| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Center for Reproductive Sciences, Department of Obstetrics, Gynecology and Reproductive Sciences (H.I., R.B.J.) and Department of Laboratory Medicine (M.O.M.), University of California at San Francisco, San Francisco, California 94143; and Department of Obstetrics and Gynecology (H.I., T.H., K.M., M.T., Y.Y.), Keio University School of Medicine, Tokyo 160-8582, Japan
Address all correspondence and requests for reprints to: Robert B. Jaffe, M.D., Center for Reproductive Sciences, 1450 Health Sciences West, Department of Obstetrics, Gynecology and Reproductive Sciences, University of California, San Francisco, San Francisco, California 94143-0556.
| Abstract |
|---|
|
|
|---|
Objective: The objective of this study was to investigate expression, proliferative effects, and ACTH regulation of MK in the HFA.
Design and Setting: RNA, cryosections, and primary cell cultures from HFAs (1424 wk) and adult adrenal RNA were used.
Main Outcome Measures: The main outcome measures were MK mRNA levels (measured by quantitative real-time RT-PCR); MK localization (measured by immunostaining); MK proliferative effects and mechanism (measured by proliferation assays, flow cytometry, pharmacological interventions); and ACTH regulation (measured by quantitative real-time RT-PCR).
Results: HFA MK mRNA levels were 4-fold higher than in adult adrenals (P < 0.05) and were comparable to levels in fetal and adult brains (positive controls). MK immunoreactivity was abundant throughout the HFA. Exogenous MK caused proliferation of isolated DZ cells but not FZ cells (72 h, P < 0.05). In contrast, basic fibroblast growth factor induced proliferation of cells from both zones. Pharmacological interventions indicated that MK-induced DZ cell proliferation may be mediated by phosphatidylinositol 3-kinase, MAPK kinase, and Src family kinases. ACTH (1 nM) increased MK mRNA by 3.5-fold (48 h, P < 0.01) in isolated FZ cells.
Conclusions: MK likely plays a key role in HFA development. MKs selective in vitro mitotic effects on DZ cells may provide insights into the mechanism underlying the distinct in vivo differences in mitotic activity between the DZ and FZ.
| Introduction |
|---|
|
|
|---|
The human fetal adrenal gland (HFA) undergoes rapid growth during midgestation. By 20 wk, the gland is as large as the fetal kidney and by 30 wk achieves a relative size 10- to 20-fold that of the adult adrenal. Various growth factors have been demonstrated to regulate growth in fetal and adult adrenal glands. These include basic fibroblast growth factor (bFGF), IGF-II, and epidermal growth factor (EGF) (1, 5). Of these factors, bFGF, a heparin-binding growth factor, is one of the most potent mitogens for primary culture cells from fetal and adult adrenals (5, 6, 7, 8).
Midkine (MK) is a 13-kDa secreted protein with various functions including cell proliferation, migration, survival, differentiation, and angiogenesis (9). MK belongs to a family of heparin-binding growth/differentiation factors that share functional, but not structural, features with the FGF family. Although MK was originally described, and has been most extensively studied, in neural tissue, subsequent studies have demonstrated its presence in a wide variety of organs and tissues. The expression of MK is developmentally regulated: generally, MK is highly expressed during midgestation. Strong expression is found in the brain and in tissues in which epithelial-mesenchymal interactions or remodeling are taking place (9). Although MK is extensively expressed in a wide variety of human cancers and other neoplasms, its expression in normal adult tissues is greatly restricted. Thus, these expression patterns of MK suggest its role in embryonic and fetal development. In the rat adrenal gland, analyses of MK mRNA demonstrated a specific pattern of fetal expression (10). However, to date, expression and functions of MK have not been studied in the primate adrenal gland, except for one recent DNA microarray study that demonstrated that MK was one of 69 transcripts that have a greater than 2.5-fold difference in expression between human fetal and adult adrenals (11).
Therefore, we investigated expression, regulation, and function of MK in the HFA. Our results indicate a key role for MK in HFA development, with abundant expression in the HFA and regulation by ACTH, the primary regulator of HFA growth and function. Of particular note, we demonstrate that MK exerts mitogenic effects selectively on DZ cells in vitro but not on FZ cells. This finding may provide clues to the mechanism underlying the zonal differential cell proliferative status observed in the DZ and FZ in vivo.
| Materials and Methods |
|---|
|
|
|---|
Adrenal glands and brains were obtained from midgestation human fetuses after elective termination of pregnancy. The study was approved by the Committee on Human Research, University of California, San Francisco (UCSF). Adrenal glands were collected and placed in ice-cold medium for primary cell culture, in RNA Later (Ambion, Austin, TX) for RNA extraction or in 4% paraformaldehyde in PBS for histological examination.
Reagents
Recombinant human MK and bFGF were purchased from R&D Systems (Minneapolis, MN). Human ACTH 124 (Cortrosyn) was obtained from Organon (West Orange, NJ). Eight-bromoadenosine cAMP (8-Br-cAMP) and forskolin were obtained from Sigma (St. Louis, MO). Polyclonal rabbit antibody against 17
-hydroxylase/17,20 lyase (P450c17) was kindly provided by Dr. Walter Miller (UCSF). Protein kinase inhibitors were purchased from BD Biosciences (San Diego, CA).
Fetal adrenal cortical cell culture
The capsule with the adherent DZ was carefully peeled away from the HFA to separate the DZ from the FZ as described previously (12). Cells in the separated zones were dispersed by enzymatic digestion and plated on plastic culture dishes (Falcon, Los Angeles, CA) at a density of approximately 25,000 cells/cm2. Culture medium consisted of a 1:1 (vol/vol) mixture of DMEM H-16 and Hams F-12 with 10% FCS, 2 mM glutamine, and antibiotics. Cells were incubated at 37 C in a humidified environment consisting of 5% CO2 in air. After 48 h in culture, the medium was changed to one containing 2% FCS, and nonadherent cells were removed. At the initiation of experiments (usually 96 h after plating), the medium was renewed and test substances were added in the doses shown in the figures. For studies of the regulation of MK, only FZ cells were used because they were more abundant. All experiments were replicated on adrenal cortical cells obtained from at least three different fetuses.
RNA isolation and quantitative real-time RT-PCR (qRT-PCR)
Total RNA extraction from HFAs was performed using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Human adult adrenal total RNA was obtained from archival material isolated from operative specimens in our previous studies (4, 13) and a commercial source (BD Biosciences). Human adult brain RNA was purchased from BD Biosciences. RNA was further purified using an RNeasy Mini kit together with its deoxyribonuclease (QIAGEN, Valencia, CA). Total RNA from primary culture cells was isolated and purified with an RNeasy Mini kit and deoxyribonuclease treatment. Purity and integrity of the RNA were assessed spectroscopically and by gel electrophoresis. Reverse transcription reactions with random primers were carried out with Omniscript reverse transcription (QIAGEN) under conditions described by the supplier. Expression of MK and its family member, pleiotrophin (PTN), and IGF-II were analyzed using real-time TaqMan RT-PCR as we have described previously (14, 15, 16). The levels of expression of each gene were normalized using ß-glucuronidase (GUS) levels after the comparative threshold cycle method (15, 16, 17). Sequences for the PCR primers and TaqMan fluorogenic probes were as follows: IGF-II: forward, CCTCCTGGAGACGTACTGTGCTA; reverse, TCATATTGGAAGAACTTGCCCA; TaqMan probe, FAM (6-carboxy-fluorescein)-CTTCCGGACAACTTCCCCAGATACCC-TAMRA (6-carboxytetramethyl-rhodamine) (18); MK: forward, GACCATCCGCGTCACCA; reverse, TCCAGGCTTGGCGTCTAGTC; TaqMan probe, FAM-CAAAGGCCAAAGCCAAGAAAGGGAAG-TAMRA; PTN: forward, AGATGTAAGATCCCCTGCAACTG; reverse, GGCTGTGTTCAGGTCACATTCTC; TaqMan probe, FAM-AGCAATTTGGCGCGGAGTGCAAATAC-TAMRA. All primers and probes were purchased from Integrated DNA Technologies (Coralville, IA).
Immunofluorescence studies
Cryosections (10 µm) were prepared from HFAs and processed for indirect immunofluorescence and subsequent imaging analysis as previously described (14, 16). Primary antibody incubation was performed with a 1:50 dilution of goat antihuman MK polyclonal antibody (R&D Systems), a combination of the anti-MK antibody, and a 1:300 dilution of rabbit anti-P450c17, or a combination of the anti-MK antibody and 1:10 dilution of mouse anti-CD56 monoclonal antibody (Leu-19; BD Biosciences), for 1 h at room temperature. After washing, incubation with Cy3-conjugated rabbit antigoat antibody (Jackson Laboratories, West Grove, PA) was performed at room temperature for 30 min for MK localization. Cy3-conjugated donkey antirabbit and fluorescein isothiocyanate (FITC)-conjugated donkey antigoat antibodies (Jackson Laboratories) were used to detect staining for P450c17 and MK, respectively. FITC-conjugated donkey antimouse and Cy3-conjugated donkey antigoat antibodies (Jackson Laboratories) were used to detect staining for CD56 and MK, respectively. After washing, slides were mounted with VectorShield mounting medium with 4',6-diamidino-2-phenylindole (Vector Laboratories, Inc., Burlingame, CA). Slides were examined with a DMR fluorescent microscope (Leica, Quebec, Canada). Image capture was performed with a DCS 430 digital camera (Eastman Kodak Co., Rochester, NY). Confocal microscopy was performed using a Carl Zeiss (Jena, Germany) 510 META laser scanning microscope. Control sections were stained with appropriate species-specific IgG or serum. Background staining using these controls under the conditions described above was minimal.
Cell proliferation assays
Cells isolated from the DZ or FZ were plated onto 96-well plates as described above. At the initiation of experiments (72 h after plating), the medium was renewed, and test substances were added in the doses indicated in the figures. In the experiments involving inhibitors of signal transduction, the cells were pretreated with the drugs for 30 min before the addition of MK. After a 72-h treatment, cell growth was evaluated by a nonradioactive colorimetric MTS/PMS proliferative assay performed with a CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI), according to the manufacturers instructions. After cell culture, 20 µl of combined MTS/PMS (20:1) reagent was added to the wells, and the cells were further incubated for 4 h at 37 C (5% CO2). The plates were analyzed at absorbance of 490 nm on a plate reader. Cell-free wells with medium only served as blanks.
Flow cytometric analysis of cultured adrenal cells
Preparations of adrenal cells were cultured in medium alone, 10 ng/ml bFGF, or 1 ng/ml MK. After 72 h of growth, the cells were harvested, counted, and analyzed for the frequency of DZ cells expressing the marker CD56. Cells were pelleted by centrifugation in 96-well Costar V-bottom plates (Corning Inc., Corning, NY) and suspended in 50 µl of blocking buffer consisting of PBS supplemented with 0.01% NaN3 (Sigma) and 5% normal mouse serum (Gemini-Bio-Products Inc., Woodland, CA). DZ cells were identified by expression of CD56 and lack of expression of CD31 and CD45 (14). Phycoerythrin and FITC-conjugated CD56 (clone C5.9) were purchased from Exalpha Corp. (Boston, MA). FITC-labeled CD31 (clone WM-59) and CD45 (clone 2D1) were purchased from BD Bioscience. Additionally, phycoerythrin- and FITC-labeled mouse IgG1 and mouse IgG2b were purchased from Caltag Laboratories (Burlingame, CA) and were used to determine the levels of nonspecific background staining. Cells were incubated with saturating amounts of antibodies on ice for at least 30 min. Cells were washed twice with 250 µl PBS with 0.3% fraction-V ethanol-extracted BSA (Roche Applied Science, Indianapolis, IN) and 0.01% NaN3. The washed cells were suspended in the washing buffer containing 2 µg/ml propidium iodide (Molecular Probes, Eugene, OR). Propidium iodide was used to stain dead cells so that they could be excluded from the flow cytometric analysis. Flow cytometry was performed using a FACSCalibur flow cytometer (BD Biosciences). Analyses of results were performed using CellQuest software (BD Biosciences).
Statistical analysis
Data were analyzed by ANOVA, followed by Student-Newman-Keul posttest for multiple comparisons, or by Students t test, where appropriate. P < 0.05 was accepted as significant.
| Results |
|---|
|
|
|---|
To gain insight into the roles of MK in the HFA, we examined mRNA levels of MK in human fetal and adult adrenals. qRT-PCR revealed that mean MK mRNA levels in fetal adrenals were 4.4-fold higher than those in adult adrenals (P < 0.05) and were comparable to the levels in fetal and adult brains (positive controls) (Fig. 1
). In contrast, mRNA levels of PTN, the related family protein, were not significantly different from adult values and were much lower than those of fetal and adult brains and those of MK in HFAs. MK and PTN mRNA levels did not change significantly during midgestation.
|
MK protein was localized in midgestation HFA frozen sections by immunofluorescence. MK immunoreactivity was found abundantly on cell surfaces and extracellular matrix throughout the HFA, with strong cytoplasmic staining in scattered cortical cells, particularly in the FZ (Fig. 2
). Predominant staining for MK was evident in the FZ compared with the DZ (Fig. 2
, B and C). Double staining with zone-specific markers, P450c17 (FZ marker) and CD56 (DZ marker) (14), demonstrated that several scattered cells in the DZ, albeit less in number compared with those in the FZ (Fig. 2E
), also exhibited strong cytoplasmic staining for MK peptide (Fig. 2F
). There was no apparent effect of gestational age on the pattern of staining for MK over the age range studied (i.e. 1724 wk).
|
We then tested the capacity of MK to act as a mitogen for isolated HFA cortical cells using a nonradioactive colorimetric MTS/PMS assay. MK showed proliferative effects on isolated DZ cells but not on FZ cells. In contrast, bFGF, a potent mitogen for adrenocortical cells, stimulated proliferation of cells from both zones (Fig. 3
). The proliferative effect of MK on DZ cells was further confirmed by flow cytometric analysis using CD56, a DZ cell marker (14). Cells prepared from whole adrenal tissues were treated with bFGF, MK, or medium alone. As shown in Fig. 4
, both bFGF and MK significantly increased the number of CD56+ cells recovered from cultured cells prepared from whole fetal adrenals, confirming the mitotic effect of MK on DZ cells.
|
|
|
To determine whether ACTH regulates MK gene expression, isolated FZ cells were challenged with ACTH treatment (Fig. 6
, A and B). Total RNA was extracted and analyzed by qRT-PCR. The action of ACTH on cultured cortical cells was confirmed by assessing its effects on the abundance of IGF-II mRNA, which is known to be up-regulated by ACTH (22). ACTH (1 nM) caused a significant 3.5-fold increase in MK mRNA levels after 48 h (Fig. 6A
). Dose-response experiments revealed that maximal stimulation was attained at concentrations equal to or greater than 1 nM (Fig. 6B
). Forskolin or 8-Br-cAMP mimicked the effects of ACTH on the accumulation of mRNA encoding MK (Fig. 6C
).
|
| Discussion |
|---|
|
|
|---|
We provide quantitative data on MK expression in human fetal and adult adrenal glands using qRT-PCR. MK mRNA levels in the HFA were markedly higher than in adult adrenals, whereas levels of mRNA encoding the related family protein, PTN, were much lower than MK. We also show that MK immunoreactivity is observed throughout the HFA at midgestation. The presence of MK protein on cell membranes and extracellular matrix, accompanied by cytoplasmic staining in several scattered cells, suggests that MK may be produced and secreted by adrenal cortical cells and that matrix molecules may sequester and store MK. This distribution pattern of MK protein, because it resembles that of bFGF (23), may similarly reflect a heparin-binding growth factor that is locally active. Collectively, these results indicate that MK is likely an important player in the development of the HFA and merits further investigation.
Rapid growth of the primate fetal adrenal gland at midgestation is supported by an active proliferative drive observed in the periphery of the gland, i.e. the DZ. A classic ultrastructural study by Johannisson (3) revealed that the DZ exhibits numerous mitotic figures, whereas mitotic figures are scant in the FZ. We later confirmed this finding by staining for proliferating cell nuclear antigen (4). Before the third trimester, the DZ cells are not capable of producing steroids. This has led to the hypothesis that DZ cells may represent a progenitor population in the HFA (1, 14, 24). The mechanism(s) that maintain the active, proliferative phenotype of DZ cells remain unclear. In this study, MK exhibited selective proliferative effects only on DZ cells but not on FZ cells. In contrast, bFGF elicited proliferative responses on both cell types, consistent with our previous study (6) and that of Hornsby et al. (25). Similarly, EGF stimulated proliferation of cells from both zones (6). The current study identifies MK as a novel growth factor that can selectively regulate DZ growth. Thus, effects of DZ-selective growth factors such as MK may in part explain why DZ cells have a proliferative phenotype in vivo. Alternatively, DZ cells per se may be more responsive to proliferative stimuli such as bFGF and EGF. Previous studies showed that DZ cells were more responsive to the proliferative actions of bFGF and EGF (6, 25).
MK is mitogenic for a number of cell types including endothelial cells, keratinocytes, and fibroblasts (9). The mechanism of action of MK has not been well documented, largely because of the lack of a well-defined MK receptor that can transduce the growth factor signal (9). However, recent studies indicate that the MK receptor may be a molecular complex that contains protein-tyrosine phosphatase
(PTP
), anaplastic lymphoma kinase (ALK), and low-density lipoprotein receptor-related protein (LRP). Indeed, MK has been shown to signal through ALK and PTP
in its proliferative actions and in MK-induced neuronal migration, respectively (26, 27). Receptor(s) that mediate the mitogenic actions of MK on DZ cells remain to be defined. RT-PCR and immunocytochemistry did not detect expression of PTP
and ALK in midgestation HFAs. By contrast, LRP was expressed in the HFA; however, significant immunoreactive LRP was only seen in the capsule, not in cortical cells (Ishimoto, H., and R. B. Jaffe, unpublished observations). As mitogenic effects of MK were observed only on DZ cells, we hypothesize that an MK receptor that has DZ-specific expression may be involved in the DZ-selective mitogenic effects of MK. Recently, we found that neural cell adhesion molecule (NCAM; CD56) is highly expressed in the DZ of the HFA and can serve as a marker of DZ cells (14). Intriguingly, a recent study demonstrated that NCAM was present in an MK-binding membrane protein fraction isolated from mouse embryos, suggesting that NCAM also may be an MK receptor (28). Therefore, the possibility that the DZ-selective effect of MK is mediated through NCAM will be the subject of future studies.
Although little has been documented concerning downstream pathways of growth factor signaling by MK, recent studies indicate that PI3-K and MAPK may be involved (9, 19, 20). Src family kinases may also be included in MK signaling (21). In this study, MK-stimulated proliferation of DZ cells was attenuated by LY294002 (PI3-K inhibitor), PD98059 (MAPK kinase inhibitor), or PP2 (inhibitor of Src family kinases), suggesting involvement of these kinases in the downstream signaling pathway of MK. Because the magnitude of DZ cell proliferation induced by MK is only moderate, studies using a cell line that responds well to MK will be necessary to further determine respective contributions of these protein kinases to the MK signaling.
ACTH provides the primary drive for the development and function of the HFA (1). However, ACTH is not a growth factor by itself and is not a mitogen for adrenal cortical cells in vitro (29, 30), whereas it stimulates adrenal growth in vivo (1, 31), suggesting that its trophic actions may be mediated by local growth factors. We have demonstrated that bFGF and IGF-II are likely to be such local growth factors, acting in an autocrine and/or paracrine fashion, in human and subhuman primate fetal adrenal growth (7, 22, 32). Our present study demonstrates that ACTH can stimulate MK mRNA accumulation in primary cultures of FZ cells, suggesting that MK may be another autocrine and/or paracrine mediator of the tropic actions of ACTH. Tropic hormonal regulation of MK mRNA expression also has been reported in other steroidogenic tissues. In the ovary, MK mRNA levels were increased by pregnant mare serum gonadotropin and decreased by pregnant mare serum gonadotropin plus human chorionic gonadotropin treatment of immature rats (33). FSH increased MK mRNA levels by 2-fold in cultured rat granulosa cells (34). The stimulatory effects of FSH were mimicked by 8-Br-cAMP. In a parallel manner, our results demonstrate that MK can also be up-regulated by 8-Br-cAMP and forskolin. The almost identical effects of these reagents and ACTH are consistent with the concept that ACTH action is mediated through the activation of adenylate cyclase, with subsequent increase in intracellular cAMP (35).
In summary, this is the first study that describes the expression, function, and regulation of the heparin-binding growth factor MK in the HFA. The novel finding of MKs selective in vitro proliferative effects on DZ cells affords insight into the mechanisms by which DZ cells maintain their proliferative phenotype in vivo. As the DZ has been postulated to serve as a pool of progenitor cells, DZ cell-selective proliferative effects of MK indicate that it is likely a significant growth factor for the HFA. In addition, this study demonstrates that ACTH can stimulate expression of MK, further extending our understanding of the coordinated molecular regulation of adrenal growth and function by ACTH.
| Acknowledgments |
|---|
| Footnotes |
|---|
This work was presented, in part, at the annual meeting of The Endocrine Society, June 2004, New Orleans.
Present address for M.O.M.: Blood Systems Research Institute, San Francisco, California 94118.
Disclosure summary: The authors have nothing to disclose.
First Published Online August 8, 2006
Abbreviations: ALK, Anaplastic lymphoma kinase; bFGF, basic fibroblast growth factor; 8-Br-cAMP, 8-bromoadenosine cAMP; DZ, definitive zone; EGF, epidermal growth factor; FAM, 6-carboxy-fluorescein; FITC, fluorescein isothiocyanate; FZ, fetal zone; GUS, ß-glucuronidase; HFA, human fetal adrenal gland; LRP, low-density lipoprotein receptor-related protein; MK, midkine; NCAM, neural cell adhesion molecule; P450c17, 17
-hydroxylase/17,20 lyase; PI3-K, phosphatidylinositol 3-kinase; PTN, pleiotrophin; PTP, protein-tyrosine phosphatase; qRT-PCR, quantitative real-time RT-PCR; TAMRA, 6-carboxytetramethyl-rhodamine.
Received May 26, 2006.
Accepted July 31, 2006.
| References |
|---|
|
|
|---|
. Mitogen-activated protein kinase, and phosphatidylinositol 3-kinase. J Biol Chem 276:1586815875
/RPTPß binds a heparin-binding growth factor midkine. Involvement of arginine 78 of midkine in the high affinity binding to PTP
. J Biol Chem 274:1247412479This article has been cited by other articles:
![]() |
T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J. D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, et al. Expression of Ovary-Specific Acidic Protein in Steroidogenic Tissues: A Possible Role in Steroidogenesis Endocrinology, July 1, 2009; 150(7): 3353 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishimoto, K. Minegishi, T. Higuchi, M. Furuya, S. Asai, S. H. Kim, M. Tanaka, Y. Yoshimura, and R. B. Jaffe The Periphery of the Human Fetal Adrenal Gland Is a Site of Angiogenesis: Zonal Differential Expression and Regulation of Angiogenic Factors J. Clin. Endocrinol. Metab., June 1, 2008; 93(6): 2402 - 2408. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Doghman, M. Arhatte, H. Thibout, G. Rodrigues, J. De Moura, S. Grosso, A. N. West, M. Laurent, J.-C. Mas, A. Bongain, et al. Nephroblastoma Overexpressed/Cysteine-Rich Protein 61/Connective Tissue Growth Factor/Nephroblastoma Overexpressed Gene-3 (NOV/CCN3), a Selective Adrenocortical Cell Proapoptotic Factor, Is Down-Regulated in Childhood Adrenocortical Tumors J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3253 - 3260. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |