help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-2528
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Related Collections
Right arrow Female Endocrinology
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 8 4710-4715
Copyright © 2005 by The Endocrine Society

Inflammatory Cytokine and Thrombin Regulation of Interleukin-8 and Intercellular Adhesion Molecule-1 Expression in First Trimester Human Decidua

Charles J. Lockwood, Michael Paidas, Graciela Krikun, Louise A. Koopman, Rachael Masch, Edward Kuczynski, Harvey Kliman, Rebecca N. Baergen and Frederick Schatz

Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine (C.J.L., M.P., G.K., E.K., H.K., F.S.), New Haven, Connecticut 06510; Department of Oncology, Biogen, Inc. (L.A.K.), Cambridge, Massachusetts 02142; Department of Obstetrics and Gynecology, New York University School of Medicine (R.M.), New York, New York 10016; and Department of Pathology, Weill Medical College of Cornell University (R.N.B.), New York, New York 10021

Address all correspondence and requests for reprints to: Dr. Frederick Schatz, Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, 333 Cedar Street, Room 335 FMB P.O. Box 208063, New Haven, Connecticut 06510. E-mail: frederick.schatz{at}yale.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Context: Decidual neutrophil infiltration complicates spontaneous abortions associated with inflammation and hemorrhage. Transendothelial neutrophil migration into inflamed tissues involves IL-8-mediated chemoattraction, then neutrophil attachment to endothelial cell-expressed intercellular adhesion molecule-1 (ICAM-1).

Objective: The aim of this study was to assess IL-8 and ICAM-1 regulation in decidual inflammation and hemorrhage; the effects of the proinflammatory cytokines, TNF{alpha}, IL-1ß and the hemostatic, proinflammatory cytokine thrombin were measured on IL-8 expression in first trimester decidual cells (DCs), and ICAM-1 immunostaining was compared in normal, inflamed, and hemorrhagic first trimester decidua.

Design: Immunohistochemistry of human decidua and in vitro treatment of human decidual cells were performed

Setting: The study was conducted at the Academic Medical Center.

Intervention:. DCs were passaged until they were leukocyte-free (CD45 free by FACS), then were incubated with estradiol or medroxyprogesterone acetate alone or with TNF{alpha} or IL-1ß or thrombin. Normal, inflamed, and hemorrhagic decidua were immunostained for ICAM-1 and the neutrophil marker CD14.

Main Outcome Measure: ICAM-1 immunostaining was performed in decidua. IL-8 levels in DC-conditioned media were assessed by ELISA and immunoblotting; IL-8 mRNA levels were measured by quantitative RT-PCR.

Results: Endothelial cell ICAM-1 immunostaining was similar in normal and inflamed or hemorrhagic decidua. In cultured DCs, optimal concentrations of IL-1ß, TNF{alpha}, and thrombin elevated secreted IL-8 levels by 1083 ± 261-, 370 ± 77-, and 45 ± 15-fold, respectively (mean ± SEM; P < 0.05; n = 8). The effects were dose dependent and were unaffected by medroxyprogesterone acetate. Western blotting confirmed the ELISA results, and corresponding effects on IL-8 mRNA levels were observed.

Conclusions: Cytokine/thrombin-enhanced DC IL-8 expression interacts with constitutively expressed ICAM-1 in decidual endothelium to modulate neutrophil trafficking into hemorrhagic and inflamed first trimester decidua.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE HUMAN IMPLANTATION site contains a mixture of interstitial trophoblasts, decidual cells (DCs), and CD45+ leukocytes. Of the latter, the majority are CD56bright natural killer cells, with a significant number of macrophages as well as some T and B lymphocytes and CD1d-restricted natural killer cells (1, 2, 3, 4). In contrast, there is a dearth of neutrophils in early gestational endometrium in the absence of hemorrhage or inflammation associated with miscarriage and septic abortion.

Control of leukocyte trafficking involves the concerted actions of chemokines and adhesion molecules (5). The best studied of these are IL-8, a nonglycosylated, 8-kDa protein member of the C-X-C chemokine subfamily (6), and intercellular adhesion molecule-1 (ICAM-1), a member of the Ig superfamily (7, 8). IL-8-mediated chemotaxis and activation play a primary role in promoting adherence of neutrophils to endothelial cell-expressed ICAM-1 before transendothelial cell migration (5, 6, 7, 8).

Previous reports demonstrated prominent ICAM-1 immunostaining in human endometrial endothelium across the menstrual cycle (9, 10, 11) and in the first trimester of pregnancy (12, 13). Because leukocytes are a rich source of proinflammatory cytokines (3, 5), they can reasonably be expected to enhance the transcription of ICAM-1 via cis-acting elements on the gene promoter (14). Therefore, the current study determined whether the intensity of endothelial cell immunostaining for ICAM-1 is affected by the perivascular proximity of leukocytes.

Recently, we found that IL-8 mRNA and protein levels are inhibited during progestin-induced decidualization of human stromal cells derived from cycling endometrium and that the hemostatic/proinflammatory agent, thrombin, reversed this inhibition (15). The current study extends these observations by evaluating the separate and interactive effects of estradiol (E2), medroxyprogesterone acetate (MPA), thrombin, and the classic proinflammatory cytokines, IL-1ß and TNF{alpha} on IL-8 expression in leukocyte-free, first trimester DCs.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Tissues

Decidual specimens for cell culture were obtained from elective terminations (n = 8) between 6 and 12 wk at Bellevue Hospital (New York, NY) with institutional review board approval. A small portion of each specimen was formalin-fixed and paraffin-embedded, then examined histologically to rule out underlying acute and chronic inflammation. The remainder was used for decidual cell isolation. Additional first trimester specimens for immunohistochemical studies were obtained after elective terminations at Bellevue Hospital (n = 4) and after spontaneous losses associated with inflammation and/or bleeding from the Yale-New Haven Hospital (n = 4) with approval of the respective institutional review board and human investigation committees.

Isolation of first trimester decidual cells

Tissues were minced and digested with 0.1% collagenase type IV as well as 0.01% deoxyribonuclease in RPMI 1640 containing 20 µg/ml penicillin/streptomycin, and 1 µl/ml fungizone (Invitrogen Life Technologies, Inc., Grand Island, NY) in a 37 C shaking water bath for 30 min. After washing with sterile PBS, the digestate was washed three times and subjected to consecutive filtration through 100-, 70-, and 40-µm pore size filters (Millipore Corp., Bedford, MA). Cells were then resuspended in RPMI 1640 and seeded on polystyrene tissue culture dishes. Cells were harvested using trypsin/EDTA and analyzed by flow cytometric analysis with anti-CD45 and anti-CD14 monoclonal antibodies (BD Pharmingen, San Diego, CA) to monitor the presence of leukocytes after each passage. After three or four passages, cell cultures were found to be leukocyte free (<1%). Cell aliquots were then frozen in fetal calf serum/dimethylsulfoxide (9:1; Sigma-Aldrich Corp., St. Louis, MO) and stored in liquid nitrogen.

DC cultures

Thawed cells were incubated in basal medium, a phenol red-free 1:1 (vol/vol) mix of DMEM (Invitrogen Life Technologies, Inc.) and Ham’s F-12 (Flow Laboratories, Rockville, MD), with 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml fungizone that was supplemented with 10% charcoal-stripped calf serum (BMS). After two additional passages, confluent cultures were incubated in parallel in BMS containing either 10–8 mol/liter E2 or E2 plus 10–7 mol/liter medroxyprogesterone acetate (MPA; Sigma-Aldrich Corp.) added in 0.1% ethanol with one change of medium after 4 d. Because circulating levels of progesterone are relatively high during the first trimester compared with the background level of E2, the latter was used as the control incubation for evaluating the effects of the progestin, MPA. After 7 d, the cultures were washed twice with HBSS, then switched to a defined medium (DM) consisting of BM plus ITS+ (Collaborative Research, Waltham, MA), 5 µM FeSO4, 50 µM ZnSO4, 1 nM CuSO4, 20 nM Na2SeO3, trace elements (Invitrogen Life Technologies, Inc.), 50 µg/ml ascorbic acid (Sigma-Aldrich Corp.), and 50 ng/ml epidermal growth factor (BD Biosciences, Bedford, MA). Experimental incubations were carried out in DM supplemented with steroid(s) added with or without thrombin (American Diagnostica, Greenwich, CT) or IL-1ß or TNF{alpha} (R&D Systems, Inc., Minneapolis, MN). After the experimental test period, the harvested cell pellets were extracted in ice-cold lysis buffer. Cell lysates and conditioned DM supernatants were stored at –70 C. In parallel incubations, total RNA was extracted from cultured decidual cells with Tri-Reagent (Sigma-Aldrich Corp.).

Biochemical assay

Immunoreactive IL-8 was measured in conditioned medium by ELISA (R&D Systems, Inc.). The ELISA has a sensitivity of 3.5 pg/ml and intra- and interassay coefficients of variation of 4.6% and 6.7%, respectively. The protein content of the cell lysates was determined by the Bio-Rad assay (Bio-Rad Laboratories, Inc., Hercules, CA). Western blot analysis was carried out on supernatants of conditioned DM subjected to electrophoresis on a 10–20% sodium dodecyl sulfate-polyacrylamide linear gradient gel (Bio-Rad Laboratories, Inc.). The gel was electroblotted onto a 0.2-µm pore size nitrocellulose membrane (Bio-Rad Laboratories, Inc.). After transfer, the membrane was blocked overnight in PBS (Sigma-Aldrich Corp.) with 1% casein and then incubated for 2 h with a 1:333 dilution of a mouse antihuman IL-8 monoclonal antibody (R&D Systems, Inc.). Membranes were rinsed in PBS and 0.2% Tween 20 before and after incubation with horseradish peroxidase-conjugated antimouse IgG (ICN Biomedicals, Aurora, OH). Chemiluminescence was detected with enhanced chemiluminescence reagents (PerkinElmer Life Sciences, Boston, MA) and audioradiography film (Amersham Biosciences, Little Chalfont, UK) according to the manufacturer’s instructions.

Real-time quantitative RT-PCR

To verify that the IL-8 and ß-actin probes yielded the correct bands, extracted RNA from experimental cell incubations were subjected to semiquantitative RT-PCR using a kit from Invitrogen Life Technologies, Inc. (Carlsbad, CA), carrying out 35 cycles with the Eppendorf MasterCycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, RT was initially carried out with avian myeloblastosis virus reverse transcriptase (Invitrogen Life Technologies, Inc.) according to the manufacturer’s recommendations using oligo(deoxythymidine) primers, also supplied by that company. A quantitative standard curve was created between 500 pg and 250 ng cDNA with a Light Cycler (Roche, Indianapolis, IN) by monitoring the increasing fluorescence of PCR products during amplification. Upon establishing the standard curve, quantitation of the unknowns was determined with the Roche Light Cycler and adjusted to the quantitative expression of ß-actin from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The following primers were synthesized and gel-purified at the Yale DNA Synthesis Laboratory, Critical Technologies (abbreviated sense, 5' to 3'; antisense, 5' to 3'): ß-actin, CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG (452 bp); and IL-8, GACAAGAGCCAGGAAGAAAC CTACAACAGACCCACACAATAC (459 bp).

Immunohistochemistry (IHC)

Decidual specimens were fixed in 4% paraformaldehyde and embedded in paraffin. Four-micrometer sections were deparaffinized, rehydrated, and washed in Tris-buffered saline (20 mmol/liter Tris-HCl and 150 mmol/liter NaCl, pH 7.6), which was used for all washes and for dilution of the antibodies. Antigen retrieval was carried out by incubating sections in Target Retrieval Solution (DakoCytomation, Carpinteria, CA) in a 95–99 C water bath for 30 min. The sections were then rinsed in 3% hydrogen peroxide to block endogenous peroxidase and incubated for 1 h at room temperature with either a goat polyclonal ICAM-1 (CD54) antibody (R&D Systems, Inc.) or a monoclonal antibody to the platelet endothelial cell adhesion molecule (PECAM; CD31; DakoCytomation). This specific endothelial cell antigen marker was used to confirm localization of ICAM to endothelial cells. Neutrophils were detected with a mouse monoclonal anti-CD15 (granulocyte) antibody (Zymed Laboratories, South San Francisco, CA). Staining was visualized using the avidin-biotin peroxidase complex (Vectastain ABC kit, Vector Laboratories, Inc., Burlingame, CA) and the 3,3'-diaminobenzidine tetrahydrochloride (Sigma-Aldrich Corp.) chromogen substrate. Hematoxylin was used for counterstaining. Negative controls for each tissue section consisted of substituting the corresponding preimmune serum for the primary antibody.

Statistical analysis

Statistical analyses included the Kruskal-Wallis ANOVA on ranks with the Student-Newman-Keuls post hoc test for pairwise comparisons or by t test, with P < 0.05 considered significant. Experimental results are presented as the mean ± SEM. The intensity of ICAM-1 and PECAM staining was evaluated by a semiquantitative four-point rating scale ranging from 0 for least staining to 3 for maximum intensity of staining. To determine the interrater reliability of this scale, two independent judges scored a series of 35 separate fields on slides from four separate patient samples. The degree of concordance was then assessed by use of Cohen’s {kappa}. The value for ICAM-1 was 0.6, and the corresponding value for PECAM was 0.57, indicating good agreement between the judges in assessing immunostaining for both endothelial cell-specific markers (16).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Immunoreactive ICAM-1 levels in first trimester decidua

Figure 1Go demonstrates prominent immunostaining for ICAM-1 in the endothelium of first trimester decidua. That decidual endothelial cell ICAM-1 expression is constitutive is suggested by similar staining intensity in the vessels in normal decidua (Fig. 1AGo) compared with that in decidua displaying infiltration of leukocytes (Fig. 1BGo). Figure 1CGo indicates that immunostaining for the endothelial cell-specific marker PECAM (CD31) is comparable to that of ICAM-1 in both intensity and specificity for endothelial cells.



View larger version (81K):
[in this window]
[in a new window]
  		FIG. 1. Immunostaining for ICAM-1 and CD31 in first trimester decidua. IHC staining for ICAM-1 is prominent and of equal intensity in the decidual endothelium from a normal pregnancy (A) vs. a pregnancy complicated by inflammation (B). IHC staining for the endothelial cell-specific surface marker, CD31, is shown for comparison with ICAM-1 (C). Magnification, x400. White arrow, vessel; G, gland; red arrow, lymphocyte; blue-green arrow, neutrophil.

 
Constitutive endothelial cell-expressed ICAM-1 was also confirmed in spontaneous first trimester abortion specimens. These display areas of hemorrhagic, acutely inflamed, regressing decidua, which are frequently complicated by a marked influx of neutrophils. Figure 2Go displays serial sections immunostained for either ICAM-1 (left panels) or the neutrophil-specific marker, CD15 (right panels). In Fig. 2AGo, the area delineated by the larger box in the right panel includes a cluster of spiral arterioles intermingled with relatively sparse neutrophils, whereas the smaller box in the right panel shows a venule surrounded by neutrophils. Figure 2BGo depicts magnified views of the boxes delineated in Fig. 2AGo. Specifically, the upper panels refer to the larger boxes, and the lower panel refers to the smaller boxes stained for either ICAM-1 (left panels) or CD15 (right panels), respectively. Although the venule is surrounded by neutrophils (lower right panel), the intensity of ICAM-1 staining in the endothelium (lower left panel) was no greater than that in the endothelium of the arterioles (upper right panel), with relatively few neutrophils in close proximity. Moreover, within the cluster of arterioles, no difference in endothelial cell staining intensity for ICAM-1 is evident when comparing vessels devoid of surrounding neutrophils (yellow arrows) with a vessel in close proximity to some neutrophils (red arrow) or in a vessel containing an intraluminal neutrophil (green arrow). Other areas also contained venules exhibiting ICAM-1 staining of similar intensity to the venule depicted in Fig. 2BGo, but were relatively devoid of surrounding neutrophils (not shown). Additional confirmation that the intensity of ICAM-1 and PECAM immunostaining in the endothelium of these decidual specimens is unaffected by the vascular proximity of neutrophils was confirmed by observations made by two independent observers who were in good agreement in their scoring values, as indicated by Cohen’s {kappa} values of 0.67 and 0.57 for ICAM-1 and PECAM, respectively (see Materials and Methods for details).



View larger version (125K):
[in this window]
[in a new window]
  		FIG. 2. Immunostaining for ICAM-1 and CD15 in serial sections of acutely inflamed regressing first trimester decidua. A, Left panel, Immunostaining for ICAM-1 (low magnification). The vascular endothelium displays prominent and ubiquitous immunostaining, whereas the highly decidualized stroma is negative. Magnification, x200. Right panel, Immunostaining for CD15 (low magnification). The large box contains spiral arterioles with relatively few CD15+ cells. The small box contains a venule surrounded by CD15+ cells. Magnification, x200. B, Left panel, Immunostaining for ICAM-1 (high magnification). The upper panel is derived from the large box in A; the lower panel is derived from the small box in A. Magnification, x400. Right panel, Immunostaining for CD 15 (high magnification). The upper panel is derived from the large box in A; the lower panel is derived from the small box in A. Magnification, x400. Yellow arrows, Vessels devoid of surrounding neutrophils; red arrows, vessel in close proximity to some neutrophils; green arrows, vessel containing an intraluminal neutrophil.

 
IL-8 protein expression in cultured DCs

Figure 3Go indicates that in monolayers of first trimester decidual cells, E2 and MPA did not significantly enhance IL-8 output compared with E2 alone, whereas the addition of thrombin (2.5 U/ml) resulted in statistically significant increases in IL-8 output under both steroid treatments. Evaluating the results as net fold changes revealed that the addition of thrombin increased IL-8 expression by 35.3 ± 14.5-fold in E2-treated cultures and by 43.5 ± 14.3-fold in E2- plus MPA-treated cultures (n = 8; P < 0.05).



View larger version (6K):
[in this window]
[in a new window]
  		FIG. 3. Effects of E2, MPA, and thrombin (Th) on IL-8 output by DC monolayers. Confluent, passaged, leukocyte-free DCs were incubated for 7 d in 10–8 mol/liter E2 or E2 plus 10–7 mol/liter MPA, then switched to DM with the corresponding steroid(s) with or without 2.5 U/ml thrombin for 24 h. IL-8 levels were measured by ELISA in conditioned DM and normalized to cell protein [n = 8 separate patient specimens; by Kruskal-Wallis ANOVA on ranks with Student-Newman-Keuls post hoc test, P < 0.05 (*, vs. E2; **, vs. E2 plus MPA)].

 
Circulating levels of E2 and progesterone are high during the first trimester. Therefore, in Fig. 4Go, the concentration effects of thrombin, TNF{alpha}, and IL-1ß were evaluated on DCs that were primed with and then maintained in E2 and MPA. Dose-response effects on IL-8 output are shown for thrombin between 0.1 and 2.5 U/ml (Fig. 4AGo) and for TNF{alpha} and IL-1ß from 0.01–10.0 ng/ml (Fig. 4BGo). When each agonist was added at the optimal concentration, Fig. 4CGo indicates that a clear order of potency was evident, with IL-ß > TNF{alpha} > thrombin. Specifically, IL-1ß and TNF{alpha} increased IL-8 levels by 1083 ± 261- and 370 ± 77-fold, respectively (n = 8; P < 0.05), whereas the hemostatic agent, thrombin, increased IL-8 levels by 45 ± 15-fold (P < 0.05).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. Effects of thrombin (Th), IL-1ß, and TNF-{alpha} on IL-8 output by E2- plus MPA-treated DC monolayers. Confluent, passaged, leukocyte-free DCs were incubated for 7 d in 10–8 mol/liter E2 and 10–7 mol/liter MPA, then switched to DM with E2 plus 10–7 mol/liter MPA alone or with thrombin, IL-1ß, or TNF-{alpha} for 24 h. IL-8 levels were measured by ELISA in conditioned DM and normalized to cell protein. A, Dose-response effects of thrombin added in the presence of E2 plus MPA (control). Values are the mean ± SEM [n = 8 separate patient specimens; P < 0.05 (*, vs. E2 plus MPA; **, vs. E2, MPA, and 0.1 U/ml thrombin)]. B, Dose-response effects of TNF-{alpha} and IL-1ß in the presence of E2 and MPA (control; mean ± SD from duplicate dishes; n = 2 separate patient specimens). C, Effects of thrombin (2.5 U/ml), TNF-{alpha} (10 ng/ml), and IL-1ß [10 ng/ml; mean ± SEM; n = 8 separate patient specimens; by Kruskal-Wallis ANOVA on ranks with Student-Newman-Keuls post hoc test, P < 0.05 for all (*, vs. E2 plus MPA; **, vs. E2, MPA, and thrombin; ***, vs. E2, MPA, and TNF-{alpha})].

 
Western blot analysis of conditioned medium validated the ELISA results by revealing the presence of a single band at the molecular weight of IL-8 for incubations of DCs with thrombin, TNF{alpha}, or IL-1ß (Fig. 5Go).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 5. Western blot of effects of thrombin (Th), IL-1ß, and TNF-{alpha} on IL-8 output by E2- plus MPA-treated DC monolayers. Confluent, passaged, leukocyte-free DCs were incubated for 7 d in 10–8 mol/liter E2 and 10–7 mol/liter MPA. The medium was exchanged for DM with E2 and MPA alone or with thrombin, IL-1ß, or TNF-{alpha} for 24 h of incubation. Unconcentrated, conditioned DM was subjected to Western blotting (see Materials and Methods).

 
IL-8 mRNA expression in cultured DCs

Figure 6Go depicts levels of IL-8 mRNA, as measured by quantitative RT-PCR, in parallel cultures of first trimester DCs primed with E2 or E2 plus MPA, then maintained in the steroids alone or together with thrombin, TNF{alpha}, or IL-1ß. The results are plotted on a log scale and normalized for ß-actin mRNA. They indicate that, as is the case with secreted IL-8 protein levels, IL-1ß produced the largest increase in steady-state IL-8 mRNA levels, followed by TNF{alpha} and then thrombin.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 6. Quantitative RT-PCR of effects of thrombin (Th), IL-1ß, and TNF-{alpha} on IL-8 mRNA levels by E2- and E2- plus MPA-treated DC monolayers. Confluent, passaged, leukocyte-free DCs were incubated for 7 d in 10–8 mol/liter E2 or E2 plus 10–7 mol/liter MPA, then switched to DM with corresponding steroids alone or with thrombin, IL-1ß, or TNF-{alpha} for 5 h [n = 4 separate patient specimens; by t test, P < 0.05 for all (*, vs. E2; **, vs. E2 plus MPA)]. The ordinate shows the log plot of IL-8 mRNA/ß actin mRNA.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Circulating neutrophils migrate down an IL-8 gradient toward the endothelium. Endothelial cell-expressed ICAM-1 acts in concert with selectins and integrins to mediate neutrophil rolling and adhesion before transendothelial migration (8). IL-8 exerts several effects on neutrophils that are mediated by two heptahelical receptors coupled to GTP-binding proteins (17). These effects include shape change, chemoattraction, enhanced expression of adhesion molecules, and respiratory burst (5, 18).

The current study confirms a report on the decidua of uncomplicated pregnancies that demonstrated prominent endothelial cell ICAM-1 staining in all vessel types and weak staining in the stroma and glands that was essentially negative (12), and extends this work to show that ICAM-1 is constitutively expressed in the endothelium of inflammation-complicated decidua. This conclusion is underscored by the immunostaining results obtained for hemorrhagic, acutely inflamed, regressing gestational endometrium. In these specimens, similar immunoreactive ICAM-1 levels were observed in the endothelium of blood vessels regardless of whether they were enveloped by or were completely free of surrounding leukocytes. In cultured endothelial cells, transcription of the ICAM-1 gene can be regulated by leukocyte-derived cytokines (19, 20). Our observation that ICAM-1 is constitutively expressed in the endothelial cells of first trimester human decidua suggests that factors such as cell-cell or cell-matrix interactions may inhibit cytokine responses in vivo.

Although the promoter region of the ICAM-1 and IL-8 genes predicts responsiveness to proinflammatory stimuli, regulation of ICAM-1 and IL-8 gene expression has been shown to depend on both tissue and cell type as well as the nature of the inflammatory stimulus. For example, the potent oxidative stress initiator, H2O2, induces IL-8, but not ICAM-1, in epithelial cells. Conversely, H2O2 induces ICAM-1 in endothelial cells, whereas IL-8 is constitutively expressed in these cells. However, TNF{alpha}, whose proinflammatory activity depends on reactive oxygen species formation, induces IL-8 and ICAM-1 in both endothelial and epithelial cells (reviewed in Ref.14).

Previously, we showed that IL-8 expression is markedly inhibited during progestin-induced decidualization of stromal cells from cycling endometrium (15). By comparison, the current study indicates that progestin elicited a small, nonsignificant increase in IL-8 expression in leukocyte-free, passaged, first trimester DC cultures. Unlike this marginal response to progestin, the classic proinflammatory cytokines, IL-1ß and TNF{alpha}, and the hemostatic agent, thrombin, up-regulated IL-8 protein expression in cultured DCs 45- to 1000-fold. Extrapolation of this striking up-regulation in IL-8 expression in vitro to gestational decidua in vivo may account for the ineffectiveness of high levels of endogenous or exogenous gestational progesterone to impede neutrophil infiltration in association with hemorrhagic and inflammatory abortions. Interestingly, IL-8 levels in products of conception were found to increase in association with the occurrence of spontaneous compared with elective abortions (21). The absence of a significant progestin effect on IL-8 expression in cultured DCs does not reflect a general loss in progestin responsiveness by these cultures, because progestin markedly up-regulates the expression of type 1 plasminogen activator inhibitor and down-regulates that of matrix metallproteinase-1 (22, 23).

In summary, the results presented in this study suggest that the interactive effects of constitutive endothelial cell ICAM-1 and rapid alterations in DC-derived IL-8 output in response to T helper cell type 1 cytokines and excess thrombin generation promote infiltration of neutrophils into the decidua. Our findings suggest a mechanism by which aberrant T helper cell type 1 cytokine expression and thrombophilia-induced thrombin generation mediate spontaneous abortions associated with hemorrhage or inflammation (24, 25, 26, 27).


   Footnotes
 
This work was supported by National Institutes of Health Grants 2-R01-HD-33937-03 (to C.J.L.) and 1-R01-HL-070004-02 (to C.J.L.).

First Published Online May 24, 2005

Abbreviations: DC, Decidual cell; DM, defined medium; E2, estradiol; ICAM-1, intercellular adhesion molecule-1; IHC, immunohistochemistry; MPA, medroxyprogesterone acetate; PECAM, platelet endothelial cell adhesion molecule.

Received December 23, 2004.

Accepted May 13, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bulmer JN, Morrison L, Longfellow M, Ritson A, Pace D 1991 Granulated lymphocytes in human endometrium: histochemical and immunohistochemical studies. Hum Reprod 6:791–798[Abstract/Free Full Text]
  2. Boyson JE, Rybalov B, Koopman LA, Exley M, Balk SP, Racke FK, Schatz F, Masch R, Wilson SB, Strominger JL 2002 CD1d and invariant NKT cells at the human maternal-fetal interface. Proc Natl Acad Sci USA 99:13741–13746[Abstract/Free Full Text]
  3. Salamonsen LA, Wooley DE 1999 Menstruation: induction by matrix metalloproteinases and inflammatory cells. J Reprod Immunol 44:1–27[CrossRef][Medline]
  4. Moffett-King A 2002 Natural killer cells and pregnancy. Nat Rev Immunol 2:656–663[CrossRef][Medline]
  5. Springer TA 1994 Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301–314[CrossRef][Medline]
  6. Baggiolini M 1988 Chemokines and leukocyte traffic. Nature 392:565–568
  7. Dustin ML, Springer TA 1988 The leukocyte function-associated antigen-1 (LFA-1) interaction with intercellular adhesion molecule-1 (ICAM-1) is one of at least three mechanisms for lymphocyte adhesion to cultured endothelial cells. J Cell Biol 107:321–331[Abstract/Free Full Text]
  8. Issekutz AC, Rowter D, Springer TA 1999 Role of ICAM-1 and ICAM-2 and alternate CD11/CD18 ligands in neutrophil transendothelial migration. J Leukocyte Biol 65:117–126[Abstract]
  9. Tabibzadeh SS, Poubourdis D 1990 Expression of leukocyte adhesion molecules in human endometrium. Am J Clin Pathol 93:183–189[Medline]
  10. Tawia SA, Beaton LA, Rogers PAW 1993 Immunolocalization of the cellular adhesion molecules, intercellular adhesion molecule-1 (ICAM-1) and platelet adhesion molecule (PECAM), in human endometrium throughout the menstrual cycle. Hum Reprod 8:175–181[Abstract/Free Full Text]
  11. Thomson AJ, Greer MR, Young A, Boswell F, Telfer JF, Cameron IT, Norman JE, Campbell S 1999 Expression of intercellular adhesion molecules ICAM-1 and ICAM-2 in human endometrium throughout the menstrual cycle. Mol Hum Reprod 5:64–70[Abstract/Free Full Text]
  12. Ruck P, Marzusch K, Kaiserling E, Horny HP, Dietl J, Geiselhart A, Handgretinger R, Redman CW 1994 Distribution of cell adhesion molecules in decidua of early human pregnancy: an immunohistochemical study. Lab Invest 71:94–101[Medline]
  13. Jaakkola K, Jokimaa V, Kallajoki M, Jalkanen S, Ekholm E 2000 Pre-eclampsia does not change the adhesion molecule status in the placental bed. Placenta 21:133–141[CrossRef][Medline]
  14. Roebuck KA 1999 Oxidative stress regulation of IL-8 and ICAM-1 gene expression: differential activation and binding of the transcription factors AP-1 and NF{kappa}B. Int J Mol Med 3:223–230 (Review)
  15. Lockwood CJ, Kumar P, Krikun G, Kadner S, Dubon P, Critchley H, Schatz F 2004 Effects of thrombin, hypoxia, and steroids on interleukin-8 expression in decidualized human endometrial stromal cells: implications for long-term progestin-only contraceptive-induced bleeding. J Clin Endocrinol Metab 89:1467–1475[Abstract/Free Full Text]
  16. Altman DG 1991 Inter-rater agreement. In: Altman DG, ed. Practical statistics for medical research. London: Chapman Hall/CRC; 403–409
  17. Wu D, Larosa GJ, Simon MI 1993 G Protein-coupled signal transduction pathways for interleukin-8. Science 261:101–103[Abstract/Free Full Text]
  18. Ben-Baruch A, Bengali K M, Biragyn A, Johnston JJ, Wang J-M, Kim J, Chuntharapai A, Michiel DF, Oppenheim JJ, Kelvin DJ 1995 Interleukin-8 receptor ß. The role of the carboxyl terminus in signal transduction. J Biol Chem 270:9121–9128[Abstract/Free Full Text]
  19. Jiang H, Williams GJ, Dhib-Jalbut S 1997 The effect of interferon ß-1b on cytokine-induced adhesion molecule expression. Neurochem Int 30:449–453[CrossRef][Medline]
  20. Simiantonaki N, Jayasinghe C, Kirkpatrick CJ 2002 Effect of pro-inflammatory stimuli on tumor cell-mediated induction of endothelial cell adhesion molecules in vitro. Exp Mol Pathol 73:46–53[CrossRef][Medline]
  21. Madhappan B, Kempuraj D, Christodoulou S, Tsapikidis S, Boucher W, Karagiannis V, Athanassiou A, Theoharides TC 2003 Jun High levels of intrauterine corticotropin-releasing hormone, urocortin, tryptase, and interleukin-8 in spontaneous abortions. Endocrinology 144:2285–2290[Abstract/Free Full Text]
  22. Schatz F, Lockwood CJ 1993 Progestin regulation of plasminogen activator inhibitor type 1 in primary cultures of endometrial stromal and decidual cells. J Clin Endocrinol Metab 77:621–625[Abstract]
  23. Schatz F, Papp C, Toth-Pal E, Lockwood CJ 1994 Ovarian steroid-modulated stromelysin-1 expression in human endometrial stromal and decidual cells. J Clin Endocrinol Metab 78:1467–1472[Abstract]
  24. Hill JA, Polgar K, Anderson DJ 1995 T-helper 1-type immunity to trophoblast in women with recurrent spontaneous abortion. JAMA 273:1933–1936[Abstract/Free Full Text]
  25. Hill JA, Choi BC 2000 Maternal immunological aspects of pregnancy success and failure. J Reprod Fertil 55(Suppl):91–97
  26. Clark DA, Yu G, Levy GA, Gorczynski RM 2001 Procoagulants in fetus rejection: the role of the OX-2 (CD200) tolerance signal. Semin Immunol 13:255–263[CrossRef][Medline]
  27. Roque H, Paidas MJ, Funai EF, Kuczynski E, Lockwood CJ 2004 Maternal thrombophilias are not associated with early pregnancy loss. Thromb Haemost 91:290–295[Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
S.-U. Chen, H. Lee, D.-Y. Chang, C.-H. Chou, C.-Y. Chang, K.-H. Chao, C.-W. Lin, and Y.-S. Yang
Lysophosphatidic Acid Mediates Interleukin-8 Expression in Human Endometrial Stromal Cells through Its Receptor and Nuclear Factor-{kappa}B-Dependent Pathway: A Possible Role in Angiogenesis of Endometrium and Placenta
Endocrinology, November 1, 2008; 149(11): 5888 - 5896.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
C. J. Lockwood, P. Toti, F. Arcuri, E. Norwitz, E. F. Funai, S.-T. J. Huang, L. F. Buchwalder, G. Krikun, and F. Schatz
Thrombin Regulates Soluble fms-Like Tyrosine Kinase-1 (sFlt-1) Expression in First Trimester Decidua: Implications for Preeclampsia
Am. J. Pathol., April 1, 2007; 170(4): 1398 - 1405.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A.P. Hess, A.E. Hamilton, S. Talbi, C. Dosiou, M. Nyegaard, N. Nayak, O. Genbecev-Krtolica, P. Mavrogianis, K. Ferrer, J. Kruessel, et al.
Decidual Stromal Cell Response to Paracrine Signals from the Trophoblast: Amplification of Immune and Angiogenic Modulators
Biol Reprod, January 1, 2007; 76(1): 102 - 117.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockwood, C. J.
Right arrow Articles by Schatz, F.
Related Collections
Right arrow Female Endocrinology

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals