| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Medicine (F.W.L.), Pathology (C.R.H.), and Surgery (J.M.S.), University Hospitals of Cleveland and Case Western Reserve University School of Medicine, Cleveland, Ohio 44121; and Center for Molecular Medicine (K.R.C., A.A.), University of Connecticut School of Medicine, Farmington, Connecticut 06030
Address all correspondence and requests for reprints to: Fred W. Lafferty, M.D., University Suburban Health Center, 1611 South Green Road, Suite 147, Cleveland, Ohio 44121. E-mail: FWLafferty{at}aol.com.
| Abstract |
|---|
|
|
|---|
Objective: Our objective was to investigate the cause of a low-normal serum PTH in a patient with PHP.
Patient: A 57-yr-old asymptomatic white female from the private practice of F.W.L. presented with an 8-yr history of a rising serum calcium from 10.511.6 mg/dl (2.632.88 mmol/liter) and a low-normal serum intact PTH of 29.2 pg/ml. After localization of a parathyroid adenoma by [18F]fluorodesoxyglucose positron emission tomography scanning, a 120-mg parathyroid adenoma was removed with the achievement of normocalcemia for the subsequent 2 yr.
Methods: Routine pre- and postoperative serum intact PTH assays were preformed at both the Quest Diagnostics regional laboratory in Pittsburgh, Pennsylvania, and at the Quest Diagnostics Nichols Institute in California. In addition, intact, biointact, and C-terminal assays were measured in undiluted, 1:2 diluted, and 1:4 diluted sera at the Nichols Institute. PTH gene sequence analysis was performed from DNA extracted both from the parathyroid adenoma and the patients peripheral blood leukocytes.
Results: Dilution, with correction for the dilution factor, of the preoperative serum produced a progressive rise in the intact, biointact, and the C-terminal assays, whereas no dilution effect was seen in postoperative serum. No intragenic mutations in the pre-pro-PTH coding region were found in either the parathyroid adenoma or matched blood DNA samples.
Conclusions: The discordant preoperative immunoassay curves with dilution could not be explained by the adenoma producing a mutated PTH. Furthermore, an autoantibody against the PTH produced by the adenoma is ruled out by the prompt loss of the dilution effect in the three PTH assays within 1 wk of the adenomas excision. A posttranslational effect on the PTH molecule within the adenoma remains a possible explanation for the discordant immunoassay curves. Our report emphasizes that one cannot always rule out PHP because of a low-normal serum intact or biointact PTH. Repeated PTH measurements after serum dilution in suspected cases of PHP with low-normal PTH levels may be a useful method for detecting atypical forms of PTH.
| Introduction |
|---|
|
|
|---|
The following case report further emphasizes that primary hyperparathyroidism may present with a low-normal PTH and suggests that not all bioactive PTH produced by parathyroid adenomas is measured by the current intact and biointact assays.
| Patient and Methods |
|---|
|
|
|---|
A 57-yr-old white female presented in January 2003 with an 8-yr history of a rising serum calcium from 10.511.6 mg/dl (2.632.90 mmol/liter) with a normal range of 8.510.5 mg/dl or 2.132.63 mmol/liter. From 1995 until her menopause in 2000, routine serum multichannel measurements of calcium fluctuated from 10.0 mg/dl (2.50 mmol/liter) to 10.7 mg/dl (2.67 mmol/liter) but postmenopausally rose to 11.1 mg/dl (2.77 mmol/liter) in December 2002 and 11.6 mg/dl (2.90 mmol/liter) in January 2003. She was asymptomatic with no history of bone disease, dyspepsia, constipation, weakness, renal calculi, depression, loss of vitality, or cardiovascular disease. A spontaneous menopause occurred at age 55 with no subsequent estrogen replacement. There was no family history of hypercalcemia. She denied the intake of thiazides, lithium, or supplements of calcium, vitamin D, and vitamin A.
Physical examination was normal, including a blood pressure of 120/80 mm Hg and a body mass index of 23 kg/m2, with no evidence of neck masses, thyromegaly, lymphadenopathy, or organomegaly. Bone densitometry using the Hologic 4500 in 1998 and 2002 revealed a stable osteopenia of the anteroposterior spine (T score, 1.4), the total hip (T score, 0.8), and femoral neck (T score, 1.6).
Additional serum measurements obtained between January and March 2003 included a phosphorus of 2.8 mg/dl (0.9 mmol/liter), a chloride of 102 meq/liter (102 mmol/liter), an alkaline phosphatase of 112 U/liter (reference range, 33112 U/liter), a creatinine of 0.8 mg/dl (71 mmol/liter), a TSH of 1.16 mIU/liter, and a normal serum protein electrophoresis. The complete blood count was normal. The 24-h urinary calcium was 176 mg (4.4 mmol). Serum hormone measurements included an intact PTH of 29.229.7 pg/ml (Nichols reference range, 1065), a PTHrP less than 0.3 pmol/liter (Nichols reference range, 0.01.5), a 25-hydroxyvitamin D of 42 ng/ml (reference range, 8.946.7), and a 1,25-dihydroxyvitamin D of 98 pg/ml (reference range, 1560). The angiotensin-converting enzyme was 25 U/liter (reference range, 889). A 10-d corticosteroid suppression test using 40 mg prednisone daily failed to reduce the serum calcium to less than 11.6 mg/dl (2.90 mmol/liter).
Radiological studies included a normal chest x-ray, a total body bone scan, and a negative computed tomography scan of the chest and abdomen. Because of a suspicion of malignancy or granulomatous disease, a positron emission tomography (PET) scan of the torso was obtained using 19 mCi of [18F]fluorodesoxyglucose. This revealed a hot spot in the lower left neck (Fig. 1
). A subsequent double-phase sestamibi single-photon emission computed tomography scan revealed a subtle area of increased uptake inferior and posterior to the left lobe of the thyroid suspicious for a parathyroid adenoma.
|
Methods
All studies were performed in accordance with institutional review board-approved protocols for human studies. The serum calcium measurement method has not changed at our laboratory since 1995. Routine assays performed at Quest Diagnostics Inc., Pittsburgh, Pennsylvania, were as follows: PTH (Nichols Advantage Intact Parathyroid Hormone assay, catalog no. 52-7022), 25-hydroxyvitamin D, and 1,25-dihydroxyvitamin D. PTHrP was performed at ARUP Laboratories in Salt Lake City, Utah, using a Nichols Institute Diagnostics kit.
Frozen (20 C) preoperative and 1-wk postoperative sera were sent to Quest Diagnostics Nichols Institute (San Juan Capistrano, CA) where biointact PTH [Nichols Advantage BIO-INTACT PTH (184), catalog no. 62-7040], intact PTH (Nichols Advantage Intact Parathyroid Hormone, catalog no. 52-7022), and C-terminal PTH (C/MM PTH Parathyroid Hormone, Nichols Institute Diagnostics, catalog no. 40-2130) assays were measured in undiluted, 1:2 diluted, and 1:4 diluted sera.
The parathyroid adenoma sample was histologically confirmed by a pathologist, and tumor genomic DNA was extracted from fixed, paraffin-embedded tissue using the MagneSil Genomic, Fixed Tissue System (Promega, Madison, WI). Germline genomic DNA was extracted from the patients peripheral blood leukocytes using Gentra Systems Puregene DNA Purification Kit (Gentra, Minneapolis, MN). PCR amplification of the pre-pro-PTH coding region was performed using the following primers: exon 2 forward, 5'CCTCCATTTTGCTTGTCCT3'; exon 2 reverse, 5'CCTGGGAAGAAGAGAACAGA3'; exon 3A forward, 5'GCCCTCTCTGTTTCTCTTC3'; exon 3A reverse, 5'GGCTCTCAACCAAGACATTGT3'; exon 3B forward, 5'GAGAGTAGAATGGCTGCGTAA3'; and exon 3B reverse, 5'ATCAGAAATATTGGCACTTGG3'.
PCR included 25 ng template DNA and Platinum Taq polymerase (Invitrogen, Carlsbad, CA). PCR parameters were 94 C for 1 min and then 35 cycles at 94 C for 30 sec, 55 C for 30 sec, and 68 C for 1 min followed by a 4 C hold. PCR product was then purified with Exo-SAP-It (USB Corp., Cleveland, OH), and sequenced using Beckman Coulters DNA sequencing protocol and the CEQ 8800 Genetic Analysis System (Beckman Coulter, Fullerton, CA). The listed PCR primers (Invitrogen) were used as sequencing primers, and all products were sequenced on both complementary strands.
| Results |
|---|
|
|
|---|
|
|
| Discussion |
|---|
|
|
|---|
The intact, biointact, and C-terminal assays performed on the preoperative serum by the Nichols Reference Laboratory were all in the low or midrange of normal. The biointact and intact PTH assays are homogeneous sandwich assays and are subject to the hook effect. However, for the observed values to be falsely low because of the hook effect, the actual PTH value would have to be greater than 1 x 106 pg/ml. High-dose hook effect could not have occurred with the C-terminal assay (10). The intact PTH level (19 pg/ml) found by the Nichols California laboratory that was lower than that measured at the Pittsburgh laboratory (29.229.7 pg/ml) can be explained by the use of different reagent lots by the two laboratories, each optimized for normal PTH but not for cross-reaction substances such as an altered PTH. One week postoperatively, both laboratories found identical intact PTH levels of 14 pg/ml.
With increasing dilution of serum, with correction for the dilution factor, the PTH rose to the mid-normal range with the intact assay and to slightly elevated levels with the biointact and C-terminal assays (Table 1
). According to Yalow and Berson (11), when an assays calibrator and a patients antigen are identical, dilutions of both yield superimposable immunoassay curves. When the patients antigen is slightly different, dilutions produce a divergent immunoassay curve that may yield incorrect results when read off the correct calibration curve. In the present case, the preoperative divergence from the normal reference curve of PTH is most consistent with the adenoma producing a bioactive form of PTH that was not totally measured by the intact or biointact assays. Postoperatively, there was no effect of serum dilution on PTH levels, which is not compatible with the patient having an antibody to PTH (Fig. 2
). Furthermore, autoantibodies to PTH cause elevated PTH levels (12). An intragenic mutation producing an abnormal PTH within the adenoma was not found by PTH gene sequence analysis.
The 784 PTH peptide makes up roughly 15% of the measured intact assay in normal plasma, whereas the amino-truncated PTH (784) may account for 30% or more of the intact assay measurement in primary and secondary hyperparathyroidism (13). It is surprising that the preoperative intact and biointact assay levels were nearly identical in the present case, but the biointact assay level was appropriately 20% lower postoperatively. However, the intact and biointact assays may not completely detect PTH if a posttranslational alteration has occurred within an adenoma. DAmour et al. (14) have recently described an amino-terminal form of PTH with modifications in the 1520 amino acid region. This amino PTH is recognized by the biointact but not by the intact assay and is overproduced in hyperparathyroidism. However, an amino PTH would not explain the low-normal preoperative biointact PTH assays in the present case.
In conclusion, we have described a surgically proven case of primary hyperparathyroidism secondary to an adenoma in which the intact and biointact PTH assays were low-normal. The lack of an intragenic mutation in the parathyroid adenoma is strongly suggestive of a posttranslational alteration of PTH within the adenoma cells that interferes with PTH measurement by immunoassay but not with its action on the PTH receptor. One can only speculate as to the frequency of this condition and as to how often neck exploration is not performed because of finding a low-normal serum PTH. The use of serum dilution in PTH measurements among cases of suspected primary hyperparathyroidism with low-normal PTH levels may be helpful in detecting posttranslational changes of the PTH molecule.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online July 18, 2006
Abbreviation: PET, Positron emission tomography.
Received February 8, 2006.
Accepted July 10, 2006.
| References |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |