help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism, doi:10.1210/jc.2005-0210
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/9/5279    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cakmak, H.
Right arrow Articles by Lockwood, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cakmak, H.
Right arrow Articles by Lockwood, C. J.
Related Collections
Right arrow Female Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 9 5279-5286
Copyright © 2005 by The Endocrine Society

Progestin Suppresses Thrombin- and Interleukin-1ß-Induced Interleukin-11 Production in Term Decidual Cells: Implications for Preterm Delivery

Hakan Cakmak, Frederick Schatz, S.-T. Joseph Huang, Lynn Buchwalder, Mizanur Rahman, Aydin Arici and Charles J. Lockwood

Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, New Haven, Connecticut 06520-8063

Address all correspondence and requests for reprints to: Dr. Charles J. Lockwood, Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, 333 Cedar Street, FMB 334, P.O. Box 208063, New Haven, Connecticut 06520-8063. E-mail: chairobgyn{at}yale.edu.


   Abstract
Top
 Abstract
Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Context: Decidual inflammation and hemorrhage are major contributors to the pathogenesis of preterm delivery (PTD). IL-11 is a cytokine with pleiotropic biological effects, including induction of T helper cell type 2 and inhibition of T helper cell type 1 cytokine responses. Paradoxically, it enhances the synthesis of prostaglandins, which induce labor.

Objective: The objectives of this study were to evaluate in vivo IL-11 expression in decidua after term and preterm deliveries and evaluate the effects of the primary mediators of inflammation, IL-1ß and TNF-{alpha}, as well as the primary regulator of hemostasis, thrombin, on IL-11 expression in cultured term decidual cells (DCs).

Interventions and Main Outcome Measures: Human decidua from uncomplicated term deliveries and chorioamnionitis- or placental abruption-related PTDs were immunostained for IL-11. Cultures of DCs were primed with estradiol (E2) or with E2 and medroxyprogesterone acetate (MPA), then incubated in a defined medium with corresponding steroid(s) with or without IL-1ß, TNF-{alpha}, or thrombin. IL-11 levels in DC-defined media were assessed by ELISA and Western blotting; IL-11 mRNA levels were measured by quantitative RT-PCR.

Results: IL-11 immunostaining was significantly higher in DCs after PTD compared with those after term delivery (P < 0.05). In the absence of cytokines or thrombin, IL-11 levels in the defined medium were 47% lower in incubations with E2 plus MPA vs. E2 alone (P = 0.001). IL-1ß and thrombin elevated IL-11 output during incubations with E2 [24-fold (P < 0.05) and 120-fold (P < 0.05), respectively]. These increases were blunted by the addition of MPA [13-fold (P < 0.05) and 36-fold (P < 0.05), respectively]. Western blot analysis confirmed the ELISA results, and RT-PCR demonstrated corresponding effects on IL-11 mRNA levels. Unexpectedly, TNF-{alpha} did not affect IL-11 levels.

Conclusion: Because excess IL-1ß and thrombin generation are associated with chorioamnionitis- and abruption-related PTD, respectively, these findings add to our understanding of the genesis of inflammation- and abruption-associated prematurity.


   Introduction
Top
 Abstract
 Introduction
Patients and Methods
 Results
 Discussion
 References
 
PRETERM DELIVERY (PTD) complicates over 12% of all live births and is a major cause of perinatal morbidity and mortality. The principal pathogenic mechanisms for early PTD (<32 wk) are intrauterine infection and placental abruption (1). Intrauterine inflammation, which is the most frequent antecedent of preterm premature rupture of the fetal membranes (PPROM) and preterm labor with intact membranes, causes premature activation of cytokine cascades that, in turn, initiates parturition mechanisms (1). Prematurity stemming from intrauterine infection is associated with a marked elevation in amniotic fluid IL-1ß concentrations (2), although there is conflicting evidence as to whether amniotic TNF-{alpha} levels are also elevated (2, 3, 4, 5).

Decidual hemorrhage (abruption) has been identified histologically in the placentas of about 45% of patients with PTD (6). Tissue factor, the primary initiator of hemostasis, is highly expressed in decidual cells (DCs) of gestational human endometrium (7, 8). After decidual hemorrhage, membrane-bound DC-expressed tissue factor binds plasma factor VII to activate factor X directly or indirectly via activation of factor IX. Ultimately, prothrombin is converted to thrombin, which promotes hemostasis by acting as a serine protease that specifically cleaves fibrinogen to fibrin. In addition to this extracellular action, thrombin binds to G protein-coupled protease-activated receptors to mediate various biological effects (9), including enhanced decidual protease expression (10, 11). Elevated maternal plasma levels of thrombin-antithrombin complexes are highly predictive of PTD due to PPROM and preterm labor, suggesting a role for decidual thrombin generation in the etiology of these adverse pregnancy outcomes (12, 13).

IL-11 is a cytokine with pleiotropic biological activities in diverse cell types. It is a member of the IL-6-type cytokine family, whose biological activities stem from binding to a surface receptor complex comprised of a ligand-specific {alpha}-chain and the signaling component, glycoprotein 130 (14). Although originally identified as a hemopoietic growth factor that stimulates megakaryocytopoiesis, erythropoiesis, and lymphopoiesis (15, 16, 17), IL-11 also exerts complex regulatory effects on inflammation. For example, it acts as an antiinflammatory agent by inhibiting TNF-{alpha} production in endometrial epithelial cells (18). IL-11 also attenuates IL-1ß, TNF-{alpha}, IL-12, and nitric oxide production in activated macrophages (19) by up-regulating inhibitors of nuclear factor-{kappa}B (20). In addition to its effects on macrophages, IL-11 reduces CD4+ T cell production of T helper cell type 1 cytokines, such as IL-12 induced interferon-{gamma}, while enhancing the expression of T helper cell type 2 cytokines, such as IL-4 and IL-10 (21, 22). However, IL-11 also possesses proinflammatory properties, because it induces prostaglandin E2 secretion during bone resorption (23, 24). Moreover, IL-11 treatment increases the expression of several acute phase proteins, including fibrinogen, C-reactive protein, ferritin, and haptoglobin (25, 26).

Given the importance of IL-11 in the regulation of inflammation taken together with the central role that inflammation and decidual hemorrhage/thrombin generation play in PTD, we evaluated in vivo decidual IL-11 expression after term and preterm deliveries and assessed the effects of IL-1ß, TNF-{alpha}, and thrombin on IL-11 expression in cultured term DCs.


   Patients and Methods
Top
 Abstract
 Introduction
 Patients and Methods
Results
 Discussion
 References
 
Immunohistochemistry

After receiving written informed consent, placentas and attached fetal membranes were obtained from patients with uncomplicated pregnancies having spontaneous vaginal deliveries at term (n = 5) and from patients with intrauterine infection- (chorioamnionitis) or placental abruption-related PTDs (n = 5; gestational age, 26–35 wk) at Yale-New Haven Hospital under human investigation committee approval. Gestational age was estimated using the last menstrual period when reliable or by an ultrasonogram in the first 20 wk of pregnancy. Each term specimen was examined histologically to rule out underlying acute or chronic inflammation and decidual hemorrhage. Chorioamnionitis or placental abruption was verified histologically in preterm delivery specimens. Histological chorioamnionitis was identified as an inflammatory infiltrate of polymorphonuclear leukocytes at two or more sites in the chorionic plate and extraplacental membranes in all placental sections. In this study, positive histology for chorioamnionitis was defined as more than 10 polymorphonuclear leukocytes per high-power field in the subchorionic space and adjacent chorion based on the criteria reported by Naeye et al. (27). A diagnosis of abruptio placentae was made when gross findings of retroplacental hematoma with subjacent placental infarct or when a villous infarct showed microscopic evidence of basal plate destruction or deformation (6).

Formalin-fixed samples were embedded in paraffin and cut into 5-µm sections. After deparaffinization in xylene and rehydration in a graded series of ethanol, slides were boiled in citrate buffer (10 mM; pH 6.0) for 15 min for antigen retrieval. Sections were immersed in 3% hydrogen peroxide (in 50% methanol/50% distilled water) for 15 min to block endogenous peroxidase. Slides were then incubated in a humidified chamber with 5% blocking horse serum in Tris-buffered saline (TBS; Lab-Vision, Fremont, CA) for 30 min at room temperature. After removing excess serum, the sections were incubated with primary antibodies [mouse monoclonal antihuman IL-11 antibody (10 µg/ml) in 1% blocking horse serum in TBS (R&D Systems, Inc., Minneapolis, MN) and mouse monoclonal antivimentin antibody (1:100 dilution in TBS; DakoCytomation, Carpinteria, CA)] overnight at 4 C in a humidified chamber. For negative controls, normal mouse IgG isotypes were used at the same concentrations. The sections were washed three times for 5 min each time with TBS, then biotinylated horse antimouse antibody (1.5 mg/ml; Vector Laboratories, Inc., Burlingame, CA) was added at a 1:400 dilution for 30 min at room temperature. The antigen-antibody complex was detected with an avidin-biotin-peroxidase kit (LabVision). Diaminobenzidine (3,3-diaminobenzidine tetrahydrochloride dihydrate; LabVision) was used as the chromogen, and sections were counterstained with hematoxylin and mounted with Permount (Fisher Chemicals, Springfield, NJ) on glass slides.

The intensity of IL-11 immunostaining was semiquantitatively evaluated by the following categories: 0 (no staining), 1+ (weak, but detectable, staining), 2+ (moderate or distinct staining), and 3+ (intense staining). For each tissue, an HSCORE value was derived by summing the percentage of cells that stained at each intensity category and multiplying that value by the weighted intensity of the staining, using the formula HSCORE = {Sigma} Pi (i + l), where i represents the intensity score, and Pi is the corresponding percentage of the cells. In each slide, five different areas and 100 cells/area were evaluated microscopically with a x40 objective magnification, the percentage of cells for each intensity within these areas was determined at different times by two investigators blinded to the source of the samples, and the average score was then used.

Isolation of DCs

After receiving written informed consent, placentas and attached fetal membranes were obtained from patients with uncomplicated pregnancies undergoing repeat cesarean deliveries at term at Yale-New Haven Hospital under human investigation committee approval. None of the patients from whom specimens were obtained was in labor. A small portion of each specimen was formalin fixed and paraffin embedded, then examined histologically to rule out underlying acute or chronic inflammation. The decidua was scraped from the maternal surface of the chorion, minced, and digested in Ham’s F-10 and 10% charcoal-stripped calf serum (SCS; Flow Laboratories, Rockville, MD) containing 25 mg/ml collagenase (200 U/mg; Worthington Biochemical Corp., Freehold, NJ) in a shaking water bath at 37 C for 30 min. After adding 6.25 U deoxyribonuclease (Sigma-Aldrich Corp., St. Louis, MO)/ml digestate, the incubation was continued for another 45 min. The final digestate was passed through a 23-gauge needle to dissociate remaining cell clusters. The isolated cells were centrifuged at 1500 rpm for 5 min at 4 C, then washed in Ham’s F-10. This procedure was repeated three times, and the final cell pellet was resuspended (1 g tissue/ml) in 20% Percoll (Sigma-Aldrich), layered on a (60%:50%:40%) discontinuous Percoll gradient, then centrifuged at 22,000 rpm for 20 min at 4 C. The top cell layer was collected, washed, resuspended in Ham’s F-10, and centrifuged at 1500 rpm for 5 min at 4 C. After repeating this procedure, the resulting cell pellet was resuspended in 40% Percoll (1 g tissue/ml), layered on a discontinuous (55%:50%:40%) Percoll gradient, then centrifuged at 22,000 rpm for 20 min at 4 C. The top cell layer was washed twice in serum-free Ham’s F-10, then centrifuged at 500 rpm for 5 min at 4 C. The cell pellet was resuspended in Ham’s F-10 and 10% SCS, and DCs were counted in a hemocytometer. After isolation, a trypan blue exclusion test identified that more than 95% of the isolated cells were viable.

Cell cultures

Isolated DCs (5 x 105 cells/ml) were suspended in basal medium (BM), a phenol red-free 1:1 (vol/vol) mix of DMEM (Invitrogen Life Technologies, Inc., Grand Island, NY) and Ham’s F-12 (Flow Laboratories) with 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml fungizone supplemented with 10% SCS. The DCs were seeded onto polystyrene tissue culture dishes coated with 2% type B gelatin (Sigma-Aldrich Corp.). The cultures were grown to confluence in a standard 95% air/5% CO2 incubator at 37 C and passaged three times. Fluorescent antibody cell sorting for the presence of CD45+, conducted as previously described (28), demonstrated that unpassaged cultures contained 12–15% CD45+ cells, whereas passaged cultures were more than 99% free of this common leukocyte marker. The latter were used for experimental cell incubations. The cultured cells were vimentin positive and cytokeratin negative. Moreover, cultured cells showed characteristic decidualization-related morphological changes and expressed elevated levels of prolactin and IGF-binding protein under the influence of estradiol (E2) and medroxyprogesterone acetate (MPA).

Experimental cell incubations

Confluent DCs were primed for 7 d in BM supplemented with SCS containing vehicle control (0.1% ethanol), 10–8 M E2, 10–7 M MPA (Sigma-Aldrich Corp.), or E2 plus 10–7 M MPA with one change of medium. Because circulating levels of both E2 and progesterone are high during the third trimester, E2 was employed with MPA to mimic the gestational steroidal milieu. The latter was used in place of native progesterone, because we have previously shown that the latter is rapidly metabolized in vitro (29). The cultures were washed twice with PBS to remove residual serum components and switched to a serum-free defined medium (DM) consisting of BM plus ITS+ premix (BD Biosciences, Bedford, MA), 5 µM FeSO4, 50 µM ZnSO4, 1 nM CuSO4, 20 nM Na2SeO3, trace elements (Invitrogen Life Technologies, Inc.), 50 µg/ml ascorbic acid (Sigma-Aldrich Corp.), and 50 ng/ml epidermal growth factor (BD Biosciences). The corresponding vehicle or steroid(s) with or without thrombin (American Diagnostica, Greenwich, CT), IL-1ß (R&D Systems, Inc.), or TNF-{alpha} (R&D Systems, Inc.) was added to DM. The pure thrombin antagonist, hirudin (Sigma-Aldrich Corp.), was also used in some experimental incubations. When thrombin and hirudin were used together, they were mixed and preincubated for 30 min at room temperature before treating DCs.

ELISA

After 24-h incubation, concentrations of immunoreactive IL-11 in conditioned DM were measured using an ELISA according to instructions provided by the manufacturer (R&D Systems, Inc.). The sensitivity of this ELISA was 8 pg/ml. The intra- and interassay coefficients of variation were 2.4% and 6.9%, respectively. According to the manufacturer, there is no significant cross-reactivity or interference with other known cytokines in this assay. Levels of IL-11 were normalized to the total cell culture protein content as measured by Bradford protein assay (Bio-Rad Laboratories, Hercules, CA). Briefly, after collecting culture supernatants and washing the monolayers with Hanks’ balanced salt solution, the cells were harvested using a cell scraper in cold PBS. After the centrifugation, the cell extraction buffer [20 mM Tris-HCl buffer with 150 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulfonylfluoride, and Complete protease inhibitor cocktail (Roche, Indianapolis, IN)] was added to the cell pellets and sonicated for 5 sec. After the final centrifugation, the supernatant was collected, and protein content was measured at 650 nm with a multiwell plate reader.

Western blot analysis

At the end of 24-h treatment, conditioned DM were concentrated 8-fold using Microcon centrifugal filter devices (Millipore Corp., Bedford, MA), then mixed with equal volumes of Laemmli sample buffer (Bio-Rad Laboratories) and boiled for 3 min in 95 C. Solubilized proteins were separated by SDS-PAGE on 4–15% linear gradient Tris-HCl gel (Bio-Rad Laboratories) under nonreducing conditions and transferred electrophoretically to a 0.2-µm pore size nitrocellulose membrane (Bio-Rad Laboratories) in transfer buffer. The membrane was blocked with 5% BSA in TBS containing 0.1% Tween 20 (TBS-T) overnight at 4 C. The blot was probed with mouse monoclonal antihuman IL-11 antibody (R&D Systems, Inc.) in 1% casein in TBS (Pierce Chemical Co., Rockford, IL) containing 0.1% Tween 20 for 3 h at room temperature. The blot was washed with TBS-T for 1 h and incubated with horseradish peroxidase-conjugated goat antimouse IgG (ICN Biomedicals, Inc., Aurora, OH) in 1% casein in TBS (Pierce Chemical Co.) containing 0.1% Tween 20 for 1 h at room temperature. Then the membrane was washed with TBS-T for 1 h. The protein was visualized by light emission on film (Amersham Biosciences, Little Chalfont, UK) with enhanced chemiluminescence substrate (PerkinElmer Life Sciences, Boston, MA).

Real-time quantitative RT-PCR

At the end of 6-h experimental incubations, RNA was isolated from cultures with Tri-Reagent (Sigma-Aldrich Corp.). To verify that the IL-11 and ß-actin probes yielded the correct bands, extracted RNA was subjected to semiquantitative RT-PCR using a kit from Invitrogen Life Technologies, Inc. (Carlsbad, CA), which was carried out for 35 cycles with a MasterCycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, RT was initially carried out with avian myeloblastosis virus reverse transcriptase (Invitrogen Life Technologies, Inc.). A quantitative standard curve was created between 2.5 and 40 ng cDNA with a Roche Light Cycler by monitoring the increasing fluorescence of PCR products during amplification. Quantization of the unknowns was then determined with the Light Cycler 3 data analysis software and adjusted to the quantitative expression of ß-actin from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The following primers were synthesized and gel purified at the Yale DNA Synthesis Laboratory, Critical Technologies (sense, 5' to 3'; antisense, 5' to 3' size): IL-11, ACAGTACCCGTATGGG CCGGTCTCGAACTCTT (306 bp); and ß-actin, CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG (452 bp).

Statistical analysis

Because the data from ELISA and quantitative RT-PCR were not normally distributed (as determined by Kolmogorov-Smirnov test), pairwise multiple comparisons were analyzed with nonparametric ANOVA on ranks (Kruskal-Wallis test), followed by post hoc Student-Newman-Keuls test. In contrast, ELISA results with percentage of control and IL-11 HSCORE values were normally distributed and, therefore, were analyzed with one-way ANOVA, followed by post hoc Holm-Sidak test and Student’s t test, respectively. Statistical calculations were performed using SigmaStat for Windows, version 3.0 (Jandel Scientific Corp., San Rafael, CA). Statistical significance was defined as P < 0.05.


   Results
Top
 Abstract
 Introduction
 Patients and Methods
 Results
Discussion
 References
 
In vivo decidual IL-11 expression in term and preterm deliveries

Immunohistochemical analysis revealed that IL-11 was expressed in DCs after both term and preterm deliveries. However, IL-11 expression was significantly higher in DCs during PTDs compared with those during term deliveries (P < 0.05; Fig. 1Go). HSCORE values of IL-11 immunostaining were significantly higher in DCs associated with PTDs (mean ± SEM, 184.7 ± 10.9) compared with those of women with term deliveries (113 ± 26; P < 0.05).



View larger version (129K):
[in this window]
[in a new window]
  		FIG. 1. In vivo IL-11 expression in DCs after term and preterm deliveries. Representative micrographs of immunohistochemistry staining for IL-11 (B and D) and vimentin (A and C) in the decidua of women with term (A and B) and preterm (C and D) deliveries. IL-11 expression was significantly higher in DCs during PTDs compared with those during term deliveries (P < 0.05).

 
Regulation of IL-11 secretion in cultured term DCs by ovarian steroids

Although DCs were refractory to the addition of E2 (10–8 M) alone, treatment with MPA and E2 plus MPA significantly reduced immunoreactive IL-11 levels in cultured DC by 30 ± 5% (mean ± SEM; P < 0.05; n = 6) and 47 ± 3% (P = 0.001), respectively (Fig. 2Go). Values of IL-11 decreased from 0.22 ± 0.06 pg/ml/µg total protein in E2-treated cultures to 0.16 ± 0.06 pg/ml/µg protein after MPA exposure and 0.12 ± 0.02 pg/ml/µg protein with E2 plus MPA treatment. Thus, progestin exerted a net inhibitory effect on IL-11 expression.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 2. Effects of sex steroids on IL-11 expression by term DC monolayers. Confluent, leukocyte-free term DCs were incubated for 7 d in vehicle (control), 10–8 M E2, 10–7 M MPA, or E2 plus MPA, then switched to DM with corresponding steroid(s) for 24 h. IL-11 levels were quantified by ELISA in conditioned DM and normalized to total cell protein (details in Patients and Methods; n = 6). Bars represent the mean ± SEM; scatters with error bars represent the percentage of the control. *, P < 0.05; **, P = 0.001 (vs. E2 regarding percentages).

 
Regulation of IL-11 expression in term DC cultures by thrombin and proinflammatory cytokines

In DCs incubated with E2 alone, the addition of thrombin (2.5 U/ml) and IL-1ß (10 ng/ml) markedly enhanced secreted IL-11 levels by 24 ± 5- and 120 ± 11-fold, respectively (P < 0.05; n = 6). The values increased from 0.22 ± 0.06 to 6.75 ± 1.73 pg/ml/µg protein after exposure to thrombin and 41.4 ± 9.63 pg/ml/µg protein after treatment with IL-1ß (P < 0.05; Fig. 3Go). Similarly, in cultures treated with E2 plus MPA, IL-11 output was elevated by 13 ± 2- and 36 ± 7-fold in response to treatment with thrombin and IL-1ß, respectively (P < 0.05). IL-11 values increased from basal levels of 0.12 ± 0.02 pg/ml/µg protein in cultures maintained in E2 plus MPA to 2.24 ± 0.36 and 6.16 ± 2.16 pg/ml/µg protein in parallel cultures treated with thrombin and IL-1ß, respectively (P < 0.05; Fig. 3Go). Therefore, compared with cultures maintained in E2, the addition of E2 and MPA significantly inhibited the effects of thrombin and IL-1ß on IL-11 secretion by 61 ± 4% and 86 ± 2%, respectively (P < 0.05). By contrast, TNF-{alpha} (10 ng/ml) did not affect IL-11 release (Fig. 3Go).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 3. Effects of thrombin, IL-1ß, TNF-{alpha}, and MPA on IL-11 secretion by term DC monolayers. Confluent, leukocyte-free term DCs were incubated for 7 d in 10–8 M E2 or E2 plus 10–7 M MPA, then switched to DM with corresponding steroid(s) with or without thrombin (Thr; 2.5 U/ml), IL-1ß (10 ng/ml), or TNF-{alpha} (10 ng/ml) for 24 h. IL-11 levels were quantified by ELISA in conditioned DM and normalized to total cell protein (mean ± SEM; n = 6). *, P < 0.05 vs. E2; **, P < 0.05 vs. E2 plus MPA; {dagger}, P < 0.05 vs. E2 plus Thr; {ddagger}, P < 0.05 vs. E2 plus IL-1ß.

 
Because circulating levels of both E2 and progesterone are high during the third trimester, additional evaluation of the effects of thrombin and IL-1ß on IL-11 expression were carried out on DCs incubated in E2 plus MPA. When DCs were treated with various concentrations of thrombin (0.1–2.5 U/ml) and IL-1ß (0.1 to 10 ng/ml), IL-11 secretion increased in a dose-dependent manner at all concentrations of thrombin and IL-1ß investigated (P < 0.05; n = 3; Fig. 4Go). Hirudin (0.5 U/ml) acted as a pure thrombin antagonist in these cultures, exerting no agonistic effects and completely blocking the effects of thrombin (0.5 U/ml) on IL-11 protein and mRNA expression (Fig. 5Go).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 4. Dose-response effects of thrombin and IL-1ß on IL-11 secretion by E2- plus MPA-treated term DC monolayers. Confluent, leukocyte-free term DCs were incubated for 7 d in 10–8 M E2 and 10–7 M MPA, then switched to DM with E2 plus MPA alone or with various concentrations of thrombin (Thr; A; 0.1–2.5 U/ml) or IL-1ß (B; 0.1–10 ng/ml) for 24 h. IL-11 levels were quantified by ELISA in conditioned DM and normalized to total cell protein (mean ± SEM; n = 3). *, P < 0.05 vs. E2 plus MPA.

 


View larger version (10K):
[in this window]
[in a new window]
  		FIG. 5. Effects of hirudin, thrombin, or both on IL-11 expression by term DC monolayers maintained in E2 plus MPA. Confluent, leukocyte-free term DCs were incubated for 7 d in 10–8 M E2 and 10–7 M MPA, then switched to DM with E2 plus MPA alone or with hirudin (Hir; 0.5 U/ml), thrombin (Thr; 0.5 U/ml), or hirudin plus thrombin. A, At the end of 24-h incubation, IL-11 levels were quantified by ELISA in conditioned DM and normalized to total cell protein (mean ± SEM; n = 3). *, P < 0.05 vs. E2 plus MPA; **, P < 0.05 vs. E2 plus MPA plus Thr. B, At the end of 6-h incubation, IL-11 mRNA levels were measured by real-time quantitative RT-PCR and normalized to ß-actin.

 
The Western blot illustrated in Fig. 6Go revealed the presence of a single IL-11 protein band in the DC-conditioned medium at the appropriate molecular mass of 23 kDa. Western blot analysis also confirmed the ELISA results showing that IL-11 secretion was markedly enhanced by thrombin (2.5 U/ml) and IL-1ß (10 ng/ml), whereas the addition of MPA blunted their effects. Furthermore, TNF-{alpha} (10 ng/ml) did not affect IL-11 secretion.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 6. Western blot analysis of the effects of thrombin, IL-1ß, TNF-{alpha}, and MPA on IL-11 secretion by term DCs in vitro. Confluent, leukocyte-free term DCs were incubated for 7 d in 10–8 M E2 or E2 plus 10–7 M MPA, then switched to DM with the corresponding steroid(s) with or without thrombin (Thr; 2.5 U/ml), IL-1ß (10 ng/ml), or TNF-{alpha} (10 ng/ml) for 24 h. The conditioned medium was concentrated eight times, then subjected to Western blotting (details in Patients and Methods). Representative data are shown.

 
Regulation of IL-11 mRNA expression in term DCs

Real-time quantitative RT-PCR results corresponded to our ELISA findings. In cultures maintained in E2 alone, 2.5 U/ml thrombin and 10 ng/ml IL-1ß increased IL-11 mRNA expression by 7.1 ± 0.7-fold (P < 0.05) and 16.2 ± 3.6-fold (P < 0.05), respectively (Fig. 7Go). Likewise, in the E2- plus MPA-treated cultures, IL-11 mRNA expression was enhanced by 6.1 ± 1.5-fold (P < 0.05) and 7.1 ± 1.8-fold (P < 0.05) with the addition of thrombin and IL-1ß, respectively (Fig. 7Go). Similar to the blunting effect of MPA on IL-11 protein output, the addition of MPA significantly reduced the basal levels IL-11 mRNA by 56 ± 7% (P < 0.05) and inhibited the effects of thrombin and IL-1ß on IL-11 mRNA expression by 68 ± 3% (P < 0.05) and 82 ± 4% (P < 0.05), respectively (Fig. 7Go).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 7. Real-time quantitative RT-PCR of the effects of thrombin, IL-1ß, and MPA on IL-11 mRNA levels in term DC monolayers. Confluent, leukocyte-free term DCs were incubated for 7 d in 10–8 M E2 or E2 plus 10–7 M MPA, then switched to DM with the corresponding steroid(s) with or without thrombin (Thr; 2.5 U/ml) or IL-1ß (10 ng/ml) for 6 h. IL-11 mRNA levels were measured by real-time quantitative RT-PCR and normalized to ß-actin (mean ± SEM; n = 4). *, P < 0.05 vs. E2; **, P < 0.05 vs. E2 plus MPA; {dagger}, P < 0.05 vs. E2 plus Thr; {ddagger}, P < 0.05 vs. E2 plus IL-1ß.

 

   Discussion
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
References
 
The expression patterns of IL-11 and its receptor have been evaluated in cyclic and early gestational endometrium. The IL-11 receptor has been shown to be constitutively expressed in both epithelial and stromal cells throughout the menstrual cycle and pregnancy (18, 30, 31, 32). In contrast to these findings with the IL-11 receptor, there are conflicting reports about the cellular localization and menstrual phase-dependent expression of IL-11 ligand. Immunostaining for IL-11 was observed in both glandular and luminal epithelial, and stromal cells in the mid to late luteal phase (18, 33). In contrast, von Rango et al. (32) showed that IL-11 is expressed by epithelial and stromal cells, and levels peak in the follicular and early luteal phases, then decline precipitously in the progesterone-dominated luteal phase. Consistent with these latter observations, IL-11 protein output by cultured glandular epithelial cells from cycling as well as early gestational endometrium was reduced by exogenous progestin (32). The current study extends previous observations of progestin effects on IL-11 expression in human endometrium to include term decidual cells. Moreover, we now establish that IL-11 mRNA and protein expression in these cells is progestationally inhibited.

Our immunohistochemical findings suggest that PTD is associated with a significant increase in decidual IL-11 expression. Given the prominent roles that infection and abruption play in PTD, we examined the effects of inflammatory cytokines and thrombin on IL-11 expression by DCs in vitro. We now report the novel finding that thrombin, a mixed hemostatic and proinflammatory cytokine, and IL-1ß, a classic proinflammatory cytokine, augment endometrial IL-11 expression. Moreover, we demonstrate that coincubation with a progestin significantly blunts the up-regulation of IL-11 expression elicited by both agents. A thorough search of the published sequence of the IL-11 promoter fails to reveal canonical or alternative estrogen or progesterone response elements. This suggests that progestational effects are mediated through other transcription factor intermediaries (34, 35, 36).

Thrombin is formed during abruptions by contact between circulating clotting factors and DC-expressed tissue factor. Its generation is evident in the increased levels of circulating thrombin-antithrombin complexes that precede and predict PTD in association with both preterm labor and PPROM (12, 13). Our previous studies indicated the regulation of matrix metalloproteinase (MMP) expression in cultured term DCs conforms to the same pattern as described in this study for IL-11. Specifically, interstitial collagenase (MMP-1) (11) and stromelysin-1 (MMP-3) (10) mRNA and protein levels were elevated by thrombin in a protease-activated receptor-1-dependent manner. These thrombin effects were inhibited by E2 and MPA, but not E2 alone (10, 11). Thrombin-induced MMP-1 and -3 may trigger extracellular matrix degradation in the decidua and fetal membranes, thereby compromising their integrity and promoting PPROM and PTD (10, 11). Conversely, inhibition of these thrombin effects by progestins is consistent with the observed protection against PTD afforded by progestin administration (37). The similar regulations of both DC-expressed IL-11 and MMPs by thrombin suggest that IL-11 may also be involved in both abruption-associated preterm labor as well as PPROM. For example, IL-11 enhances synthesis of prostaglandins in other cell systems (23, 24). This occurrence in DCs could induce uterine contractions, thus augmenting the direct effects of thrombin on myometrial contractility to promote preterm labor (38, 39).

In addition to a potential role in abruption, the current results suggest that DC-derived IL-11 may also mediate PTD due to intraamniotic infections. Chorioamnionitis is associated with elevated amniotic levels of IL-1ß (1). Moreover, as demonstrated by the current results, like thrombin, IL-1ß augmented IL-11 expression in term DCs and progestin inhibited this effect. By contrast, term DC cultures were refractory to the addition of TNF-{alpha}. Interestingly, although enhanced amniotic fluid levels of IL-1ß have been conclusively associated with intraamniotic fluid infection-induced PTD (1, 2), there are conflicting reports about whether amniotic fluid levels of TNF-{alpha} are elevated in such PTDs (2, 4, 5).

In conclusion, we theorize that IL-11 is ideally positioned to act as both a stimulus for PTD through prostaglandin generation (23, 24) and an inhibitor of a potentially dangerous exaggerated maternal inflammatory response. Moreover, the dampening effects of progestins on thrombin- and IL-1ß-induced decidual IL-11 expression suggest a mechanism by which weekly administration of 17{alpha}-hydroxyprogesterone caproate may reduce PTD rates (37).


   Acknowledgments
 
We thank Umit A. Kayisli and Tracy Fairchild for invaluable contributions to this study.


   Footnotes
 
This work was supported by Grant 1-R01-HL-070004–02 from the National Institutes of Health (to C.J.L.).

First Published Online July 5, 2005

Abbreviations: BM, Basal medium; DC, decidual cell; DM, defined medium; E2, estradiol; MMP, matrix metalloproteinase; MPA, medroxyprogesterone acetate; PPROM, preterm premature rupture of the fetal membrane; PTD, preterm delivery; SCS, charcoal-stripped calf serum; TBS, Tris-buffered saline; TBS-T, TBS containing 0.1% Tween 20.

Received February 1, 2005.

Accepted June 28, 2005.


   References
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Lockwood CJ 2002 Predicting premature delivery–no easy task. N Engl J Med 346:282–284[Free Full Text]
  2. Arntzen KJ, Kjollesdal AM, Halgunset J, Vatten L, Austgulen R 1998 TNF, IL-1, IL-6, IL-8 and soluble TNF receptors in relation to chorioamnionitis and premature labor. J Perinat Med 26:17–26[Medline]
  3. Fortunato SJ, Menon RP, Swan KF, Menon R 1996 Inflammatory cytokine (interleukins 1, 6 and 8 and tumor necrosis factor-{alpha}) release from cultured human fetal membranes in response to endotoxic lipopolysaccharide mirrors amniotic fluid concentrations. Am J Obstet Gynecol 174:1855–1862[CrossRef][Medline]
  4. Hillier SL, Witkin SS, Krohn MA, Watts DH, Kiviat NB, Eschenbach DA 1993 The relationship of amniotic fluid cytokines and preterm delivery, amniotic fluid infection, histologic chorioamnionitis, and chorioamnion infection. Obstet Gynecol 81:941–948[Abstract/Free Full Text]
  5. Romero R, Manogue KR, Mitchell MD, Wu YK, Oyarzun E, Hobbins JC, Cerami A 1989 Infection and labor. IV. Cachectin-tumor necrosis factor in the amniotic fluid of women with intraamniotic infection and preterm labor. Am J Obstet Gynecol 161:336–341[Medline]
  6. Salafia CM, Lopez-Zeno JA, Sherer DM, Whittington SS, Minior VK, Vintzileos AM 1995 Histologic evidence of old intrauterine bleeding is more frequent in prematurity. Am J Obstet Gynecol 173:1065–1070[CrossRef][Medline]
  7. Lockwood CJ, Krikun G, Schatz F 2001 Decidual cell-expressed tissue factor maintains hemostasis in human endometrium. Ann NY Acad Sci 943:77–88[Abstract/Free Full Text]
  8. Lockwood CJ, Nemerson Y, Guller S, Krikun G, Alvarez M, Hausknecht V, Gurpide E, Schatz F 1993 Progestational regulation of human endometrial stromal cell tissue factor expression during decidualization. J Clin Endocrinol Metab 76:231–236[Abstract]
  9. Coughlin SR 2000 Thrombin signalling and protease-activated receptors. Nature 407:258–264[CrossRef][Medline]
  10. Mackenzie AP, Schatz F, Krikun G, Funai EF, Kadner S, Lockwood CJ 2004 Mechanisms of abruption-induced premature rupture of the fetal membranes: thrombin enhanced decidual matrix metalloproteinase-3 (stromelysin-1) expression. Am J Obstet Gynecol 191:1996–2001[CrossRef][Medline]
  11. Rosen T, Schatz F, Kuczynski E, Lam H, Koo AB, Lockwood CJ 2002 Thrombin-enhanced matrix metalloproteinase-1 expression: a mechanism linking placental abruption with premature rupture of the membranes. J Maternal Fetal Neonatal Med 11:11–17
  12. Elovitz MA, Baron J, Phillippe M 2001 The role of thrombin in preterm parturition. Am J Obstet Gynecol 185:1059–1063[CrossRef][Medline]
  13. Rosen T, Kuczynski E, O’Neill LM, Funai EF, Lockwood CJ 2001 Plasma levels of thrombin-antithrombin complexes predict preterm premature rupture of the fetal membranes. J Maternal Fetal Med 10:297–300
  14. Muller-Newen G 2003 The cytokine receptor gp130: faithfully promiscuous. Sci STKE 2003:PE40
  15. Hirayama F, Ogawa M 1994 Cytokine regulation of early B-lymphopoiesis assessed in culture. Blood Cells 20:341–347[Medline]
  16. Quesniaux VF, Clark SC, Turner K, Fagg B 1992 Interleukin-11 stimulates multiple phases of erythropoiesis in vitro. Blood 80:1218–1223[Abstract/Free Full Text]
  17. Weich NS, Wang A, Fitzgerald M, Neben TY, Donaldson D, Giannotti J, Yetz-Aldape J, Leven RM, Turner KJ 1997 Recombinant human interleukin-11 directly promotes megakaryocytopoiesis in vitro. Blood 90:3893–3902[Abstract/Free Full Text]
  18. Cork BA, Tuckerman EM, Li TC, Laird SM 2002 Expression of interleukin (IL)-11 receptor by the human endometrium in vivo and effects of IL-11, IL-6 and LIF on the production of MMP and cytokines by human endometrial cells in vitro. Mol Hum Reprod 8:841–848[Abstract/Free Full Text]
  19. Trepicchio WL, Bozza M, Pedneault G, Dorner AJ 1996 Recombinant human IL-11 attenuates the inflammatory response through down-regulation of proinflammatory cytokine release and nitric oxide production. J Immunol 157:3627–3634[Abstract]
  20. Trepicchio WL, Wang L, Bozza M, Dorner AJ 1997 IL-11 regulates macrophage effector function through the inhibition of nuclear factor-{kappa}B. J Immunol 159:5661–5670[Abstract]
  21. Bozza M, Bliss JL, Dorner AJ, Trepicchio WL 2001 Interleukin-11 modulates Th1/Th2 cytokine production from activated CD4+ T cells. J Interferon Cytokine Res 21:21–30[CrossRef][Medline]
  22. Curti A, Ratta M, Corinti S, Girolomoni G, Ricci F, Tazzari P, Siena M, Grande A, Fogli M, Tura S, Lemoli RM 2001 Interleukin-11 induces Th2 polarization of human CD4+ T cells. Blood 97:2758–2763[Abstract/Free Full Text]
  23. Morgan H, Tumber A, Hill PA 2004 Breast cancer cells induce osteoclast formation by stimulating host IL-11 production and downregulating granulocyte/macrophage colony-stimulating factor. Int J Cancer 109:653–660[CrossRef][Medline]
  24. Morinaga Y, Fujita N, Ohishi K, Zhang Y, Tsuruo T 1998 Suppression of interleukin-11-mediated bone resorption by cyclooxygenases inhibitors. J Cell Physiol 175:247–254[CrossRef][Medline]
  25. Baumann H, Schendel P 1991 Interleukin-11 regulates the hepatic expression of the same plasma protein genes as interleukin-6. J Biol Chem 266:20424–20427[Abstract/Free Full Text]
  26. Gordon MS, McCaskill-Stevens WJ, Battiato LA, Loewy J, Loesch D, Breeden E, Hoffman R, Beach KJ, Kuca B, Kaye J, Sledge Jr GW 1996 A phase I trial of recombinant human interleukin-11 (neumega rhIL-11 growth factor) in women with breast cancer receiving chemotherapy. Blood 87:3615–3624[Abstract/Free Full Text]
  27. Naeye RL, Maisels MJ, Lorenz RP, Botti JJ 1983 The clinical significance of placental villous edema. Pediatrics 71:588–594[Abstract/Free Full Text]
  28. Koopman LA, Kopcow HD, Rybalov B, Boyson JE, Orange JS, Schatz F, Masch R, Lockwood CJ, Schachter AD, Park PJ, Strominger JL 2003 Human decidual natural killer cells are a unique NK cell subset with immunomodulatory potential. J Exp Med 198:1201–1212[Abstract/Free Full Text]
  29. Arici A, Marshburn PB, MacDonald PC, Dombrowski RA 1999 Progesterone metabolism in human endometrial stromal and gland cells in culture. Steroids 64:530–534[CrossRef][Medline]
  30. Chen HF, Lin CY, Chao KH, Wu MY, Yang YS, Ho HN 2002 Defective production of interleukin-11 by decidua and chorionic villi in human anembryonic pregnancy. J Clin Endocrinol Metab 87:2320–2328[Abstract/Free Full Text]
  31. Karpovich N, Chobotova K, Carver J, Heath JK, Barlow DH, Mardon HJ 2003 Expression and function of interleukin-11 and its receptor {alpha} in the human endometrium. Mol Hum Reprod 9:75–80[Abstract/Free Full Text]
  32. von Rango U, Alfer J, Kertschanska S, Kemp B, Muller-Newen G, Heinrich PC, Beier HM, Classen-Linke I 2004 Interleukin-11 expression: its significance in eutopic and ectopic human implantation. Mol Hum Reprod 10:783–792[Abstract/Free Full Text]
  33. Dimitriadis E, Salamonsen LA, Robb L 2000 Expression of interleukin-11 during the human menstrual cycle: coincidence with stromal cell decidualization and relationship to leukaemia inhibitory factor and prolactin. Mol Hum Reprod 6:907–914[Abstract/Free Full Text]
  34. Hubler TR, Scammell JG 2004 Intronic hormone response elements mediate regulation of FKBP5 by progestins and glucocorticoids. Cell Stress Chaperones 9:243–252[CrossRef][Medline]
  35. McKinley D, Wu Q, Yang-Feng T, Yang YC 1992 Genomic sequence and chromosomal location of human interleukin-11 gene (IL11). Genomics 13:814–819[CrossRef][Medline]
  36. Paul SR, Bennett F, Calvetti JA, Kelleher K, Wood CR, O’Hara Jr RM, Leary AC, Sibley B, Clark SC, Williams DA 1990 Molecular cloning of a cDNA encoding interleukin 11, a stromal cell-derived lymphopoietic and hematopoietic cytokine. Proc Natl Acad Sci USA 87:7512–7516[Abstract/Free Full Text]
  37. Meis PJ, Klebanoff M, Thom E, Dombrowski MP, Sibai B, Moawad AH, Spong CY, Hauth JC, Miodovnik M, Varner MW, Leveno KJ, Caritis SN, Iams JD, Wapner RJ, Conway D, O’Sullivan MJ, Carpenter M, Mercer B, Ramin SM, Thorp JM, Peaceman AM, Gabbe S 2003 Prevention of recurrent preterm delivery by 17{alpha}-hydroxyprogesterone caproate. N Engl J Med 348:2379–2385[Abstract/Free Full Text]
  38. Elovitz MA, Ascher-Landsberg J, Saunders T, Phillippe M 2000 The mechanisms underlying the stimulatory effects of thrombin on myometrial smooth muscle. Am J Obstet Gynecol 183:674–681[CrossRef][Medline]
  39. Elovitz MA, Saunders T, Ascher-Landsberg J, Phillippe M 2000 Effects of thrombin on myometrial contractions in vitro and in vivo. Am J Obstet Gynecol 183:799–804[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
C. Oner, F. Schatz, G. Kizilay, W. Murk, L. F. Buchwalder, U. A. Kayisli, A. Arici, and C. J. Lockwood
Progestin-Inflammatory Cytokine Interactions Affect Matrix Metalloproteinase-1 and -3 Expression in Term Decidual Cells: Implications for Treatment of Chorioamnionitis-Induced Preterm Delivery
J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 252 - 259.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
M. Ulukus, H. Cakmak, and A. Arici
The Role of Endometrium in Endometriosis
Reproductive Sciences, October 1, 2006; 13(7): 467 - 476.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/9/5279    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cakmak, H.
Right arrow Articles by Lockwood, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cakmak, H.
Right arrow Articles by Lockwood, C. J.
Related Collections
Right arrow Female Endocrinology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals