help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2005-0432
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zinn, A. R.
Right arrow Articles by Ross, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zinn, A. R.
Right arrow Articles by Ross, J. L.
Related Collections
Right arrow Male Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 9 5041-5046
Copyright © 2005 by The Endocrine Society

Androgen Receptor CAGn Repeat Length Influences Phenotype of 47,XXY (Klinefelter) Syndrome

Andrew R. Zinn, Purita Ramos, Frederick F. Elder, Karen Kowal, Carole Samango-Sprouse and Judith L. Ross

McDermott Center for Human Growth and Development and Department of Internal Medicine (A.R.Z., P.R.), and Department of Pathology (F.F.E.), The University of Texas Southwestern Medical School, Dallas, Texas 75390-8591; Division of Endocrinology, Department of Pediatrics, Thomas Jefferson University Medical College (K.K., J.L.R.), Philadelphia, Pennsylvania 19107-5083; and Department of Pediatrics, George Washington University (C.S.-S.), Washington, D.C. 20052

Address all correspondence and requests for reprints to: Dr. Andrew R. Zinn, University of Texas Southwestern Medical School, 5323 Harry Hines Boulevard, Dallas, Texas 75390-8591. E-mail: andrew.zinn{at}utsouthwestern.edu.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: Klinefelter syndrome (KS; 47,XXY karyotype and variants) is characterized by tall stature and testicular failure, with marked variation in severity of the phenotype. Previous studies have proposed that genetic factors including mosaicism, parental origin of the supernumerary X-chromosome, skewed X inactivation, and androgen receptor (AR) polyglutamine repeat length may contribute to phenotypic variability in KS.

Objective: The objective of this study was to investigate the roles of these genetic factors in the variability of the KS phenotype.

Design: This was a cross-sectional study.

Setting: The study was performed at a pediatric endocrinology referral clinic.

Patients: Thirty-five KS boys and men, aged 0.1–39 yr, were studied.

Interventions: There were no interventions.

Main Outcome Measures: Auxological measurements, biological indices of testicular function, and clinical assessment of muscle tone were the main outcome measures. Genetic studies included karyotyping to detect mosaicism, genotyping of microsatellite markers to determine parental origin of the supernumerary X-chromosome, and genotyping and methylation studies to measure AR polyglutamine (AR CAGn) repeat length and X inactivation ratio.

Results: The only genetic factor that significantly influenced the KS phenotype was the AR CAGn repeat length, which was inversely correlated with penile length, a biological indicator of early androgen action. Mosaicism, imprinting, and skewed X inactivation did not account for the variability of the KS phenotype.

Conclusions: Normal genetic variation in the AR coding sequence may be clinically significant in the setting of early testicular failure and subnormal circulating testosterone levels, as occur in KS.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
KLINEFELTER SYNDROME (KS), first described in 1942 on the basis of testicular failure (1), occurs in one of 500 to one of 1000 males (2, 3, 4, 5, 6) and is characterized by the abnormal karyotype 47,XXY (7). The extra X-chromosome is usually acquired though nondisjunction during maternal or paternal gametogenesis (8). The KS phenotype is highly variable, but generally includes testicular failure, tall stature, and characteristic cognitive differences, such as language-based learning disabilities and reading dysfunction. The risks for osteoporosis, breast cancer, autoimmune thyroid disorders, and type II diabetes mellitus are also increased in KS males (9). The clinical spectrum of testicular failure in KS ranges from near-complete, fetal-onset gonadal failure and androgen deficiency, manifested by small testes and penis early in infancy or childhood (10, 11, 12, 13, 14, 15), to mild androgen deficiency with azoospermia in adulthood (16).

Multiple genetic mechanisms may explain the variability of the KS phenotype, apart from normal interindividual genetic variation (17). First, the KS phenotype, or at least the extragonadal component, results primarily from excessive dosage of X-linked genes that escape inactivation, and there may be allelic differences in the expression of these genes (18). Second, mosaicism for 46,XY or other cell lines could influence the KS phenotype. Third, the pattern of X inactivation could account for variation in the KS phenotype (19). Ordinarily, random inactivation of one of the two X-chromosomes in KS males, as in most females, would mask the phenotype of any X-linked recessive mutations. However, preferential inactivation of one X-chromosome could result in the expression of such mutations (20). Similarly, X-chromosome isodisomy due to nondisjunction during the second maternal meiotic division could result in the expression of an X-linked recessive phenotype. Fourth, the parental origin of the supernumerary X-chromosome has been postulated to affect the KS phenotype via differential expression of paternal vs. maternal alleles, i.e. imprinting (19). And fifth, there may be a particular role for androgen-related genes in the phenotype of KS men, whose androgen levels are already subnormal due to testicular failure beginning as early as infancy (21).

One such gene that has been the subject of numerous genetic studies is the androgen receptor (AR) gene, a member of the nuclear receptor superfamily. The AR gene encodes a ligand-dependent transcription factor and has a highly polymorphic CAGn trinucleotide repeat in the coding sequence of the first exon. Translation of this repeat results in a polyglutamine tract in the N-terminal transactivation domain of the protein. The length of this polyglutamine tract is inversely related to receptor transactivation activity in vitro (22, 23, 24, 25). AR CAGn repeat length variation has been associated in vivo with androgen-related disorders, such as prostate cancer (26), male infertility (25, 27), or undermasculinized genitalia (28).

The goal of the present study was to investigate the roles of these genetic factors in the variability of the KS phenotype in a cohort of 35 KS boys and men, aged 1 month to 39 yr. The phenotype evaluation included auxological measurements, biological indices of testicular function, and clinical assessment of muscle tone. Genetic studies included karyotyping to detect mosaicism, genotyping of microsatellite markers to determine parental origin of the supernumerary X-chromosome, and genotyping and methylation studies to measure AR CAGn repeat length and X inactivation ratio. The results indicated that one genetic factor examined influenced the KS phenotype: AR CAGn repeat length inversely correlated with penile length, a biological indicator of early androgen action.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
All subjects or their parents gave informed consent or assent. This study was approved by the institutional review boards at Thomas Jefferson University and The University of Texas Southwestern Medical School. Individuals with KS variants with greater degrees of sex chromosome aneuploidy, e.g. 48,XXYY, were excluded because their phenotype is distinct from that of 47,XXY KS (29).

Subjects (n = 35) ranged in age from 0.1–39 yr (mean, 8.1 ± 8.9 yr). Twelve were infants (age, <2 yr), 21 were boys (age, 2–18 yr), and two were adults (age, >18 yr). Thirty-two were Caucasian, and three were African-American. Twenty-four subjects (69%) were ascertained by antenatal testing for advanced maternal age. The remaining subjects were ascertained for developmental or behavioral issues (nine), tall stature (one), or infertility (one). Three subjects who were of adolescent age or older were receiving testosterone therapy at the time of evaluation and were not included in analyses of penile length, testicular volume, or muscle tone.

Phenotypic assessment

Anthropometric measurements. Subjects’ heights were measured with a stadiometer. Supine length was measured in boys less than 2 yr of age. Measured or reported parental heights were also recorded. Midparental height adjusted for the child’s sex (target height) was calculated using the formula 0.5 x [father’s height (centimeters) + mother’s height (centimeters) + 13 cm] (30). The subjects’ target height SD scores were calculated from sex-adjusted midparental height obtained from the National Center for Health Statistics growth data (31). Body mass index was calculated as weight in kilograms divided by height in meters squared. Other measurements were also converted to SD scores where possible using age- and gender-specific norms (31, 32, 33).

Genitalia. Penile length was measured by one trained investigator (J.L.R.) and converted to SD score using available standards (34). Testicular size was assessed with the Prader orchidometer, and the measured volumes were converted to SD scores using published reference values (35). Only measurements from subjects who had received testosterone treatment for a total duration of less than 3 months and no treatment in the past year were used for analyses. For subjects with a discrepancy in testis size, the smaller measurement was used for analyses.

Muscle tone. Muscle tone was evaluated clinically as normal, mildly decreased, or severely decreased by one experienced clinician (J.L.R.), assessing resistance to passive movement at the elbow and knee. Also the degree of head lag in the infants less than 6 months of age was evaluated. Standing posture tone was also evaluated clinically in children able to bear weight on the lower extremities.

Hormone measurements. Serum testosterone, FSH, LH, and estradiol levels were measured by commercial assays (Esoterix Endocrinology, Calabasas Hill, CA) or as previously reported (21).

Genetic studies

Karyotype. A postnatal, G-banded, peripheral blood karyotype was obtained for all subjects. Each karyotype included at least 20 cells. Antenatal karyotype reports were also obtained for most subjects diagnosed prenatally.

Parental origin. Parental origin of the supernumerary X-chromosome was determined by genotyping probands and parents with a panel of seven highly polymorphic microsatellite markers dispersed along the length of the chromosome. Markers were selected from the ABI Linkage Set 2.5 and analyzed using an ABI 3100 capillary electrophoresis instrument and GeneMapper software (Applied Biosystems, Foster City, CA). The panel included DXS987, DXS1001, DXS1047, DXS1214, DXS8091, DXS1060, and DXS1226. In seven cases a sample was not available from the father. For these cases if any of the proband’s marker alleles were nonmaternal, we assigned the origin of the supernumerary X to the father.

X inactivation ratio and AR CAGn repeat length. Skewing of X-chromosome inactivation was measured using the AR methylation assay (36). One microgram of genomic DNA was either digested at 37 C for more than 6 h with 20 U restriction enzyme HpaII in buffer supplied by the manufacturer (New England Biolabs, Beverly, MA) or mock-digested in buffer alone, followed by incubation at 65 C for 30 min to inactivate the enzyme. DNA was then ethanol precipitated and redissolved in water, and 100 ng were used as template for PCR amplification of the AR CAGn repeat. The primers were GCTGTGAAGGTTGCTGTTCCTCAT and TCCAGAATCTGTTCCAGAGCGTGC. One primer was labeled at its 5' end with the fluorophor 6-carboxyfluorescein. Products were analyzed by capillary electrophoresis as described above for genotyping. Fragment lengths were determined by comparison with a reference sample containing pooled DNAs from individuals with CAGn repeat lengths of 18, 19, 20, 21, 22, 23, or 25 copies, as determined by DNA sequencing. Peak areas were calculated using GeneMapper software. The percentage of each X-allele that was active (unmethylated) was determined from the ratio of peak areas in the HpaII-digested samples after correcting for unequal amplification of alleles in the mock-digested samples as previously described (37). Preferential inactivation favoring one allele more than 80% was considered skewed (38). The weighted mean AR CAGn repeat length was calculated as previously described (37), using the formula weighted mean AR CAGn repeat length = x1a1 + x2a2, where x1 and x2 were the proportions of unmethylated (active) AR alleles 1 and 2, and a1 and a2 were the CAGn repeat lengths of alleles 1 and 2. The weighted mean AR CAGn repeat length equaled the measured repeat length for homozygotes.

Statistical analyses

All results are presented as the mean ± SD. We calculated Pearson correlation coefficients and P values for height SD score vs. age, testosterone vs. estradiol levels, and penile length, testicular volume, and height, head circumference, and body mass index (BMI) SD scores vs. mean weighted AR CAGn repeat length using PRISM (GraphPad, San Diego, CA). The same software was used to calculate Spearman’s correlation coefficient for the fraction of active alleles vs. AR CAGn repeat length. Dichotomous variables were compared by Fisher’s exact test (two-tailed). The t tests were also two-tailed and assumed equal variance. All P values shown are nominal; P < 0.05 was considered statistically significant. We excluded postpubertal-aged KS males who had received testosterone treatment from certain analyses, including penile length, testicular volume, and muscle tone, because these phenotypes may be affected by the treatment.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Anthropometric and physical findings

Subjects, on the average, were taller and heavier than normal, with proportional head circumference (Table 1Go). The height SD score tended to increase with chronological age, but the trend did not reach statistical significance (r = 0.27; P = 0.11; data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Anthropometric and physical measurements of KS cohort

 
Gynecomastia, defined as the presence of at least Tanner stage 2 breast tissue, was present in six subjects: five with Tanner stage 2 breast tissue, ages 6.9, 10.9, 14, 13.9, and 39.9 yr, and one with Tanner stage 3 breast tissue, age 14 yr. Muscle tone was normal in 13 subjects, 16 had mild hypotonia, and six were severely hypotonic.

Endocrine findings

Hormone measurements, including testosterone, LH, and FSH, are presented in Table 2Go. Six of 32 nonandrogen-treated subjects had castrate gonadotropin levels; all were over 14 yr of age. There was a trend for testosterone and estradiol levels to correlate that did not achieve statistical significance (n = 20; r = 0.43; P = 0.06).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Hormone measurements of subjects who were not treated with androgen

 
Genetic data

Only one subject had a mosaic karyotype (46,XY[14]/47,XXY[7]); the remaining 34 were 47,XXY. We were unable to assess the affect of clinically apparent mosaicism on the phenotype, because there was only one mosaic in our cohort.

Parental samples were available for 34 subjects. The extra X-chromosome was maternal in 19 subjects (56%) and paternal in 15 subjects (44%). There was no significant difference in any mean anthropometric measure or in penile length or testicular volume SD score in subjects with a maternal vs. a paternal extra X-chromosome (data not shown). Five patients had maternal X-chromosome isodisomy, as judged by homozygosity for all seven microsatellite markers tested. They did not show any significant differences from subjects with uniparental heterodisomy or biparental inheritance of their X-chromosomes for any of the phenotypes listed in Table 1Go (data not shown).

Thirteen of the 35 subjects (37%) were homozygous for the AR CAGn repeat polymorphism. The percentage of each X-allele that was active (unmethylated) was measured for the other 22 heterozygous subjects. Because the total percentage of active alleles (shorter plus longer) is 100%, only data for shorter alleles are shown (Fig. 1Go). The mean percentage of active shorter alleles was 48 ± 18%, which was not significantly different from the expected mean of 50% for random X inactivation (P = 0.65, by t test). Furthermore, there was no correlation between the length of the CAGn repeat and the percent activity of the shorter allele (Fig. 1Go; P = 0.78).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. X inactivation studies. The percentage of shorter AR alleles that were active (unmethylated) vs. CAGn repeat length of shorter allele for each heterozygous subject is shown. The dashed line indicates the mean percent activity (48%) of shorter AR alleles for all 22 heterozygous subjects. n.s., Not significant.

 
Only two subjects showed highly skewed X inactivation, defined as the percentage of activity of one allele greater than 80% or less than 20% (Fig. 1Go). Both were infants who inherited their supernumerary X-chromosome from their mothers, i.e. both were 47,XmXmY. Their respective height SD scores were –0.58 and +0.12, penile length SD scores were –3.5 and +1.0, and testicular volume SD scores were both –1.5. Both subjects had mild hypotonia. The subject with the shorter penile length had AR CAGn repeat lengths of 21 and 26, with activities of 12% and 88%, respectively. The subject with the longer penile length had AR CAGn repeat lengths of 14 and 19, with respective activities of 88% and 12%.

AR gene CAGn repeat lengths ranged from 14–28, all within the normal range. We computed correlations of repeat length with penile length, testicular volume, and height, head circumference, and BMI SD scores for subjects who did not receive prior testosterone treatment. The weighted mean CAGn repeat length was calculated for heterozygotes to account for the effect of X inactivation (see Subjects and Methods). Measured CAGn repeat length was used for homozygotes. Penile length SD score showed a significant inverse correlation with AR CAGn repeat length (P < 0.01; Fig. 2AGo). In contrast, testicular volume and height SD scores did not correlate with CAGn repeat length (Fig. 2Go, B and C), nor did head circumference or BMI SD scores (data not shown). Similarly, the means of the AR CAGn repeat lengths did not differ significantly among untreated subjects with no (22.1 ± 2.3; n = 11), mild (22.1 ± 3.0; n = 15), or severe (23.2 ± 0.8; n = 6) hypotonia, although short repeats were conspicuously absent among subjects with severe hypotonia (Fig. 2DGo). There was also no significant difference in CAGn repeat length among untreated subjects with or without gynecomastia [21.4 ± 2.4 (n = 6) vs. 22.5 ± 2.5 (n = 26); P = 0.4, by t test].



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Weighted mean AR CAGn repeat length vs. penile length SD score (A), testicular volume z-score (B), height SD score (C), or degree of hypotonia (D). n.s., Not significant.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Previous studies have suggested that genetic factors involving the sex chromosomes may influence the phenotype of KS (19, 37). These studies were generally subject to ascertainment bias because most KS patients fail to be diagnosed in childhood (2). We analyzed a cohort of 35 KS patients, most ascertained by antenatal diagnosis for advanced maternal age. Our results should therefore show less phenotypic bias while admittedly introducing other potential biases, e.g. socioeconomic status and motivation to participate in research.

The proportion of mosaics in previous KS studies varied between 7–10% and 15% (2, 39). We identified only one mosaic patient (3%) in our cohort. Although in most cases only 20 cells were counted in postnatal karyotypes, most patients also had prior antenatal karyotypes that were nonmosaic. The difference in the prevalence of mosaicism could reflect sampling error and parental decisions about terminating pregnancies (40). Although mosaicism for a normal 46,XY cell line probably ameliorates the KS phenotype, mosaicism detected by standard clinical karyotyping did not account for the phenotypic variability of our cohort.

Iitsuka et al. (19) speculated that the KS phenotype might also reflect X chromosome imprinting effects, as has been proposed for 45,X Turner syndrome (41, 42). We therefore assayed the parental origin of the supernumerary X-chromosome in our KS cohort. This variable was not associated with the phenotypes of penile length, testicular volume, or height.

Isodisomy could result in the expression of X-linked recessive mutations in severely affected KS males, as has been suggested for females (43). Five of our 34 subjects for whom parental genotypes were available (15%) appeared to have maternal X isodisomy, as judged by the lack of heterozygosity of any microsatellite marker tested. These five subjects were not more severely affected than the 29 subjects with maternal heterodisomy or biparental disomy. Thus, isodisomy did not explain the variability of the KS phenotype in our cohort.

Skewed X inactivation has also been proposed to influence the severity of the KS phenotype (19). Only two of 22 (9%) of our patients who were informative for the AR CAGn repeat length polymorphism showed highly skewed inactivation, defined as greater than 80% methylation of one allele. Zitzmann et al. (37) observed a similar prevalence of highly skewed inactivation (five of 46, 11%; see their Fig. 1AGo). Iitsuka et al. (19) reported that five of 16 (31%) KS males who were informative for the AR polymorphism had skewed X-chromosome inactivation, but two of their subjects had karyotype 48,XXYY. The proportion of 47,XXY subjects with highly skewed inactivation in their study was three of 14 (21%), which was not statistically significantly different from the 9% in our study (P = 0.28, by Fisher’s exact test).

AR CAGn repeat lengths greater than 40 are directly correlated with hormonal and biological indices of androgen resistance in patients with X-linked Kennedy’s disease or spinal and bulbar muscular atrophy (44). Repeat length varied from 40–62 within the Kennedy’s disease population and was directly correlated with the age at disease onset and the presence of testicular dysfunction and gynecomastia (44). All of our subjects had AR CAGn repeat lengths within the normal range of seven to 35. Even within this range, functional differences have been demonstrated in AR alleles in vitro, with proteins containing shorter polyglutamine repeats having greater transregulatory activity (26, 45). Variation in the AR CAGn repeat length in vivo may influence a variety of androgen-sensitive traits, including male fertility (25, 27), prostatic hypertrophy and cancer (26), bone density, body composition, and serum lipid levels (46, 47, 48, 49). Another study found that the mean AR CAGn repeat length was slightly greater among 46,XY males with moderate to severe defects in genital masculinization, including hypospadias, partly fused or unfused scrotum, and micropenis, compared with controls (28). The researchers concluded that the AR CAGn repeat acts as a modifier locus.

Circulating testosterone in KS males is frequently low due to testicular failure. The effects of small differences in AR activity on the growth of androgen-responsive tissues could be amplified by subnormal testosterone levels. Zitzmann et al. (37) recently reported an association between AR CAGn repeat length and multiple aspects of the KS phenotype in a cohort of 47,XXY men. They found that longer AR CAGn repeats were associated with increased height, decreased testicular volume, decreased bone density, presence of gynecomastia, decreased likelihood of being in a stable relationship, and less professional achievement. We found a highly significant negative correlation between AR CAGn repeat length and penile length SD score, but no significant correlation with testicular volume or height SD scores or the presence of gynecomastia. The youth of our cohort limited our ability to study this last phenotype. Although not statistically significant, there was a paucity of short AR CAGn repeat alleles among our severely hypotonic subjects.

Zitzmann et al. (37) also reported finding preferential inactivation of the shorter AR CAGn repeat alleles in their subjects, which would magnify the effect of CAGn repeat length on androgen action. We did not find any systematic trend toward preferential inactivation of the shorter or longer AR CAGn allele in our cohort. The reason for this discrepancy is not clear, but may relate to differences in ascertainment. Interestingly, of the two subjects in our cohort with highly skewed X inactivation, the one with preferential inactivation of his shorter AR CAGn allele had severely decreased penile length (–3.5 SD), whereas the one with preferential inactivation of his longer AR CAGn allele had a penile length SD score of +1.0.

Testicular volume during early childhood may reflect complex growth interactions of Leydig, Sertoli, and germ cells as well as pubertal development. The relationship of this phenotype to CAGn repeat length was therefore difficult to evaluate in our young cohort. Testicular biopsies of KS infants and boys demonstrated decreased or absent germ cells and abnormal seminiferous tubules (16, 50, 51, 52). Small testes in KS may be due more to germ cell loss than to interactions of testosterone deficiency and androgen activity, explaining the lack of correlation between testicular volume and AR CAGn repeat length.

In summary, AR CAGn repeat length variation was the only genetic factor we examined that was significantly correlated with an androgen-responsive aspect of the phenotype, penile length, in our cohort of KS males. The variability of other KS phenotypes could be due to allelic differences in (over)expression of X-linked genes that escape inactivation, differences in autosomal genes, or interactions between supernumerary X-linked genes and unknown environmental factors. Subsequent studies should examine other KS phenotypes, such as cognition and previously described learning deficits. Identifying genes that contribute to the variability of the KS phenotype may lead to new prognostic tools for counseling and targets for therapeutic interventions to improve the outcome of this common genetic disorder.


    Acknowledgments
 
We thank the families who participated in this study and the KS support groups in the United States for their interest in this research.


    Footnotes
 
First Published Online June 14, 2005

Abbreviations: AR, Androgen receptor; BMI, body mass index; KS, Klinefelter syndrome.

Received February 28, 2005.

Accepted June 8, 2005.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Klinefelter H, Reifenstein, EC, Albright, F 1942 Syndrome characterized by gynecomastia, aspermatogenesis, without A-Leydigism and increased excretion of follicle stimulating hormone. J Clin Endocrinol Metab 2:615–627[Abstract/Free Full Text]
  2. Bojesen A, Juul S, Gravholt CH 2003 Prenatal and postnatal prevalence of Klinefelter syndrome: a national registry study. J Clin Endocrinol Metab 88:622–626[Abstract/Free Full Text]
  3. Jacobs PA 1979 the incidence and etiology of sex chromosme abnormalities in man. Birth Defects Orig Artic Ser 15:3–14
  4. MacLean DG, Court Brown WM 1961 Abnormalities of sex chromosome constitution in newborn babies. Lancet 2:406–408[CrossRef][Medline]
  5. Visootsak J, Aylstock M, Graham Jr JM 2001 Klinefelter syndrome and its variants: an update and review for the primary pediatrician. Clin Pediatr 40:639–651[Abstract/Free Full Text]
  6. Nielsen J, Wohlert M 1990 Sex chromosome abnormalities found among 34,910 newborn children: results from a 13-year incidence study in Arhus, Denmark. Birth Defects Orig Artic Ser 26:209–223[Medline]
  7. Bradbury J, Bunge, RG, Boccabella, RA 1956 Chromatin test in Klinefelter’s syndrome. J Clin Endocrinol Metab 16:689
  8. MacDonald M, Hassold T, Harvey J, Wang LH, Morton NE, Jacobs P 1994 The origin of 47,XXY and 47,XXX aneuploidy: heterogeneous mechanisms and role of aberrant recombination. Hum Mol Genet 3:1365–1371[Abstract/Free Full Text]
  9. Price WH, Clayton JF, Wilson J, Collyer S, De Mey R 1985 Causes of death in X chromatin positive males (Klinefelter’s syndrome). J Epidemiol Community Health 39:330–336[Abstract/Free Full Text]
  10. Laron Z, Hochman IH 1971 Small testes in prepubetal boys with Klinefelter’s syndrome. J Clin Endocrinol Metab 32:671–672[Abstract/Free Full Text]
  11. Stewart DA, Bailey JD, Netley CT, Rovet J, Park E, Cripps M, Curtis JA 1982 Growth and development of children with X and Y chromosome aneuploidy from infancy to pubertal age: the Toronto study. Birth Defects Orig Artic Ser 18:99–154
  12. Stewart DA, Netley CT, Park E 1982 Summary of clinical findings of children with 47,XXY, 47,XYY, and 47,XXX karyotypes. Birth Defects Orig Artic Ser 18:1–5
  13. Stewart DA, Bailey JD, Netley CT, Park E 1990 Growth, development, and behavioral outcome from mid-adolescence to adulthood in subjects with chromosome aneuploidy: the Toronto Study. Birth Defects Orig Artic Ser 26:131–188[Medline]
  14. Salbenblatt JA, Bender BG, Puck MH, Robinson A, Faiman C, Winter JS 1985 Pituitary-gonadal function in Klinefelter syndrome before and during puberty. Pediatr Res 19:82–86[Medline]
  15. Ratcliffe SG 1982 The sexual development of boys with the chromosome constitution 47,XXY (Klinefelter’s syndrome). Clin Endocrinol Metab 11:703–716[CrossRef][Medline]
  16. Kamischke A, Baumgardt A, Horst J, Nieschlag E 2003 Clinical and diagnostic features of patients with suspected Klinefelter syndrome. J Androl 24:41–48[Abstract/Free Full Text]
  17. Simpson JL, De La Cruz F, Swerdloff RS, Samango-Sprouse C, Skakkebaek NE, Graham Jr JM, Hassold T, Aylstock M, Meyer-Bahlburg HF, Willard HF, Hall JG, Salameh W, Boone K, Staessen C, Geschwind D, Giedd J, Dobs AS, Rogol A, Brinton B, Paulsen CA 2003 Klinefelter syndrome: expanding the phenotype and identifying new research directions. Genet Med 5:460–468[Medline]
  18. Carrel L, Willard HF 2005 X-Inactivation profile reveals extensive variability in X-linked gene expression in females. Nature 434:400–404[CrossRef][Medline]
  19. Iitsuka Y, Bock A, Nguyen DD, Samango-Sprouse CA, Simpson JL, Bischoff FZ 2001 Evidence of skewed X-chromosome inactivation in 47,XXY and 48,XXYY Klinefelter patients. Am J Med Genet 98:25–31[CrossRef][Medline]
  20. Yoshioka M, Yorifuji T, Mituyoshi I 1998 Skewed X inactivation in manifesting carriers of Duchenne muscular dystrophy. Clin Genet 53:102–107[Medline]
  21. Lahlou N, Fennoy I, Carel JC, Roger M 2004 Inhibin B and anti-Mullerian hormone, but not testosterone levels, are normal in infants with nonmosaic Klinefelter syndrome. J Clin Endocrinol Metab 89:1864–1868[Abstract/Free Full Text]
  22. Beilin J, Ball EM, Favaloro JM, Zajac JD 2000 Effect of the androgen receptor CAG repeat polymorphism on transcriptional activity: specificity in prostate and non-prostate cell lines. J Mol Endocrinol 25:85–96[Abstract]
  23. Irvine RA, Ma H, Yu MC, Ross RK, Stallcup MR, Coetzee GA 2000 Inhibition of p160-mediated coactivation with increasing androgen receptor polyglutamine length. Hum Mol Genet 9:267–274[Abstract/Free Full Text]
  24. Kazemi-Esfarjani P, Trifiro MA, Pinsky L 1995 Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies. Hum Mol Genet 4:523–527[Abstract/Free Full Text]
  25. Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L, Yong EL 1997 Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production, and male infertility. J Clin Endocrinol Metab 82:3777–3782[Abstract/Free Full Text]
  26. Buchanan G, Irvine RA, Coetzee GA, Tilley WD 2001 Contribution of the androgen receptor to prostate cancer predisposition and progression. Cancer Metastasis Rev 20:207–223[CrossRef][Medline]
  27. Dowsing AT, Yong EL, Clark M, McLachlan RI, de Kretser DM, Trounson AO 1999 Linkage between male infertility and trinucleotide repeat expansion in the androgen-receptor gene. Lancet 354:640–643[CrossRef][Medline]
  28. Lim HN, Chen H, McBride S, Dunning AM, Nixon RM, Hughes IA, Hawkins JR 2000 Longer polyglutamine tracts in the androgen receptor are associated with moderate to severe undermasculinized genitalia in XY males. Hum Mol Genet 9:829–834[Abstract/Free Full Text]
  29. Linden MG, Bender BG, Robinson A 1995 Sex chromosome tetrasomy and pentasomy. Pediatrics 96:672–682[Abstract/Free Full Text]
  30. Tanner JM, Goldstein H, Whitehouse RH 1970 Standards for children’s height at ages 2–9 years allowing for heights of parents. Arch Dis Child 45:755–762
  31. Hamill PV, Drizd TA, Johnson CL, Reed RB, Roche AF, Moore WM 1979 Physical growth: National Center for Health Statistics percentiles. Am J Clin Nutr 32:607–629[Abstract/Free Full Text]
  32. Hall JG, Froster-Iskenius UG, Allanson JE 1995 Handbook of normal physical measurements. Oxford, UK: Oxford University Press
  33. McKusick VA 1972 Heritable disorders of connective tissue. St. Louis, MO: Mosby
  34. Jones DL 1997 Smith’s recognizable patterns of human malformation. 5th ed. Philadelphia: Saunders
  35. Zachmann M, Prader A, Kind HP, Hafliger H, Budliger H 1974 Testicular volume during adolescence. Cross-sectional and longitudinal studies. Helv Paediatr Acta 29:61–72[Medline]
  36. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW 1992 Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 51:1229–1239[Medline]
  37. Zitzmann M, Depenbusch M, Gromoll J, Nieschlag E 2004 X-chromosome inactivation patterns and androgen receptor functionality influence phenotype and social characteristics as well as pharmacogenetics of testosterone therapy in Klinefelter patients. J Clin Endocrinol Metab 89:6208–6217[Abstract/Free Full Text]
  38. Plenge RM, Stevenson RA, Lubs HA, Schwartz CE, Willard HF 2002 Skewed X-chromosome inactivation is a common feature of X-linked mental retardation disorders. Am J Hum Genet 71:168–173[CrossRef][Medline]
  39. Ratcliffe SG, Murray L, Teague P 1986 Edinburgh study of growth and development of children with sex chromosome abnormalities. III. Birth Defects Orig Artic Ser 22:73–118[Medline]
  40. Mezei G, Papp C, Toth-Pal E, Beke A, Papp Z 2004 Factors influencing parental decision making in prenatal diagnosis of sex chromosome aneuploidy. Obstet Gynecol 104:94–101[CrossRef][Medline]
  41. Skuse DH, James RS, Bishop DV, Coppin B, Dalton P, Aamodt-Leeper G, Bacarese-Hamilton M, Creswell C, McGurk R, Jacobs PA 1997 Evidence from Turner’s syndrome of an imprinted X-linked locus affecting cognitive function. Nature 387:705–708[CrossRef][Medline]
  42. Haverkamp F, Keuker T, Kaiser G, Noeker M, Zerres K, Rietz C, Social cognition in relation to different visuospatial cognitive styles in Ullrich-Turner syndrome: evidence for a selective deficit in social context dependent visual integration. Proc 5th International Turner Symposium, Naples, Italy, 2000, pp 97–103
  43. Lau AW, Brown CJ, Penaherrera M, Langlois S, Kalousek DK, Robinson WP 1997 Skewed X-chromosome inactivation is common in fetuses or newborns associated with confined placental mosaicism. Am J Hum Genet 61:1353–1361[CrossRef][Medline]
  44. Dejager S, Bry-Gauillard H, Bruckert E, Eymard B, Salachas F, LeGuern E, Tardieu S, Chadarevian R, Giral P, Turpin G 2002 A comprehensive endocrine description of Kennedy’s disease revealing androgen insensitivity linked to CAG repeat length. J Clin Endocrinol Metab 87:3893–3901[Abstract/Free Full Text]
  45. Ding D, Xu L, Menon M, Reddy GP, Barrack ER 2004 Effect of a short CAG (glutamine) repeat on human androgen receptor function. Prostate 58:23–32[CrossRef][Medline]
  46. Zitzmann M, Brune M, Kornmann B, Gromoll J, Junker R, Nieschlag E 2001 The CAG repeat polymorphism in the androgen receptor gene affects bone density and bone metabolism in healthy males. Clin Endocrinol (Oxf) 55:649–657[CrossRef][Medline]
  47. Zitzmann M, Brune M, Kornmann B, Gromoll J, von Eckardstein S, von Eckardstein A, Nieschlag E 2001 The CAG repeat polymorphism in the AR gene affects high density lipoprotein cholesterol and arterial vasoreactivity. J Clin Endocrinol Metab 86:4867–4873[Abstract/Free Full Text]
  48. Zitzmann M, Depenbusch M, Gromoll J, Nieschlag E 2003 Prostate volume and growth in testosterone-substituted hypogonadal men are dependent on the CAG repeat polymorphism of the androgen receptor gene: a longitudinal pharmacogenetic study. J Clin Endocrinol Metab 88:2049–2054[Abstract/Free Full Text]
  49. Zitzmann M, Gromoll J, von Eckardstein A, Nieschlag E 2003 The CAG repeat polymorphism in the androgen receptor gene modulates body fat mass and serum concentrations of leptin and insulin in men. Diabetologia 46:31–39[Medline]
  50. Ferguson-Smith M 1959 The prepubertal testicular lesion in chromatin positive Klinefelter’s syndrome (primary micro-orchidism) as seen in mentally handicapped children. Lancet 1:219–222[Medline]
  51. Mikamo K, Aguercif M, Hazeghi P, Martin-Du Pan R 1968 Chromatin-positive Klinefelter’s syndrome. A quantitative analysis of spermatogonial deficiency at 3, 4, and 12 months of age. Fertil Steril 19:731–739[Medline]
  52. Muller J, Skakkebaek NE, Ratcliffe SG 1995 Quantified testicular histology in boys with sex chromosome abnormalities. Int J Androl 18:57–62[Medline]
  53. Ross JL, Kowal K, Samango-Sprouse C, Zinn AR, Early androgen deficiency in infants and young boys with 47,XXY Klinefelter syndrome. Horm Res., in press



This article has been cited by other articles:


Home page
J AndrolHome page
A. Balestrieri, L. Zirilli, B. Madeo, E. Pignatti, G. Rossi, C. Carani, and V. Rochira
21-Hydroxylase Deficiency and Klinefelter Syndrome in an Adult Man: Striking a Balance Between Androgen Excess and Insufficiency
J Androl, November 1, 2008; 29(6): 605 - 609.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Vorona, M. Zitzmann, J. Gromoll, A. N. Schuring, and E. Nieschlag
Clinical, Endocrinological, and Epigenetic Features of the 46,XX Male Syndrome, Compared with 47,XXY Klinefelter Patients
J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3458 - 3465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Itti, I. T. Gaw Gonzalo, A. Pawlikowska-Haddal, K. B. Boone, A. Mlikotic, L. Itti, F. S. Mishkin, and R. S. Swerdloff
The Structural Brain Correlates of Cognitive Deficits in Adults with Klinefelter's Syndrome
J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1423 - 1427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zinn, A. R.
Right arrow Articles by Ross, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zinn, A. R.
Right arrow Articles by Ross, J. L.
Related Collections
Right arrow Male Endocrinology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals