment, however, of the appropriate level of significance is not straightforward. On the one hand, in the original study (11), we tested alleles at microsatellite markers near many unlinked candidate genes, which called for substantial correction for multiple testing, which was done. Even in the present study, we tested 22 SNPs. On the other hand, the markers in the present study are all extremely tightly linked (within
180 kb), so a full Bonferroni correction would not be appropriate. Furthermore, with regard to D19S884 specifically, the three independent samples showed very similar transmission rates for A8 (Table 1
). Although difficult to quantify, this evidence also suggests that the result is not simply a false-positive finding due to multiple testing.
We therefore consider the evidence compelling for a determinant located at or near D19S884. However, the exact location is still not known. D19S884 and nearby associated SNPs are located in nonconserved intronic sequence between exons 55 and 56 of FBN3. We consider it unlikely, although formally possible, that variation in this intron contributes to pathogenesis of PCOS through variation in FBN3. Several other markers located near D19S884 also show LD with PCOS. Of these, D19S922 shows by far the strongest effect. To allow for the association between D19S884 and D19S922, we used the conditional TDT and investigated whether PCOS was associated primarily with one and only secondarily with the other. The results support the conclusion that the association of D19S884 with PCOS is primary, and that of D19S922 with PCOS is largely or entirely due to LD with D19S884. (Of course, even the association with D19S884 could be due to some nearby unobserved causal determinant.)
To assess the possible functional role of the GT repeat (D19S884) itself and surrounding regions, we tested sequences from this region in a luciferase reporter assay. In particular, we compared clones of the sequence representing A8 and A9, which show striking differences in the TDT. One fragment, encompassing D19S884, showed reproducible promoter activity. However, there was no evidence for allelic differences in the luciferase assay. Additional experiments with these and other clones in an enhancer vector, and in alternative host cells, failed to reveal regulatory activity. Thus, if the length of the GT repeat itself is the functional allelic difference, it was not detected by the luciferase assay in these host cells. Alternatively, variation at D19S884 may be a proxy for nearby causal variation.
How then might D19S884 or a nearby determinant act to confer susceptibility? Additional studies will show whether any nearby gene is regulated (in cis) or whether a transcript is made, suggesting that regulation takes place in trans. In any case, the evidence appears conclusive that the region of D19S884 plays a role in susceptibility to PCOS in Caucasians.
| Acknowledgments |
|---|
| Footnotes |
|---|
Current address for D.R.S.: National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, Building 49, Room 4A62, Bethesda, Maryland 20892-4472.
Current address for J.F.S.: Dean, School of Medicine, Virginia Commonwealth University, Richmond, Virginia 23298.
First Published Online July 25, 2006
Abbreviations: A8, Allele 8; A9, allele 9; A13, allele 13; CEPH, Centre dEtude du Polymorphisme Humain; F1, fragment 1; F2, fragment 2; FBN, fibrillin; LCL, lymphoblastoid cell line; LD, linkage disequilibrium; PCOS, polycystic ovary syndrome; PDT, pedigree disequilibrium test; pGL3-B, pGL3-basic; pGL3-P, pGL3-promoter; SNP, single-nucleotide polymorphism; TDT, transmission/disequilibrium test.
Received May 4, 2006.
Accepted July 18, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
V. Padmanabhan Polycystic Ovary Syndrome -- "A Riddle Wrapped in a Mystery inside an Enigma" J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 1883 - 1885. [Full Text] [PDF] |
||||
![]() |
S. Kenigsberg, Y. Bentov, V. Chalifa-Caspi, G. Potashnik, R. Ofir, and O. S. Birk Gene expression microarray profiles of cumulus cells in lean and overweight-obese polycystic ovary syndrome patients Mol. Hum. Reprod., February 1, 2009; 15(2): 89 - 103. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.O. Goodarzi, J.F. Maher, J. Cui, X. Guo, K.D. Taylor, and R. Azziz FEM1A and FEM1B: novel candidate genes for polycystic ovary syndrome Hum. Reprod., December 1, 2008; 23(12): 2842 - 2849. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Simoni, C.B. Tempfer, B. Destenaves, and B.C.J.M. Fauser Functional genetic polymorphisms and female reproductive disorders: Part I: polycystic ovary syndrome and ovarian response Hum. Reprod. Update, September 1, 2008; 14(5): 459 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Franks, J. Stark, and K. Hardy Follicle dynamics and anovulation in polycystic ovary syndrome Hum. Reprod. Update, May 22, 2008; (2008) dmn015v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Kent, C. L. Gnatuk, A. R. Kunselman, L. M. Demers, P. A. Lee, and R. S. Legro Hyperandrogenism and Hyperinsulinism in Children of Women with Polycystic Ovary Syndrome: A Controlled Study J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1662 - 1669. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.O. Goodarzi, N. Xu, J. Cui, X. Guo, Y.I. Chen, and R. Azziz Small glutamine-rich tetratricopeptide repeat-containing protein alpha (SGTA), a candidate gene for polycystic ovary syndrome Hum. Reprod., May 1, 2008; 23(5): 1214 - 1219. [Abstract] [Full Text] [PDF] |
||||
![]() |
The ESHRE Capri Workshop Group Genetic aspects of female reproduction Hum. Reprod. Update, April 2, 2008; (2008) dmn009v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Kevenaar, J. S. E. Laven, S. L. Fong, A. G. Uitterlinden, F. H. de Jong, A. P. N. Themmen, and J. A. Visser A Functional Anti-Mullerian Hormone Gene Polymorphism Is Associated with Follicle Number and Androgen Levels in Polycystic Ovary Syndrome Patients J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1310 - 1316. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Legro, H. X. Barnhart, W. D. Schlaff, B. R. Carr, M. P. Diamond, S. A. Carson, M. P. Steinkampf, C. Coutifaris, P. G. McGovern, N. A. Cataldo, et al. Ovulatory Response to Treatment of Polycystic Ovary Syndrome Is Associated with a Polymorphism in the STK11 Gene J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 792 - 800. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Urbanek, S. Sam, R. S. Legro, and A. Dunaif Identification of a Polycystic Ovary Syndrome Susceptibility Variant in Fibrillin-3 and Association with a Metabolic Phenotype J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4191 - 4198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |