help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-2353
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasko, V.
Right arrow Articles by Xing, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasko, V.
Right arrow Articles by Xing, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*6-METHYLURACIL
*Genetics Home Reference
Medline Plus Health Information
*Thyroid Cancer
Related Collections
Right arrow Thyroid
Right arrow Endocrine Oncology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 9 5265-5269
Copyright © 2005 by The Endocrine Society

High Prevalence and Possible de Novo Formation of BRAF Mutation in Metastasized Papillary Thyroid Cancer in Lymph Nodes

Vasily Vasko, Shuiying Hu, Guojun Wu, Jeffrey C. Xing, Alexandr Larin, Victoria Savchenko, Barry Trink and Mingzhao Xing

Department of Pediatrics (V.V.), Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814; Department of Otolaryngology (G.W., J.C.X., B.T.) and Division of Endocrinology and Metabolism (S.H., M.X.), Department of Medicine, the Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; and Center for Endocrine Surgery (A.L., V.S.), Kiev 25200, Ukraine

Address all correspondence and requests for reprints to: Mingzhao Xing, M.D., Ph.D., Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287. E-mail: mxing1{at}jhmi.edu.


   Abstract
Top
 Abstract
Introduction
 Patients and Methods
 Results
 Discussion
 References
 
Context: The role of the T1799A BRAF mutation in lymph node metastasis of papillary thyroid cancer (PTC) is not clear.

Objective: Our objective was to explore the relationship between BRAF mutation and lymph node metastasis of PTC by examining the mutation in both the primary tumors and their paired lymph node metastases.

Design: We isolated genomic DNA from primary thyroid tumors and paired lymph node metastases and performed direct sequencing of exon 15 of the BRAF gene mutation that carries the T1799A mutation.

Results: In a series of 33 cases, 21 harbored the T1799A mutation in the primary tumors, and 17 (81%) of them harbored the same mutation also in the paired lymph node metastases. Twelve cases did not harbor the T1799A mutation in the primary tumors, among which nine cases also did not harbor BRAF mutation in the lymph node-metastasized tumors, whereas the other three did harbor the T1799A mutation in lymph node-metastasized tumor tissues. A novel tandem TG1799–1800AA mutation within one allele was found in a lymph node-metastasized tumor but not in the primary tumor. This mutation results in the change of codon 600 (GTG) of the gene to GAA with the consequent amino acid change (V600E) in the B-type Raf (BRAF) protein, same as that caused by the T1799A mutation alone.

Conclusion: The high prevalence of BRAF mutation in lymph node-metastasized PTC tissues from BRAF mutation-positive primary tumors and the possible de novo formation of BRAF mutation in lymph node-metastasized PTC were consistent with a role of BRAF mutation in facilitating the metastasis and progression of PTC in lymph nodes.


   Introduction
Top
 Abstract
 Introduction
Patients and Methods
 Results
 Discussion
 References
 
BRAF MUTATION IS common in human cancers, with a prevalence of up to 66–83% in melanoma and thyroid cancer (1, 2). The most common BRAF mutation is the missense T1799A transversion mutation formerly called T1796A mutation (3). Raf kinase is a key component of the RAS->RAF->MAPK kinase->ERK/MAPK signaling pathway, which plays a fundamental role in the regulation of cell growth, division, and proliferation (4). The B-type Raf (BRAF) is the strongest activator of the downstream MAPK signaling in many cells (5). The T1799A mutation causes a V600E (formerly V599E) amino acid change in BRAF protein, conferring the kinase oncogenic function through constitutive activation of the MAPK signaling pathway (1). The T1799A BRAF mutation found in thyroid cancer occurs exclusively in papillary thyroid cancer (PTC) and some PTC-derived anaplastic thyroid cancers (6, 7, 8, 9, 10, 11, 12, 13).

PTC is the most common thyroid cancer, accounting for 80% or more of all thyroid cancers (14). Although this cancer is usually curable with standard surgical and medical treatments, many patients do have recurrence (15, 16, 17). Recurrence of PTC most commonly occurs in local lymph nodes in the neck (18, 19, 20), consistent with the general finding that, among different types of thyroid cancers, PTC is most commonly associated with local lymph node metastasis at the initial surgery (21, 22). Recently, the T1799A BRAF mutation in primary PTC tumor was found to be associated with a significantly higher prevalence of lymph node metastasis, distant metastasis, and extra-thyroidal invasion in some studies (2, 9, 10). These data suggest that BRAF mutation may play an important role in the progression and recurrence of PTC. However, other studies, albeit smaller, showed no statistically significant correlation of this mutation with tumor metastasis, although a tendency of such a correlation was observed in some of them (8, 12, 13). To explore further the role of BRAF mutation in thyroid cancer metastasis, in the present study we examined and compared the status of BRAF mutation in a series of primary PTC tumors and their paired lymph node-metastasized tumors.


   Patients and Methods
Top
 Abstract
 Introduction
 Patients and Methods
Results
 Discussion
 References
 
Tumor tissues and DNA isolation

This study was conducted based on protocols approved by our institutional review boards. Tumor specimens were obtained from 33 patients who underwent surgery from 1999–2004 at the Center for Endocrine Surgery, Kiev, Ukraine. Among these patients, four were younger than 20 yr old, two were not born yet, and the remaining 27 patients were adults in 1986 when the Chernobyl nuclear accident occurred. Their clinicopathological characteristics are summarized in Table 1Go. All the primary tumors and matched neck lymph node-metastasized tumor samples were paraffin embedded. All tumor samples were examined carefully, and histological diagnoses were established according to the World Health Organization classification by two pathologists who specialize in thyroid pathology (V.V. and V.S.). All primary tumors included in this study were classified as classical variants of PTC; tumors with morphological features of follicular variant of PTC were not included in the present study.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Demographical characteristics and BRAF mutation status in primary PTC and paired lymph node metastases

 
For genomic DNA extraction, 5- and 10-µm-thick serial sections were made for each specimen. The 5-µm sections were stained with hematoxylin and eosin and examined to confirm the histological diagnosis. The 10 µm-thick sections were used for DNA extraction. The number of 10-µm-thick sections available for DNA extraction ranged from one to five. Any tissue surrounding the tumor including normal thyroid, connective tissue, inflammatory cells, and necrotic or hemorrhagic zones was carefully pared away using a scalpel under microscopic observation. The purpose of paring was to ensure that tumor cells composed over 90% of the remaining specimen. Microdissected tumor tissues from paraffin-embedded primary tumors and their matched lymph nodes-metastasized tumors were subjected to treatment with xylene for 8 h at room temperature to remove the paraffin, followed by digestion with 1% SDS and 0.5 mg/ml proteinase K at 48 C for 48 h, with two interval additions of a spiking dose of concentrated proteinase K. DNA was subsequently isolated from the digested tissues with standard phenol-chloroform extraction procedures and precipitated with 70% ethanol and resuspended in water.

BRAF mutation analysis

Because the T1799A transverse mutation in exon 15 of the BRAF gene is exclusively found in PTC with a high prevalence, we analyzed this mutation on our tumor samples by direct DNA sequencing as previously described (11). Briefly, exon 15 containing the site where T1796A mutation occurs was amplified with PCR using primers TCATAATGCTTGCTCTGATAGGA (forward) and GGCCAAAAATTTAATCAGTGGA (reverse). The PCR was run with a step-down protocol: 95 C for 5 min for one cycle; 95 C for 1 min, 60 C for 1 min, and 72 C for 1 min for two cycles; 95 C for 1 min, 58 C for 1 min, and 72 C for 1 min for two cycles; and 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min for 40 cycles. This was followed by a final extension at 72 C for 5 min. The 30-µl final reaction mixture contained 16.6 mM ammonium sulfate, 67 mM Tris (pH 8.8), 10 mM 2-mercaptoethanol, 1.5 mM each deoxynucleotide triphosphate, 6.7 mM MgCl2, 5% dimethylsulfoxide, 1.67 µM each primers (forward and reverse), 60 ng genomic DNA, and 0.5 U of platinum DNA Taq polymerase (Life Technologies, Inc., Gaithersburg, MD). A single band of PCR product with expected molecular weight was confirmed on a 1.5% agarose gel. The PCR products were then subjected to sequencing reaction using the forward primer described above and Big Dye terminator V 3.0 cycle sequencing reagents (Applied Biosystems, Foster City, CA), and the reaction was run on a PCR cycler: 95 C for 30 sec for one cycle and 95 C for 15 sec, 50 C for 15 sec, and 60 C for 4 min for 35 cycles. DNA sequence was then read on an ABI PRISM 3700 DNA analyzer (Applied Biosystems), and the BRAF mutations were identified. For case 4, the PCR products of BRAF exon 15 were also subcloned, followed by direct DNA sequencing to confirm a tandem BRAF mutation.


   Results
Top
 Abstract
 Introduction
 Patients and Methods
 Results
Discussion
 References
 
We analyzed 33 cases of conventional PTC for which we had available both the primary tumors and the matched neck lymph node-metastasized cancer tissues. The overall prevalence of BRAF mutation in the primary PTC tumors was 63%, within the upper range reported in other studies (23). This prevalence is relatively high, reflecting the fact that all the cases in this series had lymph node metastasis and that BRAF mutation is generally reported to be associated with a higher prevalence of lymph node metastasis. Also, the PTC samples included in this study were all classical variants, which harbor BRAF mutation with a particularly high prevalence (23). As summarized in Table 1Go, 21 of these 33 cases harbored the T1799A BRAF mutation in their primary tumors. Seventeen (81%) of these 21 cases also harbored the same mutation in their metastasized tumor tissues in lymph nodes. The four cases of BRAF mutation-positive primary tumors that had no mutation in lymph nodes had multiple foci of PTC in the thyroid gland. It is therefore possible that in these four cases the lymph node-associated PTC tissues available to us for BRAF mutation analysis were metastasized from the PTC foci that were not examined and that might harbor no mutation. Figure 1Go (top) shows a representative case (no. 15) with the T1799A BRAF mutation in both the primary tumor and the metastasized tumor in a lymph node. In one case (no. 5), we had two lymph nodes available for this study, and the BRAF mutation was found in the metastasized PTC tissues in both of the lymph nodes. Among the 12 cases that did not harbor BRAF mutation in the primary tumors, nine cases also did not harbor BRAF mutation in the metastasized tumor tissue in lymph nodes. Five of the latter nine cases had multifocal PTC in the thyroid gland, and therefore we were not certain whether the lymph node metastasis was from the primary tumor available to us for this study. The remaining four cases that did not harbor mutation either in the primary tumor or in the lymph node-metastasized tumor had only a solitary PTC without multifocality in the thyroid gland, suggesting that the BRAF mutation-negative lymph node metastasis was from the BRAF mutation-negative primary tumor examined in each of the four cases. Therefore, BRAF mutation is not absolutely required for metastasis of PTC to lymph nodes, consistent with clinicopathological studies that showed association of both BRAF mutation-positive and -negative primary PTC tumors with lymph node metastasis (2, 8, 9, 10, 12, 13). Interestingly, the other three cases (4, 16, 25) that harbored no mutation in their primary tumors harbored the T1799A BRAF mutation in lymph node-metastasized tumor tissues. In one case (no. 4), a novel BRAF mutation, G1800A, was found in the metastasized tumor, which coexisted with the T1799A BRAF mutation, although the primary tumor harbored neither of the two mutations (Fig. 1Go, bottom). These two mutations form a tandem TG1799–1800AA mutation. Because careful pathological examination revealed only one PTC focus in the thyroid gland in each of the three cases, the mutations apparently developed de novo in the lymph node after metastasis occurred. The tandem TG1799–1800AA mutation was confirmed by sequencing the PCR products using the reverse primer (Fig. 1Go, bottom). When the PCR products of this case were subcloned, followed by sequencing, only two types of allelic patterns were seen, wild-type allele and the tandem TG1799–1800AA mutation, confirming a true tandem mutation within the same allele (Fig. 2Go). As a consequence of this tandem mutation, codon 600 (GTG) in the open reading frame of the BRAF gene would be expected to be converted to GAA, resulting in a V600E (valine-to-glutamine) amino acid change in the BRAF protein, same as the amino acid change caused by the commonly seen T1799A BRAF mutation that converts codon 600 (GTG) to GAG. This tandem mutation in codon 600 would therefore be expected to confer the same oncogenic function to BRAF kinase as the T1799A mutation alone does. As a morphological representative for the cases that harbored the T1799A mutation in both the primary tumors and the matched lymph node-metastasized tumors, case 15 showed similar histological and cytological features consistent with PTC in both the primary and lymph node-metastasized tumors (Fig. 1Go, A–D). Interestingly, in case 4, which harbored the tandem TG1799–1800AA mutation in the lymph node-metastasized tumor but no mutation in the primary tumor, two morphologically distinct groups of tumor cells were present in the metastasized tumor tissue, one with typical nuclear features of PTC and the other with hyperchromatic nuclei and abundant eosinophilic cytoplasm (Fig. 1Go, E–H). The tandem TG1799–1800AA mutation has not been previously reported in thyroid cancers, although it was found in invasive melanomas (24).



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 1. BRAF mutations in primary PTC and matched lymph node-metastasized tumors. Shown in the top of the figure is a representative case (no. 15) that harbored the T1799A mutation in both the primary tumor (left) and the matched metastasized tumor tissue in a lymph node (right). A, The primary thyroid tumor showed typical papillary carcinoma architecture. C, The tumor cells demonstrated typical nuclear features for PTC: irregularity of nuclear contour, nuclear clearing, and pseudoinclusion. B and D, The lymph node metastasis demonstrated histological and cytological features similar to those observed in primary tumors. Shown in the bottom of the figure is a representative case (no. 4) that harbored no mutation in the primary tumor (left) but the T1799A mutation in the metastasized tumor tissue in a lymph node (right). Together with the T1799A mutation, a novel mutation, G1800A, was also found in the lymph node of this case, forming a tandem TG1799–17800AA mutation. E and G, Primary tumor of this case showed typical histological (E) and cytological (G) features for PTC. F, The metastasis demonstrated mixed follicular and papillary structures with predominance of follicular areas. H, In the areas of metastasis with papillary morphology, the neoplastic cells possessed typical nuclear features for PTC. In the follicular areas of the metastasis, the neoplastic cells had abundant eosinophilic cytoplasm and hyperchromatic nuclei (H), different from the nuclei in the primary tumor (G). For case 4, the tandem TG1779–1800AA BRAF mutations were confirmed by also sequencing the PCR products with the reverse primers (lower chromatogram of case 4).

 


View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2. Confirmation of the tandem TG1799–1800AA BRAF mutation within one allele by sequencing of subcloned BRAF PCR products. A, Direct DNA sequencing of the PCR products of BRAF exon 15, showing the tandem TG1779–1800AA mutation overlapped with the wild 1779–1800TG; B, DNA sequencing of the subcloned PCR products from A. Only clones with wild allele or clones with the tandem TG1799–1800AA mutation were identified, confirming a true tandem mutation within the same allele.

 

   Discussion
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
References
 
There have been extensive studies on the T1799A BRAF mutation in primary thyroid tumors (6, 7, 8, 9, 10, 11, 12, 13). Significant association of this mutation in primary PTC tumors with metastasis and local invasion was shown in some studies (2, 9, 10) but not in others (8, 12, 13), although the studies in the latter group were relatively small. There have been no studies on BRAF mutation in metastasized thyroid tumors until recently (25). Demonstration of a correlation of BRAF mutation in primary and metastasized thyroid tumors would be consistent with a role of this mutation in facilitating metastasis of thyroid cancer.

The present study examined BRAF mutation in primary and matched lymph node-metastasized PTC tumors and represents a relatively large series of lymph node-metastasized PTC samples. We demonstrated a high prevalence of the T1799A mutation in metastasized thyroid tumors in lymph nodes whose primary tumors harbored the same mutation, suggesting that this mutation likely had been transferred with metastasis to lymph nodes from primary tumors. The finding of this mutation in both the primary tumor and the two matched lymph nodes in case 5 further supports this notion. It was interesting to find that some cases (4, 16, 25) harbored the T1799A BRAF mutation only in the metastasized tissues in lymph nodes but not in their primary tumors. These cases harbored a solitary PTC tumor without multifocality in the thyroid gland, arguing against the possibility that the mutation in the lymph node examined might represent metastasis from a separate BRAF mutation-positive primary tumor. It is therefore possible that BRAF mutation may develop de novo in metastasized thyroid cancer cells in lymph nodes. The presence of the tandem TG1799–1800AA mutation only in lymph node metastasis but not in the primary PTC is also consistent with this possibility. Oler et al. (25) recently reported a novel mutation, a deletion of codon 601, only in lymph node-metastasized PTC but not in the primary tumors (25). It thus appears that lymph node predisposes the BRAF gene in thyroid cancer cells to the risk of being bombarded around the area of codons 600 and 601, resulting in genetic alterations. The high prevalence of BRAF mutation in lymph node-metastasized thyroid tumors in the cases that harbored this mutation in their primary tumors supports the notion that BRAF mutation may facilitate the seeding and progression of PTC cells in lymph nodes, consistent with the finding that BRAF mutation was associated with a higher prevalence of lymph node metastasis of PTC (2, 23).

The high prevalence and de novo formation of BRAF mutations in PTC metastasized to lymph nodes may suggest that lymph nodes possess a special local milieu that favors the survival and growth of BRAF mutation-positive thyroid cancer cells once they are seeded in the lymph node. The biological changes of thyroid cancer cells as a consequence of BRAF mutation, on the other hand, may confer thyroid cancer cells’ unique ability to survive in the favorable local milieu of lymph nodes. In this model, BRAF mutation plays a role in the host-environment interaction in the process of PTC metastasis in the lymph node. This hypothesis is consistent with the common finding that follicular thyroid cancers, which do not harbor BRAF mutation, usually do not metastasize to lymph nodes (26), whereas PTC, which harbor BRAF mutation with a high prevalence, frequently metastasize to lymph nodes (21, 22). It may also explain a frequent phenomenon observed clinically that small primary micro PTC foci in the thyroid gland can be associated with large lymph node-metastasized PTC tumors (27, 28). It is likely that certain factor(s) in the local milieu of lymph node interact specifically with BRAF mutation-positive thyroid cancer cells to facilitate their survival and promote their growth and progression in lymph nodes. When the selective pressure of the local milieu of the lymph node is strong enough, it may even cause de novo formation of BRAF mutation in metastasized PTC cells. It would be interesting to see whether certain growth factors in the local milieu of lymph nodes may play a role in host-tumor interactions between BRAF mutation-positive PTC and lymph modes as seen with IGF-I and epidermal growth factor released from lymph node stromal cells that can promote growth and tumorigenicity of breast carcinoma cells (29).

In summary, our study demonstrated a high prevalence of BRAF mutation in metastasized PTC in lymph nodes. We also showed possible de novo formation of the T1799A mutation and a TG1799–1800AA tandem mutation in codon 600 of the BRAF gene in metastasized PTC in lymph nodes. These results are consistent with the notion that BRAF mutation may facilitate the metastasis and progression of PTC in lymph nodes. We propose that the local milieu of lymph nodes may specially favor the selection and survival of thyroid cancer cells that harbor BRAF mutation. Additional work is needed to test this hypothesis.


   Footnotes
 
This study was supported by a research grant from the Flight Attendant Medical Research Institute and a Johns Hopkins Clinician Scientist Award (to M.X.).

J.C.X. is a research student from River Hill High School (Howard County, MD).

During the revision of this manuscript, a paper has been published by Oler et al. (25 ) reporting a high prevalence of BRAF mutation in lymph node metastases from PTC, similar to the finding in the present study, and a new lymph node metastasis-specific BRAF mutation that was not found in the present study.

First Published Online July 5, 2005

Abbreviations: BRAF, B-type Raf; PTC, papillary thyroid cancer.

Received December 2, 2004.

Accepted June 29, 2005.


   References
Top
 Abstract
 Introduction
 Patients and Methods
 Results
 Discussion
 References
 

  1. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA 2002 Mutations of the BRAF gene in human cancer. Nature 417:949–954[CrossRef][Medline]
  2. Kim KH, Kang DW, Kim SH, Seong IO, Kang DY 2004 Mutations of the BRAF gene in papillary thyroid carcinoma in a Korean population. Yonsei Med J 45:818–821[Medline]
  3. Kumar R, Angelini S, Czene K, Sauroja I, Hahka-Kemppinen M, Pyrhonen S, Hemminki K. 2003 BRAF mutations in metastatic melanoma: a possible association with clinical outcome. Clin Cancer Res 9:3362–3368[Abstract/Free Full Text]
  4. Hilger RA, Scheulen ME, Strumberg D 2002 The Ras-Raf-MEK-ERK pathway in the treatment of cancer. Onkologie 25:511–518[CrossRef][Medline]
  5. Mercer KE, Pritchard CA 2003 Raf proteins and cancer: B-Raf is identified as a mutational target. Biochim Biophys Acta 1653:25–40[Medline]
  6. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454–1457[Abstract/Free Full Text]
  7. Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westra WH, Ladenson PW, Sidransky D 2003 BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 95:625–627[Abstract/Free Full Text]
  8. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA 2003 High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res 63:4561–4567[Abstract/Free Full Text]
  9. Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T, Yamashita S 2003 Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab 88:4393–4397[Abstract/Free Full Text]
  10. Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A, Santoro M, Fagin JA, Nikiforov YE 2003 BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 88:5399–5404[Abstract/Free Full Text]
  11. Xing M, Vasko V, Tallini G, Larin A, Wu G, Udelsman R, Ringel MD, Ladenson PW, Sidransky D 2004 BRAF T1796A transversion mutation in various thyroid neoplasms. J Clin Endocrinol Metab 89:1365–1368[Abstract/Free Full Text]
  12. Fugazzola L, Mannavola D, Cirello V, Vannucchi G, Muzza M, Vicentini L, Beck-Peccoz P 2004 BRAF mutations in an Italian cohort of thyroid cancers. Clin Endocrinol (Oxf) 61:239–243[CrossRef][Medline]
  13. Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G, Cavaliere A, Ribacchi R, Falorni A, Pontecorvi A, Pacini F, Pinchera A, Santeusanio F 2004 BRAF(V599E) mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. J Clin Endocrinol Metab 89:2414–2420[Abstract/Free Full Text]
  14. Hundahl SA, Fleming ID, Fremgen AM, Menck HR 1998 A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 83:2638–2648[CrossRef][Medline]
  15. Mazzaferri EL, Jhiang SM 1994 Long-term impact of initial surgical and medical therapy on papillary and follicular thyroid cancer. Am J Med 97:418–428[CrossRef][Medline]
  16. Gilliland FD, Hunt WC, Morris DM, Key CR 1997 Prognostic factors for thyroid carcinoma. A population-based study of 15,698 cases from the Surveillance, Epidemiology and End Results (SEER) program 1973–1991. Cancer 79:564–573[CrossRef][Medline]
  17. LiVolsi VA, Fadda G, Baloch ZW 2000 Prognostic factors in well-differentiated thyroid cancer. Rays 25:163–175[Medline]
  18. Machens A, Hinze R, Thomusch O, Dralle H 2002 Pattern of nodal metastasis for primary and reoperative thyroid cancer. World J Surg 26:22–28[CrossRef][Medline]
  19. Davila-Cervantes A, Gamino R, Gonzalez O, Herrera MF 2003 Surgical treatment of recurrent differentiated thyroid carcinoma. Eur J Surg Suppl 588:14–17
  20. Kim MK, Mandel SH, Baloch Z, Livolsi VA, Langer JE, Didonato L, Fish S, Weber RS 2004 Morbidity following central compartment reoperation for recurrent or persistent thyroid cancer. Arch Otolaryngol Head Neck Surg 130:1214–1216[Abstract/Free Full Text]
  21. Wang TS, Dubner S, Sznyter LA, Heller KS 2004 Incidence of metastatic well-differentiated thyroid cancer in cervical lymph nodes. Arch Otolaryngol Head Neck Surg 130:110–113[Abstract/Free Full Text]
  22. Kupferman ME, Patterson M, Mandel SJ, LiVolsi V, Weber RS 2004 Patterns of lateral neck metastasis in papillary thyroid carcinoma. Arch Otolaryngol Head Neck Surg 130:857–860[Abstract/Free Full Text]
  23. Xing M 2005 BRAF mutation in thyroid cancer. Endocr Relat Cancer 12:245–262[Abstract/Free Full Text]
  24. Thomas NE, Alexander A, Edmiston SN, Parrish E, Millikan RC, Berwick M, Groben P, Ollila DW, Mattingly D, Conway K 2004 Tandem BRAF mutations in primary invasive melanomas. J Invest Dermatol 122:1245–1250[CrossRef][Medline]
  25. Oler G, Ebina KN, Michaluart Jr P, Kimura ET, Cerutti J 2005 Investigation of BRAF mutation in a series of papillary thyroid carcinoma and matched-lymph node metastasis reveals a new mutation in metastasis. Clin Endocrinol (Oxf) 62:509–511[CrossRef][Medline]
  26. D’Avanzo A, Treseler P, Ituarte PH, Wong M, Streja L, Greenspan FS, Siperstein AE, Duh QY, Clark OH 2004 Follicular thyroid carcinoma: histology and prognosis. Cancer 100:1123–1129[CrossRef][Medline]
  27. Chow SM, Law SC, Chan JK, Au SK, Yau S, Lau WH 2003 Papillary microcarcinoma of the thyroid : prognostic significance of lymph node metastasis and multifocality. Cancer 98:31–40[CrossRef][Medline]
  28. Wada N, Duh QY, Sugino K, Iwasaki H, Kameyama K, Mimura T, Ito K, Takami H, Takanashi Y 2003 Lymph node metastasis from 259 papillary thyroid microcarcinomas: frequency, pattern of occurrence and recurrence, and optimal strategy for neck dissection. Ann Surg 237:399–407[CrossRef][Medline]
  29. LeBedis C, Chen K, Fallavollita L, Boutros T, Brodt P 2002 Peripheral lymph node stromal cells can promote growth and tumorigenicity of breast carcinoma cells through the release of IGF-I and EGF. Int J Cancer 100:2–8[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Endocr Relat CancerHome page
F Frasca, C Nucera, G Pellegriti, P Gangemi, M Attard, M Stella, M Loda, V Vella, C Giordano, F Trimarchi, et al.
BRAF(V600E) mutation and the biology of papillary thyroid cancer
Endocr. Relat. Cancer, March 1, 2008; 15(1): 191 - 205.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
M. Xing
BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications
Endocr. Rev., December 1, 2007; 28(7): 742 - 762.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
R. Giannini, C. Ugolini, C. Lupi, A. Proietti, R. Elisei, G. Salvatore, P. Berti, G. Materazzi, P. Miccoli, M. Santoro, et al.
The Heterogeneous Distribution of BRAF Mutation Supports the Independent Clonal Origin of Distinct Tumor Foci in Multifocal Papillary Thyroid Carcinoma
J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3511 - 3516.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. M. Cerutti, G. Oler, P. Michaluart Jr., R. Delcelo, R. M. Beaty, J. Shoemaker, and G. J. Riggins
Molecular Profiling of Matched Samples Identifies Biomarkers of Papillary Thyroid Carcinoma Lymph Node Metastasis
Cancer Res., August 15, 2007; 67(16): 7885 - 7892.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al.
Targeting BRAFV600E in thyroid carcinoma: therapeutic implications
Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasko, V.
Right arrow Articles by Xing, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasko, V.
Right arrow Articles by Xing, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*6-METHYLURACIL
*Genetics Home Reference
Medline Plus Health Information
*Thyroid Cancer
Related Collections
Right arrow Thyroid
Right arrow Endocrine Oncology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals