help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2006-0273
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lafferty, F. W.
Right arrow Articles by Shuck, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lafferty, F. W.
Right arrow Articles by Shuck, J. M.
Related Collections
Right arrow Calcium and Bone Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 91, No. 10 3826-3829
Copyright © 2006 by The Endocrine Society

Primary Hyperparathyroidism with a Low-Normal, Atypical Serum Parathyroid Hormone as Shown by Discordant Immunoassay Curves

Fred W. Lafferty, Clive R. Hamlin, Kristin R. Corrado, Andrew Arnold and Jerry M. Shuck

Departments of Medicine (F.W.L.), Pathology (C.R.H.), and Surgery (J.M.S.), University Hospitals of Cleveland and Case Western Reserve University School of Medicine, Cleveland, Ohio 44121; and Center for Molecular Medicine (K.R.C., A.A.), University of Connecticut School of Medicine, Farmington, Connecticut 06030

Address all correspondence and requests for reprints to: Fred W. Lafferty, M.D., University Suburban Health Center, 1611 South Green Road, Suite 147, Cleveland, Ohio 44121. E-mail: FWLafferty{at}aol.com.


    Abstract
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
Context: In patients with primary hyperparathyroidism (PHP), one expects to find a serum PTH in the high or high-normal range. The presence of a low-normal PTH in PHP can be difficult to explain.

Objective: Our objective was to investigate the cause of a low-normal serum PTH in a patient with PHP.

Patient: A 57-yr-old asymptomatic white female from the private practice of F.W.L. presented with an 8-yr history of a rising serum calcium from 10.5–11.6 mg/dl (2.63–2.88 mmol/liter) and a low-normal serum intact PTH of 29.2 pg/ml. After localization of a parathyroid adenoma by [18F]fluorodesoxyglucose positron emission tomography scanning, a 120-mg parathyroid adenoma was removed with the achievement of normocalcemia for the subsequent 2 yr.

Methods: Routine pre- and postoperative serum intact PTH assays were preformed at both the Quest Diagnostics regional laboratory in Pittsburgh, Pennsylvania, and at the Quest Diagnostics Nichols Institute in California. In addition, intact, biointact, and C-terminal assays were measured in undiluted, 1:2 diluted, and 1:4 diluted sera at the Nichols Institute. PTH gene sequence analysis was performed from DNA extracted both from the parathyroid adenoma and the patient’s peripheral blood leukocytes.

Results: Dilution, with correction for the dilution factor, of the preoperative serum produced a progressive rise in the intact, biointact, and the C-terminal assays, whereas no dilution effect was seen in postoperative serum. No intragenic mutations in the pre-pro-PTH coding region were found in either the parathyroid adenoma or matched blood DNA samples.

Conclusions: The discordant preoperative immunoassay curves with dilution could not be explained by the adenoma producing a mutated PTH. Furthermore, an autoantibody against the PTH produced by the adenoma is ruled out by the prompt loss of the dilution effect in the three PTH assays within 1 wk of the adenoma’s excision. A posttranslational effect on the PTH molecule within the adenoma remains a possible explanation for the discordant immunoassay curves. Our report emphasizes that one cannot always rule out PHP because of a low-normal serum intact or biointact PTH. Repeated PTH measurements after serum dilution in suspected cases of PHP with low-normal PTH levels may be a useful method for detecting atypical forms of PTH.


    Introduction
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
THE UNDERLYING CAUSE of hypercalcemia continues to challenge the clinician despite advances in the measurements of serum PTH, PTHrP, 25-hydroxyvitamin D3, and 1,25-dihydroxyvitamin D3 and new scanning techniques (1). Since the introduction of the intact PTH assay (immunoradiometric assay) in 1984, it has generally been accepted that all patients with primary hyperparathyroidism have PTH levels that are elevated or in the upper third of the normal range (2, 3). Those patients having PTH levels in the lower third of the normal range with the older intact assay represented the hypercalcemia of malignancy as found in five of 63 such cases by Nussbaum and Potts (2). However, two detailed case reports of low-normal or subnormal serum intact PTH in surgically proven hyperparathyroidism have been reported by Hollenberg and Arnold in 1991 (4) and Glendenning et al. in 1996 (5). In 1998, Glendenning et al. (6) reported 60 cases of surgically proven hyperparathyroidism in which 11 (18%) had serum intact PTH levels (Ciba Corning Magiclite ICMA) in the upper half of the normal range. In 2000, Michis-Troussard et al. (7) reported that 20 (7.4%) of 271 cases of surgically proven primary hyperparathyroidism had preoperative intact assays in the normal range. Eleven of the 20 cases (4%) were in the upper third, eight cases (3%) in the middle third, and one case in the lower third of the normal range.

The following case report further emphasizes that primary hyperparathyroidism may present with a low-normal PTH and suggests that not all bioactive PTH produced by parathyroid adenomas is measured by the current intact and biointact assays.


    Patient and Methods
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
Case report

A 57-yr-old white female presented in January 2003 with an 8-yr history of a rising serum calcium from 10.5–11.6 mg/dl (2.63–2.90 mmol/liter) with a normal range of 8.5–10.5 mg/dl or 2.13–2.63 mmol/liter. From 1995 until her menopause in 2000, routine serum multichannel measurements of calcium fluctuated from 10.0 mg/dl (2.50 mmol/liter) to 10.7 mg/dl (2.67 mmol/liter) but postmenopausally rose to 11.1 mg/dl (2.77 mmol/liter) in December 2002 and 11.6 mg/dl (2.90 mmol/liter) in January 2003. She was asymptomatic with no history of bone disease, dyspepsia, constipation, weakness, renal calculi, depression, loss of vitality, or cardiovascular disease. A spontaneous menopause occurred at age 55 with no subsequent estrogen replacement. There was no family history of hypercalcemia. She denied the intake of thiazides, lithium, or supplements of calcium, vitamin D, and vitamin A.

Physical examination was normal, including a blood pressure of 120/80 mm Hg and a body mass index of 23 kg/m2, with no evidence of neck masses, thyromegaly, lymphadenopathy, or organomegaly. Bone densitometry using the Hologic 4500 in 1998 and 2002 revealed a stable osteopenia of the anteroposterior spine (T score, –1.4), the total hip (T score, –0.8), and femoral neck (T score, –1.6).

Additional serum measurements obtained between January and March 2003 included a phosphorus of 2.8 mg/dl (0.9 mmol/liter), a chloride of 102 meq/liter (102 mmol/liter), an alkaline phosphatase of 112 U/liter (reference range, 33–112 U/liter), a creatinine of 0.8 mg/dl (71 mmol/liter), a TSH of 1.16 mIU/liter, and a normal serum protein electrophoresis. The complete blood count was normal. The 24-h urinary calcium was 176 mg (4.4 mmol). Serum hormone measurements included an intact PTH of 29.2–29.7 pg/ml (Nichols reference range, 10–65), a PTHrP less than 0.3 pmol/liter (Nichols reference range, 0.0–1.5), a 25-hydroxyvitamin D of 42 ng/ml (reference range, 8.9–46.7), and a 1,25-dihydroxyvitamin D of 98 pg/ml (reference range, 15–60). The angiotensin-converting enzyme was 25 U/liter (reference range, 8–89). A 10-d corticosteroid suppression test using 40 mg prednisone daily failed to reduce the serum calcium to less than 11.6 mg/dl (2.90 mmol/liter).

Radiological studies included a normal chest x-ray, a total body bone scan, and a negative computed tomography scan of the chest and abdomen. Because of a suspicion of malignancy or granulomatous disease, a positron emission tomography (PET) scan of the torso was obtained using 19 mCi of [18F]fluorodesoxyglucose. This revealed a hot spot in the lower left neck (Fig. 1Go). A subsequent double-phase sestamibi single-photon emission computed tomography scan revealed a subtle area of increased uptake inferior and posterior to the left lobe of the thyroid suspicious for a parathyroid adenoma.


Figure 1
View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. [18F]Fluorodesoxyglucose PET scan of reported case. Scans of the neck and upper chest in the axial (left), sagittal (middle), and coronal (right) planes showing intense uptake in the mid-left neck. The less intense uptake medially represents [18F]fluorodesoxyglucose uptake by the vocal cords.

 
On April 3, 2003, a 120-mg clear-cell parathyroid adenoma was removed from a site posterior to the left lower thyroid. One week postoperatively, the serum Ca fell to 9.7 mg/dl (2.43 mmol/liter), the intact PTH to 14 pg/ml, and the P rose to 3.2 mg/dl (1.03 mmol/liter). In October 2003, the Ca was 9.9 mg/dl (2.48 mmol/liter) with an intact PTH of 21.6 pg/ml, and in April 2004, the Ca was 9.5 mg/dl (2.37 mmol/liter) with an intact PTH of 16.1 pg/ml.

Methods

All studies were performed in accordance with institutional review board-approved protocols for human studies. The serum calcium measurement method has not changed at our laboratory since 1995. Routine assays performed at Quest Diagnostics Inc., Pittsburgh, Pennsylvania, were as follows: PTH (Nichols Advantage Intact Parathyroid Hormone assay, catalog no. 52-7022), 25-hydroxyvitamin D, and 1,25-dihydroxyvitamin D. PTHrP was performed at ARUP Laboratories in Salt Lake City, Utah, using a Nichols Institute Diagnostics kit.

Frozen (–20 C) preoperative and 1-wk postoperative sera were sent to Quest Diagnostics Nichols Institute (San Juan Capistrano, CA) where biointact PTH [Nichols Advantage BIO-INTACT PTH (1–84), catalog no. 62-7040], intact PTH (Nichols Advantage Intact Parathyroid Hormone, catalog no. 52-7022), and C-terminal PTH (C/MM PTH Parathyroid Hormone, Nichols Institute Diagnostics, catalog no. 40-2130) assays were measured in undiluted, 1:2 diluted, and 1:4 diluted sera.

The parathyroid adenoma sample was histologically confirmed by a pathologist, and tumor genomic DNA was extracted from fixed, paraffin-embedded tissue using the MagneSil Genomic, Fixed Tissue System (Promega, Madison, WI). Germline genomic DNA was extracted from the patient’s peripheral blood leukocytes using Gentra Systems Puregene DNA Purification Kit (Gentra, Minneapolis, MN). PCR amplification of the pre-pro-PTH coding region was performed using the following primers: exon 2 forward, 5'CCTCCATTTTGCTTGTCCT3'; exon 2 reverse, 5'CCTGGGAAGAAGAGAACAGA3'; exon 3A forward, 5'GCCCTCTCTGTTTCTCTTC3'; exon 3A reverse, 5'GGCTCTCAACCAAGACATTGT3'; exon 3B forward, 5'GAGAGTAGAATGGCTGCGTAA3'; and exon 3B reverse, 5'ATCAGAAATATTGGCACTTGG3'.

PCR included 25 ng template DNA and Platinum Taq polymerase (Invitrogen, Carlsbad, CA). PCR parameters were 94 C for 1 min and then 35 cycles at 94 C for 30 sec, 55 C for 30 sec, and 68 C for 1 min followed by a 4 C hold. PCR product was then purified with Exo-SAP-It (USB Corp., Cleveland, OH), and sequenced using Beckman Coulter’s DNA sequencing protocol and the CEQ 8800 Genetic Analysis System (Beckman Coulter, Fullerton, CA). The listed PCR primers (Invitrogen) were used as sequencing primers, and all products were sequenced on both complementary strands.


    Results
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
The preoperative intact assay of 18 pg/ml by the Quest Diagnostics Nichols Institute Reference Laboratory (Table 1Go) was even lower than the 29.2–29.7 pg/ml obtained by the Pittsburgh Quest laboratory. Both the biointact and intact assays remained in the low range of normal with the C-terminal assay near the midrange of normal. Increasing dilution, with correction for the dilution factor, of the preoperative serum caused rising PTH levels by all three assays, a phenomenon not seen with serum obtained 1 wk postoperatively (Fig. 2Go).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Pre- and postoperative PTH assay: the effect of dilution

 

Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Pre- and postoperative PTH assays showing the effect of dilution in preoperative sera in contrast to 1 wk postoperative sera. The rise in PTH levels with dilution rapidly disappeared postoperatively.

 
Sequence analysis was performed using Sequencher version 4.5 software (Gene Codes Corp., Ann Arbor, MI). No intragenic mutations in the pre-pro-PTH coding region were found in either the parathyroid adenoma or matched blood DNA samples.


    Discussion
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 
The 8-yr history of hypercalcemia, which was accelerated after 5 yr by the menopause in the present case, was most consistent with primary hyperparathyroidism, but the finding of a low-normal intact PTH assay made that diagnosis uncertain. Initially, a chronic granulomatous disease such as sarcoidosis or lymphoma producing excessive 1,25-dihydroxyvitamin D seemed likely, but an elevation of 1,25-hydroxyvitamin D is also typical of primary hyperparathyroidism (1). A recent case report of coexistent primary hyperparathyroidism and sarcoidosis illustrates the suppression of PTH secretion from an adenoma by the 1,25-dihydroxyvitamin D produced by sarcoid tissue (8). However, the negative computed tomography scans of the chest and abdomen, the lack of lymphadenopathy on physical examination, and a normal serum antiogensin-converting enzyme did not support these diagnoses. Finally, the lack of calcium suppression with corticosteroids was consistent with primary hyperparathyroidism. The finding of a hot spot in her lower left neck with PET scanning further supported the diagnosis of primary hyperparathyroidism (9).

The intact, biointact, and C-terminal assays performed on the preoperative serum by the Nichols Reference Laboratory were all in the low or midrange of normal. The biointact and intact PTH assays are homogeneous sandwich assays and are subject to the hook effect. However, for the observed values to be falsely low because of the hook effect, the actual PTH value would have to be greater than 1 x 106 pg/ml. High-dose hook effect could not have occurred with the C-terminal assay (10). The intact PTH level (19 pg/ml) found by the Nichols California laboratory that was lower than that measured at the Pittsburgh laboratory (29.2–29.7 pg/ml) can be explained by the use of different reagent lots by the two laboratories, each optimized for normal PTH but not for cross-reaction substances such as an altered PTH. One week postoperatively, both laboratories found identical intact PTH levels of 14 pg/ml.

With increasing dilution of serum, with correction for the dilution factor, the PTH rose to the mid-normal range with the intact assay and to slightly elevated levels with the biointact and C-terminal assays (Table 1Go). According to Yalow and Berson (11), when an assay’s calibrator and a patient’s antigen are identical, dilutions of both yield superimposable immunoassay curves. When the patient’s antigen is slightly different, dilutions produce a divergent immunoassay curve that may yield incorrect results when read off the correct calibration curve. In the present case, the preoperative divergence from the normal reference curve of PTH is most consistent with the adenoma producing a bioactive form of PTH that was not totally measured by the intact or biointact assays. Postoperatively, there was no effect of serum dilution on PTH levels, which is not compatible with the patient having an antibody to PTH (Fig. 2Go). Furthermore, autoantibodies to PTH cause elevated PTH levels (12). An intragenic mutation producing an abnormal PTH within the adenoma was not found by PTH gene sequence analysis.

The 7–84 PTH peptide makes up roughly 15% of the measured intact assay in normal plasma, whereas the amino-truncated PTH (7–84) may account for 30% or more of the intact assay measurement in primary and secondary hyperparathyroidism (13). It is surprising that the preoperative intact and biointact assay levels were nearly identical in the present case, but the biointact assay level was appropriately 20% lower postoperatively. However, the intact and biointact assays may not completely detect PTH if a posttranslational alteration has occurred within an adenoma. D’Amour et al. (14) have recently described an amino-terminal form of PTH with modifications in the 15–20 amino acid region. This amino PTH is recognized by the biointact but not by the intact assay and is overproduced in hyperparathyroidism. However, an amino PTH would not explain the low-normal preoperative biointact PTH assays in the present case.

In conclusion, we have described a surgically proven case of primary hyperparathyroidism secondary to an adenoma in which the intact and biointact PTH assays were low-normal. The lack of an intragenic mutation in the parathyroid adenoma is strongly suggestive of a posttranslational alteration of PTH within the adenoma cells that interferes with PTH measurement by immunoassay but not with its action on the PTH receptor. One can only speculate as to the frequency of this condition and as to how often neck exploration is not performed because of finding a low-normal serum PTH. The use of serum dilution in PTH measurements among cases of suspected primary hyperparathyroidism with low-normal PTH levels may be helpful in detecting posttranslational changes of the PTH molecule.


    Acknowledgments
 
We thank Kathleen Allen, M.D., of Quest Diagnostics Inc. and Raj Pandian, Ph.D., of Quest Diagnostics Nichols Institute who arranged for the assays performed at Quest Diagnostics Nichols Institute at no charge to us. We also thank Elizabeth Saria, M.D., for assistance with the histological confirmation and dissection of parathyroid tissue sections at the University of Connecticut.


    Footnotes
 
The authors have nothing to declare.

First Published Online July 18, 2006

Abbreviation: PET, Positron emission tomography.

Received February 8, 2006.

Accepted July 10, 2006.


    References
 Top
 Abstract
 Introduction
 Patient and Methods
 Results
 Discussion
 References
 

  1. Lafferty FW 1991 Differential diagnosis of hypercalcemia. J Bone Miner Res 6(Suppl 2):S51–S59
  2. Nussbaum SR, Potts Jr JT 1991 Immunoassay for parathyroid hormone 1–84 in the diagnosis of hyperparathyroidism. J Bone Miner Res 6(Suppl 2):S43–S50
  3. Silverberg SJ, Gao P, Brown I, Logerfo P, Cantor TL, Bilezikian 2003 Clinical utility of an immunoradiometric assay for parathyroid hormone (1–84) in primary hyperparathyroidism. J Clin Endocrinol Metab 88:4725–4730[Abstract/Free Full Text]
  4. Hollenberg AN, Arnold A 1991 Hypercalcemia with low-normal serum intact PTH: a novel presentation of primary hyperparathyroidism. Am J Med 91:547–548[CrossRef][Medline]
  5. Glendenning P, Pullan PT, Gulland D, Edis A 1996 Surgically proven primary hyperparathyroidism with a suppressed intact parathyroid hormone. Med J Aust 165:197–198[Medline]
  6. Glendenning P, Gutteridge DH, Retallack RW, Stuckey BGA, Kermode DG, Kent GN 1998 High prevalence of normal serum calcium and intact PTH in 60 patients with proven primary hyperparathyroidism: a challenge to current diagnostic criteria. Aust NZ J Med 28:173–178[Medline]
  7. Mischis-Troussard C, Goudet P, Verges B, Cougard P, Tavernier C, Maillefert JF 2000 Primary hyperthyroidism with normal serum intact parathyroid hormone levels. QJM 93:365–367[Abstract/Free Full Text]
  8. Kinoshit Y, Taguchi M, Takesheta A, Miura D, Tomikawa S, Takeuchi Y 2005 1,25-Dihydroxy-vitamin D suppresses circulating levels of parathyroid hormone in a patient with primary hyperparathyroidism and coexistent sarcoidosis. J Clin Endocrinol Metab 90:6727–6731[Abstract/Free Full Text]
  9. Sundin A, Johansson C, Hellman P, Bergström M, Ahlström H, Jacobson GB, Langström B, Rastad J 1996 PET and parathyroid carbon-11 methionine accumulation in hyperparathyroidism. J Nucl Med 36:1766–1770
  10. Wheller CA, Davis S, Degefu S, Thorneyeroft IH, O’Quinn AG 1990 Ovarian choriocarcinoma: a difficult diagnosis of an unusual tumor and a review of the hook effect. Obstet Gynecol 75:547–549[Medline]
  11. Yalow RS, Berson SA 1971 Problems of validation of radioimmunoassays. In: Odell WD, Daughaday WH, eds. Principles of competitive protein binding assays. Lippincott; Philadelphia: 374–400
  12. Wilkinson M, McElduff A, Wilson J, Haber P, Freeman A, Robertson M, Mathews P 1990 Spontaneously occurring antibodies to parathyroid hormone. J Clin Endocrinol Metab 70:174–1749
  13. Bringhurst FR 2003 Circulating forms of parathyroid hormone: peeling back the onion. Clin Chem 49:1973–1975[Free Full Text]
  14. D’Amour P, Brossard JH, Rousseau L, Roy L, Gao P, Cantor T 2003 Amino-terminal form a parathyroid hormone (PTH) with immunologic similarities to hPTH (1–84) is overproduced in primary and secondary hyperparathyroidism. Clin Chem 49:2037–2044[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lafferty, F. W.
Right arrow Articles by Shuck, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lafferty, F. W.
Right arrow Articles by Shuck, J. M.
Related Collections
Right arrow Calcium and Bone Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals