help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism, doi:10.1210/jc.2004-2152
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/8/4852    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Munir, I.
Right arrow Articles by Jakimiuk, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Munir, I.
Right arrow Articles by Jakimiuk, A. J.
Related Collections
Right arrow Female Endocrinology
Right arrow Metabolism
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 8 4852-4857
Copyright © 2005 by The Endocrine Society

Resistin Stimulation of 17{alpha}-Hydroxylase Activity in Ovarian Theca Cells in Vitro: Relevance to Polycystic Ovary Syndrome

Iqbal Munir, Hui-Wen Yen, Talia Baruth, Rafal Tarkowski, Ricardo Azziz, Denis A. Magoffin and Artur J. Jakimiuk

Department of Obstetrics and Gynecology, Cedars-Sinai Burns and Allen Research Institute, Cedars-Sinai Medical Center/David Geffen School of Medicine at the University of California–Los Angeles (I.M., H.-W.Y., T.B., R.A., D.A.M.), Los Angeles, California 90048; and Department of Obstetrics and Gynecology, First Department of Gynecology (R.T.) and Second Department of Gynecology (A.J.J.), University School of Medicine, Lublin, and Department of Obstetrics and Gynecology (A.J.J.), Central Clinical Hospital of Ministry of Interior and Administration, 02-507 Warsaw, Poland

Address all correspondence and requests for reprints to: Denis A. Magoffin, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Davis 2066, Los Angeles, California 90048. E-mail: magoffin{at}cshs.org.


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Context: A newly discovered hormone resistin has been shown to be increased in women with polycystic ovary syndrome (PCOS).

Objective: The purpose of this study was to confirm increased resistin concentrations in women with PCOS and to test the direct effect of resistin on human theca cell androgen production.

Design: Resistin was measured in fasting serum samples by RIA. To test the direct effects of resistin on ovarian androgen biosynthesis, human theca cells were cultured with resistin for 3 d in the presence and absence of forskolin and insulin.

Patients: Fasting serum samples were obtained from 45 women with PCOS and 74 regularly cycling premenopausal control women in the follicular phase of their menstrual cycles, and ovarian theca cell cultures were established from two control women.

Results: The mean serum resistin concentration was increased (40%) in women with PCOS. Serum resistin concentrations correlated positively with body mass index and testosterone in PCOS women but not in controls. There were no significant correlations between resistin and fasting insulin or indicators of insulin resistance when corrected for body mass index. In cultured human theca cells, basal 17{alpha}-hydroxylase activity was unchanged by resistin alone, but resistin enhanced 17{alpha}-hydroxylase activity in the presence of forskolin or a combination of forskolin plus insulin. Resistin (≥1 ng/ml) augmented forskolin and forskolin plus insulin stimulation of CYP17 mRNA expression in a concentration-dependent manner.

Conclusion: These data indicate that abnormal resistin secretion in PCOS may play a role in causing ovarian hyperandrogenism.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
POLYCYSTIC OVARY SYNDROME (PCOS), the most common reproductive disorder of premenopausal women (1), is characterized by chronic anovulation and hyperandrogenism. Many women with PCOS are obese, and in 50% or more of women with PCOS, insulin resistance appears to play an important role in the etiology of ovarian hyperandrogenism (2, 3). The mechanisms by which insulin resistance leads to excessive androgen production are not fully understood. Although the insulin-resistant women with PCOS maintain fasting glucose concentrations within normal limits, higher concentrations of insulin are required. It is likely that the higher overall concentrations of insulin augment LH-stimulated androgen secretion by the ovarian theca cells. Consequently, it is important to understand the links between insulin resistance and ovarian androgen secretion.

Resistin is an adipokine belonging to a recently described family of small cysteine-rich secreted proteins (4) that is induced during adipocyte differentiation (5) and down-regulated by insulin-sensitizing agents (6). In mice, resistin has been linked to insulin resistance. Administration of recombinant resistin impaired insulin action and glucose tolerance, whereas administration of antiresistin antibodies improved insulin action (6). Infusion of resistin under euglycemic hyperinsulinemic conditions produced hepatic insulin resistance (7), and chronically elevated resistin concentrations altered glucose metabolism (8). Interestingly, the expression of resistin can be induced by dehydroepiandrosterone (9), potentially linking resistin and androgen biosynthesis.

In humans, low levels of resistin mRNA and protein expression were initially reported in isolated sc and omental adipocytes (10, 11, 12). A high level of resistin gene expression was observed in human preadipocytes that decreased during adipogenic differentiation (13). Subsequent studies demonstrated additional tissues as potential sources of resistin and showed a significantly greater expression of resistin protein in abdominal sc and omental adipose tissue homogenates (14). Resistin mRNA was also found in human monocytes (10). Differentiation of monocytes into macrophages in vitro increases resistin mRNA (15). Together, these observations demonstrate that there are multiple cellular sources of resistin in humans and that circulating resistin represents resistin from adipocytes as well as from the stromovascular compartment.

The primary structure of human resistin is only 53% homologous to murine resistin and there are two isoforms of resistin in humans compared with three in rodents. More importantly, the relationship between resistin and insulin resistance and adiposity in humans is controversial. Whereas some studies observed a positive association between resistin and insulin resistance (16, 17, 18), others failed to demonstrate a relationship (19, 20).

In humans there appear to be gender-specific differences in resistin action. Resistin concentrations were observed to be higher in women compared with men (20). In addition, a polymorphism in the resistin gene was associated with body weight in premenopausal women (21). Carriers of this polymorphism had a lower mean body mass index (BMI), suggesting a potential link between resistin and energy metabolism in women of reproductive age. A significant association exists between obesity and PCOS, and it was recently observed that women with PCOS have higher circulating resistin concentrations (22).

A causal relationship was observed between resistin and androgen synthesis in rats. Resistin dose dependently increased both basal and human chorionic gonadotropin-stimulated testosterone secretion from rat testicular tissue indicating a potential role of resistin in reproductive endocrine function (23). Because of the higher circulating resistin concentration in women in general and PCOS in particular, it is conceivable that resistin may be involved, directly or indirectly in promoting ovarian hyperandrogenism in PCOS. The purpose of the present study was to confirm the elevation of circulating resistin concentrations in women with PCOS compared with regularly cycling control women and to examine the direct role of recombinant resistin in the regulation of androgen production by human theca cells.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Fasting serum samples were obtained from 45 women with PCOS and 74 regularly cycling premenopausal control women in the follicular phase of their menstrual cycle. Women with PCOS were identified based on a history of oligo/amenorrhea, hirsutism or hyperandrogenemia, and typical morphological appearance of polycystic ovaries (normal or enlarged ovarian volume with multiple subcapsular cysts <8 mm in diameter) with no evidence of hyperprolactinemia, Cushing’s syndrome, congenital or nonclassical adrenal hyperplasia, thyroid disease, or hormone-secreting tumors. Hyperandrogenemia was defined as an androgen concentration above the 95th percentile of 98 healthy control women [total testosterone concentration ≥2.94 nmol/liter (88 ng/dl), free testosterone ≥0.026 nmol/liter (0.75 ng/dl), or dehydroepiandrosterone sulfate ≥6.64 mmol/liter (2750 ng/ml)] (24). Control and subjects with PCOS were selected such that the racial and ethnic composition of the two groups were similar (Table 1Go).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Racial composition of subject groups

 
Neither control subjects nor subjects with PCOS had received hormonal treatment or ovarian suppression for at least 3 months before obtaining the specimens. Informed consent was obtained from all subjects participating in the study as approved by the Ethics Committee at the University School of Medicine in Lublin or the Institutional Review Board at the University of Alabama, Birmingham and the Institutional Review Board at Cedars-Sinai Medical Center.

For in vitro studies, human theca interna tissue was obtained from the follicles of regularly cycling premenopausal white women undergoing total hysterectomy with bilateral ovariectomy as part of their standard care for endometriosis at Cedars-Sinai Medical Center unrelated to this study. There was no ovarian pathology, and the women were not taking any medication known to affect sex hormone metabolism for at least 3 months before surgery. Women with hirsutism, acne, hypertension, or type I or type II diabetes mellitus or who had a first-degree relative with type I or type II diabetes were excluded from the study. All women had regular menstrual cycles every 27–35 d and normal serum androgen concentrations. Because the discarded tissues were collected without identifiers, the Cedars-Sinai Medical Center Institutional Review Board determined that the tissue collection met the criteria for a waiver of the requirement for informed consent.

Serum assays

Resistin was measured with a double antibody RIA using recombinant human resistin as the standard (Phoenix Pharmaceuticals, Inc., Belmont, CA). Leptin was measured with a human leptin RIA (Linco Research, Inc., St. Charles, MO). Insulin was measured by RIA and LH and FSH were measured by immunoradiometric assay (Diagnostic Systems Laboratories, Webster, TX). The standard for LH was the World Health Organization Second International Standard for Human Pituitary Luteinizing Hormone (80/552) and the standard for FSH was the Second International Reference Preparation of Pituitary Follicle Stimulating Hormone (2nd IRP 78/549). Steroid hormones were measured by RIA (24) and glucose was measured by the glucose oxidase method. Insulin resistance was estimated using the homeostasis model assessment (HOMA) using the formula: insulin resistance = fasting insulin x fasting glucose/22.5 (25). Insulin resistance was further estimated by quantitative insulin sensitivity check index (QUICKI) using the formula: QUICKI = 1/[log(I0) + log(G0)], where I0 is the fasting insulin, and G0 is the fasting glucose (26).

Theca cell isolation and propagation

Individual follicles were dissected away from the ovarian stroma. Small antral follicles 8–9 mm in diameter were identified under a dissecting microscope and hemisected. The granulosa cells were gently removed with a platinum loop, and the theca interna was microdissected from the follicle wall. The theca shells were dispersed with collagenase (0.5 mg/ml), collagenase IA (0.5 mg/ml), and deoxyribonuclease (0.1 mg/ml) (Sigma Chemical Co., St. Louis, MO) in HEPES-buffered DMEM containing 4.5 g/liter D-glucose supplemented with 10% (vol/vol) fetal bovine serum (FBS) and antimicrobial agents (200 IU/ml penicillin, 200 µg/ml streptomycin, 0.50 µg/ml of amphotericin B, and 100 µg/ml gentamicin). The cells from each follicle were plated individually in two six-well plates containing growth medium [DMEM (without HEPES)/F-12 medium (1:1) supplemented with 5% (vol/vol) FBS, 5% (vol/vol) horse serum (Omega Scientific, Tarzana, CA), 2% (vol/vol) Ultroser G (Life Technologies, Paisley, UK), 20 nM sodium selenite, 1 µM vitamin E, 100 IU/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B, and 50 µg/ml gentamicin] and incubated at 37 C in a 5% CO2, 5% O2 and 90% N2 humidified atmosphere. When the theca cells reached subconfluence they were removed from the dish with neutral protease (Sigma Chemical Co.) in DMEM/F-12 (1:1) and frozen, and the first passage cells were stored in liquid nitrogen in culture medium containing 20% FBS and 10% dimethyl sulfoxide. For experiments, the cells were thawed and propagated to the third passage in growth medium. Before initiating experimental treatments, the cells were cultured for 3 d in serum-free medium [DMEM/F-12 (1:1) supplemented with 20 nM sodium selenite, 1 µM vitamin E, 100 µg/ml transferrin, 0.1% BSA (ICN Biomedicals, Costa Mesa, CA; fraction V), 100 IU/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B, and 50 µg/ml gentamicin]. Experimental treatments with forskolin (Sigma Chemical Co.), recombinant human insulin (Sigma Chemical Co.), and recombinant human resistin (Alpha Diagnostic International Inc., San Antonio, TX) were performed in serum-free medium as described in the figure legends for 3 d with a change to fresh medium and test agents after 2 d.

17{alpha}-Hydroxylase assay

To measure 17{alpha}-hydroxylase activity, cultured theca cells were incubated in DMEM/F-12 (1:1) containing 0.5 mg/ml BSA, 1 µM unlabeled progesterone, and 0.2 µCi [1,2,6,7-3H]progesterone (NEN Life Science Products, Boston, MA; 114 Ci/mmol). After 3 h of incubation at 37 C in a 5% CO2, 5% O2, and 90% N2 humidified atmosphere, the medium was harvested and extracted twice with diethyl ether, and the pooled extracts were dried under a stream of air. The extracted steroids were dissolved in ethyl acetate:isooctane (1:1 by volume), and the samples were spotted on thin-layer chromatography plates (PE SIL G/UV; Whatman, Clifton, NJ). The plates were developed in chloroform:ethyl acetate (3:1 by volume). The thin-layer chromatography plates were sprayed with EN3HANCE (NEN Life Science Products) and then exposed to autoradiographic film. After developing the films, the areas on the plate corresponding to the labeled progesterone substrate and 17{alpha}-hydroxyprogesterone product were cut from the plate and counted in a scintillation counter. The identity of the spots was confirmed by comparing their migration with authentic [3H]progesterone and [3H]17{alpha}-hydroxyprogesterone standards.

DNA assay

Total cellular DNA was isolated from theca cells using Tri-Reagent (MRC, Cincinnati, OH) according to the manufacturer’s protocol. The DNA pellet was dissolved in 100 µl of 40 mM NaOH at 4 C for 24 h. The DNA concentration of the samples was measured by a sensitive fluorescence assay (PicoGreen dsDNA quantitation kit; Molecular Probes, Eugene, OR). Briefly, 5 µl of sample was diluted with 200 µl of PicoGreen solution in a 96-well plate. The fluorescence was measured on a Molecular Dynamics variable mode imager (Typhoon 8600). Sample concentrations were interpolated from a standard curve calculated by linear regression of the fluorescence of known concentrations of lambda DNA standard.

Measurement of mRNA expression

CYP17 mRNA was measured by real-time RT-PCR. Total RNA was isolated with Tri-Reagent, resuspended in 30 µl of RNase free-water and transcribed into cDNA by incubation for 30 min in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2, 500 µM deoxy (d)-ATP, 500 µM dCTP, 500 µM dGTP, 500 µM dTTP, 5 µg oligo(deoxythymidine)12–18 (Pharmacia Biotech, Piscataway, NJ), 40 U RNaseout (Invitrogen Corp., Carlsbad, CA) and 400 IU Moloney murine leukemia virus reverse transcriptase (Invitrogen) in a total volume of 40 µl.

PCR was performed in an ABI PRISM 7700 (Applied Biosystems, Foster City, CA) using QuantiTect SYBR PCR reagents (QIAGEN, Valencia, CA). SYBR Green was the detected fluorophore and 5-carboxy-X-rhodamine, succinimidyl ester was the passive reference. For CYP17 PCR, a 50-µl reaction mix was prepared adding 25 µl of 2x QuantiTect SYBR PCR Master Mix, 5 µl cDNA, and 200 nM of each of the forward primer (TCTCTTGCTGCTTACCCTAGC) and reverse primer (GTGGTGGCCGACAATCACTG). After initial activation of the HotStarTaq DNA polymerase (10 min at 95 C), the cDNA was amplified for 40 cycles (94 C for 0.15 min, 60 C for 1 min). A standard curve was generated by plotting the threshold cycle values/crossing points as a function of the log of a series of known DNA concentrations. The volumes of sample were selected to yield data within the linear range of the standard curve. The amount of mRNA in each sample was interpolated from the standard curve and expressed as femtograms of full-length mRNA. The data were normalized using ß-actin as an internal control by performing real-time PCR using the reverse-transcribed cDNAs used to amplify CYP17.

Statistical analysis

Differences between the control and PCOS groups were analyzed with a t test. The level of statistical significance was considered to be P < 0.05. Linear regression analysis was performed using JMP statistical discovery software from SAS Institute Inc. (Cary, NC). Multiple comparisons were performed using one-way ANOVA with post hoc comparisons employing Tukey’s test.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
There were no significant differences in age, BMI, or leptin indicating that the PCOS and control populations were well matched for age and weight (Table 2Go). As expected, the PCOS group had significantly higher serum testosterone concentrations. LH and FSH concentrations were not different between the two groups, but the LH to FSH ratio was increased in the women with PCOS.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Characteristics of the control and PCOS subjects

 
Because insulin resistance is frequently associated with PCOS, we examined a variety of measures related to insulin sensitivity. In our subject population, fasting glucose concentrations in women with PCOS were similar to control values (Table 2Go). The mean fasting insulin concentration was significantly higher in women with PCOS compared with controls. A fasting glucose to insulin ratio (GIR) is a useful measure of insulin sensitivity in the women with PCOS (27). Significant decrease in the mean GIR was observed in the PCOS group of our study population, indicating insulin resistance in this group. Several epidemiological studies have demonstrated that the QUICKI (28) and HOMA (29, 30) indices are useful to estimate insulin sensitivity. In our population the mean QUICKI and HOMA indices of insulin resistance were both higher in PCOS compared with control women consistent with the PCOS group being more insulin resistant than controls.

To determine whether there was evidence to implicate a role for resistin in PCOS, circulating resistin concentrations were measured in both the control and PCOS groups. The mean serum resistin concentration was increased (40%) in women with PCOS compared with control women (Table 2Go).

To determine whether there were correlations between resistin concentrations and endocrine parameters associated with PCOS, we performed linear regression analysis. As shown in Table 3Go, in both control and PCOS subjects, resistin significantly correlated with the fasting insulin concentration as well as parameters of insulin resistance including the GIR, QUICKI, and HOMA. In both of the groups, there were no significant correlations between resistin concentration and LH or FSH. There was no correlation between resistin concentration and either BMI (Fig. 1Go) or testosterone (Fig. 2Go) in control subjects. In contrast, resistin correlated positively with BMI and testosterone in the PCOS group (Figs. 1Go and 2Go). There was no significant correlation between BMI and testosterone. The correlation between resistin and testosterone remained significant (P = 0.002) when corrected for BMI. In contrast, when corrected for BMI the correlations between resistin and GIR, QUICKI and HOMA were not significant. Conversely, the correlations between BMI and the parameters of insulin resistance (GIR, QUICKI, and HOMA) remained significant when corrected for resistin concentrations. These data raise the intriguing possibility that resistin may play a role in augmenting androgen biosynthesis in women with PCOS.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Correlations between resistin and indicators of insulin resistance and features of PCOS

 


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1. Correlation between serum resistin and BMI. The solid line represents the linear correlation for the control women, P = 0.605, r = 0.004. The dotted line represents the linear correlation in PCOS subjects, P < 0.0001, r = 0.333.

 


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Correlation between serum resistin and total testosterone. The solid line represents the linear correlation for the control women, P = 0.644, r = 0.004. The dotted line represents the linear correlation in PCOS subjects, P = 0.0007, r = 0.236.

 
To test the hypothesis that resistin could directly augment ovarian androgen production, we cultured theca cells isolated from regularly cycling women with recombinant human resistin. In our subject population, the average resistin concentration was 7.9 ± 0.3 ng/ml in controls and 12.4 ± 0.5 ng/ml in the PCOS group. Therefore, we selected 10 ng/ml of resistin as an appropriate concentration to test its effect on 17{alpha}-hydroxylase activity. As previously shown (31), there was a significant stimulation of 17{alpha}-hydroxylase activity by forskolin (P < 0.04), an activator of adenylate cyclase, that was further augmented (P < 0.03) by insulin (Fig. 3Go). Basal 17{alpha}-hydroxylase activity was unchanged by resistin alone; however, resistin enhanced 17{alpha}-hydroxylase activity stimulated by forskolin (P < 0.02) or a combination of forskolin plus insulin (P < 0.05) (Fig. 3Go).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 3. Resistin stimulation of 17{alpha}-hydroxylase activity in cultured human theca cells. Third-passage human theca cells were cultured for 3 d with or without 25 µM forskolin, 10 ng/ml recombinant human insulin, and 10 ng/ml (17.22 pmol/liter) recombinant human resistin. After a 3-d culture period, the cells were incubated for 3 h with [3H]progesterone to measure 17{alpha}-hydroxylase activity. Data are mean ± SEM. Data points with different letters are significantly different (P < 0.05). The data are the results of three separate experiments in triplicate from each of two subjects.

 
An important phenotypic feature of the theca cells in women with PCOS is the overexpression of steroidogenic enzymes (32). Therefore, we tested the effects of resistin on CYP17 mRNA expression. As expected, forskolin caused a significant increase (P < 0.02) in CYP17 mRNA expression that was further increased (P < 0.03) by a combination of forskolin plus insulin (Fig. 4Go). Resistin alone had no effect on CYP17 mRNA expression at any of the concentrations tested. A significant stimulatory effect of resistin (P < 0.05) on the expression of CYP17 mRNA by forskolin and forskolin plus insulin was observed at a concentration as low as 1 ng/ml. Increasing resistin concentrations further enhanced forskolin, and forskolin plus insulin activated CYP17 mRNA expression throughout the physiological range of resistin concentrations.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4. Expression of CYP17 mRNA after forskolin, insulin, and resistin stimulation. Third-passage human theca cells were cultured for 3 d with or without 25 µM forskolin, 10 ng/ml insulin (17.22 pmol/liter), and increasing concentrations of resistin (0–50 ng/ml). Total RNA was extracted from the cells, and CYP17 mRNA was measured by real-time quantitative PCR. Data are mean ± SEM. Treatments with different letters are significantly different (P < 0.05). Data points with asterisks are significantly different within treatments from cells not treated with resistin (P < 0.05). The data are the results of three separate experiments in triplicate from each of two subjects.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
In our study, there was a 40% increase in resistin concentrations in the serum of women with PCOS compared with control women. Previous studies reporting serum resistin concentrations in women with PCOS are inconsistent. Although one small study of Asian subjects observed a 2-fold higher concentration of resistin mRNA expression in adipocytes from subjects with PCOS (33), there was no difference in the circulating resistin concentration between women with PCOS and controls. In contrast, serum resistin was significantly elevated in a study of Greek women with PCOS (22). When segregated into obese and lean groups, the obese women with PCOS had significantly higher resistin concentrations than controls. In lean women with PCOS, the resistin concentration was similar to controls. These observations support the concept that there may be a relationship between obesity and circulating resistin concentrations, but the physiological significance of this relationship will require more detailed study.

Although there was no relationship between resistin concentrations and BMI in control women, there was a significant correlation between resistin and BMI in the PCOS group. In women with PCOS, there may be specific metabolic or hormonal influences that may alter the way resistin secretion is regulated. The alteration cannot be adiposity per se because our subjects were well matched for BMI. Indeed, the relationship between resistin and BMI in the general population was not consistently observed. Some studies report a positive correlation between resistin and BMI (34, 35), although others found no correlation (20, 36). Elevated resistin concentration in obese subjects was not observed for every individual in the group, some having values identical to the control nonobese population (34). These observations raise the possibility that there may be additional unidentified factors that influence the association between resistin and BMI.

In our study population, there was a significant positive correlation between the serum resistin and testosterone concentrations in PCOS patients. This is a novel observation suggesting that resistin may be an additional factor relevant to androgen excess in PCOS. There was no correlation between circulating resistin and testosterone in control subjects, indicating that there may be important differences in polycystic ovaries facilitating the responsiveness of the theca cells to resistin.

Our in vitro data provides the first evidence that resistin can increase ovarian androgen production by directly stimulating ovarian theca cells. The data demonstrate that theca cells from control women have the capacity to respond to resistin. Therefore, it is unlikely that a lack of resistin responsiveness in theca cells from control women is responsible for the absence of correlation between circulating resistin and testosterone concentrations. An intriguing possibility is that there may be an inhibitor in the follicular microenvironment of healthy developing follicles that suppresses the effect of resistin. Alternatively, a positive interaction between resistin and other factors capable of augmenting ovarian androgen production could be present in polycystic ovaries but not in controls. We observed that resistin alone had no effect on 17{alpha}-hydroxylase activity or mRNA expression, but there was enhanced 17{alpha}-hydroxylase mRNA expression as well as activity in the presence of forskolin and insulin. These data support the concept that circulating resistin may synergize with insulin to augment androgen production. Thus, interactions between resistin and insulin could be a factor in determining whether insulin-resistant women develop PCOS or not. Further study will be needed to elucidate the interactions between resistin and modulators of androgen synthesis.


   Footnotes
 
This work was supported by National Institute of Child Health and Human Development Grants HD33907 and HD41610 (to D.A.M.), HD29364 (to R.A.) and University School of Medicine Grant 122/01.

Results from this work were presented in part at the 85th Annual Meeting of The Endocrine Society, Philadelphia, PA, 2003.

First Published Online May 10, 2005

Abbreviations: BMI, Body mass index; d, deoxy; FBS, fetal bovine serum; GIR, glucose to insulin ratio; HOMA, homeostasis model assessment; PCOS, polycystic ovary syndrome; QUICKI, quantitative insulin sensitivity check index.

Received November 1, 2004.

Accepted May 3, 2005.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Azziz R, Woods KS, Reyna R, Key TJ, Knochenhauer ES, Yildiz BO 2004 The prevalence and features of the polycystic ovary syndrome in an unselected population. J Clin Endocrinol Metab 89:2745–2749[Abstract/Free Full Text]
  2. Legro RS, Kunselman AR, Dodson WC, Dunaif A 1999 Prevalence and predictors of risk for type 2 diabetes mellitus and impaired glucose tolerance in polycystic ovary syndrome: a prospective, controlled study in 254 affected women. J Clin Endocrinol Metab 84:165–169[Abstract/Free Full Text]
  3. Conn JJ, Jacobs HS, Conway GS 2000 The prevalence of polycystic ovaries in women with type 2 diabetes mellitus. Clin Endocrinol (Oxf) 52:81–86[CrossRef][Medline]
  4. Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, Dai CY, Enders GH, Silberg DG, Wen X, Wu GD, Lazar MA 2001 A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci USA 98:502–506[Abstract/Free Full Text]
  5. Kim KH, Lee K, Moon YS, Sul HS 2001 A cysteine-rich adipose tissue-specific secretory factor inhibits adipocyte differentiation. J Biol Chem 276:11252–11256[Abstract/Free Full Text]
  6. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, Lazar MA 2001 The hormone resistin links obesity to diabetes. Nature 409:307–312[CrossRef][Medline]
  7. Rajala MW, Obici S, Scherer PE, Rossetti L 2003 Adipose-derived resistin and gut-derived resistin-like molecule-ß selectively impair insulin action on glucose production. J Clin Invest 111:225–230[CrossRef][Medline]
  8. Rangwala SM, Rich AS, Rhoades B, Shapiro JS, Obici S, Rossetti L, Lazar MA 2004 Abnormal glucose homeostasis due to chronic hyperresistinemia. Diabetes 53:1937–1941[Abstract/Free Full Text]
  9. Kochan Z, Karbowska J 2004 Dehydroepiandrosterone up-regulates resistin gene expression in white adipose tissue. Mol Cell Endocrinol 218:57–64[CrossRef][Medline]
  10. Savage DB, Sewter CP, Klenk ES, Segal DG, Vidal-Puig A, Considine RV, O’Rahilly S 2001 Resistin/Fizz3 expression in relation to obesity and peroxisome proliferator-activated receptor-{gamma} action in humans. Diabetes 50:2199–2202[Abstract/Free Full Text]
  11. Nagaev I, Smith U 2001 Insulin resistance and type 2 diabetes are not related to resistin expression in human fat cells or skeletal muscle. Biochem Biophys Res Commun 285:561–564[CrossRef][Medline]
  12. McTernan CL, McTernan PG, Harte AL, Levick PL, Barnett AH, Kumar S 2002 Resistin, central obesity, and type 2 diabetes. Lancet 359:46–47[CrossRef][Medline]
  13. Janke J, Engeli S, Gorzelniak K, Luft FC, Sharma AM 2002 Resistin gene expression in human adipocytes is not related to insulin resistance. Obes Res 10:1–5[Medline]
  14. McTernan PG, McTernan CL, Chetty R, Jenner K, Fisher FM, Lauer MN, Crocker J, Barnett AH, Kumar S 2002 Increased resistin gene and protein expression in human abdominal adipose tissue. J Clin Endocrinol Metab 87:2407[Abstract/Free Full Text]
  15. Patel L, Buckels AC, Kinghorn IJ, Murdock PR, Holbrook JD, Plumpton C, Macphee CH, Smith SA 2003 Resistin is expressed in human macrophages and directly regulated by PPAR{gamma} activators. Biochem Biophys Res Commun 300:472–476[CrossRef][Medline]
  16. Osawa H, Yamada K, Onuma H, Murakami A, Ochi M, Kawata H, Nishimiya T, Niiya T, Shimizu I, Nishida W, Hashiramoto M, Kanatsuka A, Fujii Y, Ohashi J, Makino H 2004 The G/G genotype of a resistin single-nucleotide polymorphism at –420 increases type 2 diabetes mellitus susceptibility by inducing promoter activity through specific binding of Sp1/3. Am J Hum Genet 75:678–686[CrossRef][Medline]
  17. Fujinami A, Obayashi H, Ohta K, Ichimura T, Nishimura M, Matsui H, Kawahara Y, Yamazaki M, Ogata M, Hasegawa G, Nakamura N, Yoshikawa T, Nakano K, Ohta M 2004 Enzyme-linked immunosorbent assay for circulating human resistin: resistin concentrations in normal subjects and patients with type 2 diabetes. Clin Chim Acta 339:57–63[CrossRef][Medline]
  18. Silha JV, Krsek M, Skrha JV, Sucharda P, Nyomba BL, Murphy LJ 2003 Plasma resistin, adiponectin and leptin levels in lean and obese subjects: correlations with insulin resistance. Eur J Endocrinol 149:331–335[Abstract]
  19. Heilbronn LK, Rood J, Janderova L, Albu JB, Kelley DE, Ravussin E, Smith SR 2004 Relationship between serum resistin concentrations and insulin resistance in nonobese, obese, and obese diabetic subjects. J Clin Endocrinol Metab 89:1844–1848[Abstract/Free Full Text]
  20. Lee JH, Chan JL, Yiannakouris N, Kontogianni M, Estrada E, Seip R, Orlova C, Mantzoros CS 2003 Circulating resistin levels are not associated with obesity or insulin resistance in humans and are not regulated by fasting or leptin administration: cross-sectional and interventional studies in normal, insulin-resistant, and diabetic subjects. J Clin Endocrinol Metab 88:4848–4856[Abstract/Free Full Text]
  21. Mattevi VS, Zembrzuski VM, Hutz MH 2004 A resistin gene polymorphism is associated with body mass index in women. Hum Genet 115:208–212[Medline]
  22. Panidis D, Koliakos G, Kourtis A, Farmakiotis D, Mouslech T, Rousso D 2004 Serum resistin levels in women with polycystic ovary syndrome. Fertil Steril 81:361–366[CrossRef][Medline]
  23. Nogueiras R, Barreiro ML, Caminos JE, Gaytan F, Suominen JS, Navarro VM, Casanueva FF, Aguilar E, Toppari J, Dieguez C, Tena-Sempere M 2004 Novel expression of resistin in rat testis: functional role and regulation by nutritional status and hormonal factors. J Cell Sci 117(Pt 15):3247–3257
  24. Knochenhauer ES, Key TJ, Kahsar-Miller M, Waggoner W, Boots LR, Azziz R 1998 Prevalence of the polycystic ovary syndrome in unselected black and white women of the southeastern United States: a prospective study. J Clin Endocrinol Metab 83:3078–3082[Abstract/Free Full Text]
  25. Howard G, Bergman R, Wagenknecht LE, Haffner SM, Savage PJ, Saad MF, Laws A, D’Agostino Jr RB 1998 Ability of alternative indices of insulin sensitivity to predict cardiovascular risk: comparison with the "minimal model". Insulin Resistance Atherosclerosis Study (IRAS) Investigators. Ann Epidemiol 8:358–369[CrossRef][Medline]
  26. Katz A, Nambi SS, Mather K, Baron AD, Follmann DA, Sullivan G, Quon MJ 2000 Quantitative insulin sensitivity check index: a simple, accurate method for assessing insulin sensitivity in humans. J Clin Endocrinol Metab 85:2402–2410[Abstract/Free Full Text]
  27. Legro RS, Finegood D, Dunaif A 1998 A fasting glucose to insulin ratio is a useful measure of insulin sensitivity in women with polycystic ovary syndrome. J Clin Endocrinol Metab 83:2694–2698[Abstract/Free Full Text]
  28. Chen H, Sullivan G, Yue LQ, Katz A, Quon MJ 2003 QUICKI is a useful index of insulin sensitivity in subjects with hypertension. Am J Physiol Endocrinol Metab. 284:E804–E812
  29. Haffner SM, Miettinen H, Stern MP 1997 The homeostasis model in the San Antonio Heart Study. Diabetes Care 20:1087–1092[Abstract]
  30. Haffner SM, Kennedy E, Gonzalez C, Stern MP, Miettinen H 1996 A prospective analysis of the HOMA model. The Mexico City Diabetes Study. Diabetes Care 19:1138–1141[Abstract]
  31. Munir I, Yen HW, Geller DH, Torbati D, Bierden RM, Weitsman SR, Agarwal SK, Magoffin DA 2004 Insulin augmentation of 17{alpha}-hydroxylase activity is mediated by phosphatidylinositol 3-kinase but not extracellular signal-regulated kinase-1/2 in human ovarian theca cells. Endocrinology 145:175–183[Abstract/Free Full Text]
  32. Jakimiuk AJ, Weitsman SR, Navab A, Magoffin DA 2001 Luteinizing hormone receptor, steroidogenesis acute regulatory protein, and steroidogenic enzyme messenger ribonucleic acids are overexpressed in thecal and granulosa cells from polycystic ovaries. J Clin Endocrinol Metab 86:1318–1323[Abstract/Free Full Text]
  33. Seow KM, Juan CC, Wu LY, Hsu YP, Yang WM, Tsai YL, Hwang JL, Ho LT 2004 Serum and adipocyte resistin in polycystic ovary syndrome with insulin resistance. Hum Reprod 19:48–53[Abstract/Free Full Text]
  34. Degawa-Yamauchi M, Bovenkerk JE, Juliar BE, Watson W, Kerr K, Jones R, Zhu Q, Considine RV 2003 Serum resistin (FIZZ3) protein is increased in obese humans. J Clin Endocrinol Metab 88:5452–5455[Abstract/Free Full Text]
  35. Yannakoulia M, Yiannakouris N, Bluher S, Matalas AL, Klimis-Zacas D, Mantzoros CS 2003 Body fat mass and macronutrient intake in relation to circulating soluble leptin receptor, free leptin index, adiponectin, and resistin concentrations in healthy humans. J Clin Endocrinol Metab 88:1730–1736[Abstract/Free Full Text]
  36. Volarova de Courten B, Degawa-Yamauchi M, Considine RV, Tataranni PA 2004 High serum resistin is associated with an increase in adiposity but not a worsening of insulin resistance in Pima Indians. Diabetes 53:1279–1284[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Hum ReprodHome page
H.F. Escobar-Morreale, G. Villuendas, J.I. Botella-Carretero, F. Alvarez-Blasco, R. Sanchon, M. Luque-Ramirez, and J.L. San Millan
Adiponectin and resistin in PCOS: a clinical, biochemical and molecular genetic study
Hum. Reprod., September 1, 2006; 21(9): 2257 - 2265.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M Mitchell, D T Armstrong, R L Robker, and R J Norman
Adipokines: implications for female fertility and obesity
Reproduction, November 1, 2005; 130(5): 583 - 597.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/8/4852    most recent
Author Manuscript (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Munir, I.
Right arrow Articles by Jakimiuk, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Munir, I.
Right arrow Articles by Jakimiuk, A. J.
Related Collections
Right arrow Female Endocrinology
Right arrow Metabolism

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals