| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine (C.J.L., M.P., G.K., E.K., H.K., F.S.), New Haven, Connecticut 06510; Department of Oncology, Biogen, Inc. (L.A.K.), Cambridge, Massachusetts 02142; Department of Obstetrics and Gynecology, New York University School of Medicine (R.M.), New York, New York 10016; and Department of Pathology, Weill Medical College of Cornell University (R.N.B.), New York, New York 10021
Address all correspondence and requests for reprints to: Dr. Frederick Schatz, Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, 333 Cedar Street, Room 335 FMB P.O. Box 208063, New Haven, Connecticut 06510. E-mail: frederick.schatz{at}yale.edu.
| Abstract |
|---|
|
|
|---|
Objective: The aim of this study was to assess IL-8 and ICAM-1 regulation in decidual inflammation and hemorrhage; the effects of the proinflammatory cytokines, TNF
, IL-1ß and the hemostatic, proinflammatory cytokine thrombin were measured on IL-8 expression in first trimester decidual cells (DCs), and ICAM-1 immunostaining was compared in normal, inflamed, and hemorrhagic first trimester decidua.
Design: Immunohistochemistry of human decidua and in vitro treatment of human decidual cells were performed
Setting: The study was conducted at the Academic Medical Center.
Intervention:. DCs were passaged until they were leukocyte-free (CD45 free by FACS), then were incubated with estradiol or medroxyprogesterone acetate alone or with TNF
or IL-1ß or thrombin. Normal, inflamed, and hemorrhagic decidua were immunostained for ICAM-1 and the neutrophil marker CD14.
Main Outcome Measure: ICAM-1 immunostaining was performed in decidua. IL-8 levels in DC-conditioned media were assessed by ELISA and immunoblotting; IL-8 mRNA levels were measured by quantitative RT-PCR.
Results: Endothelial cell ICAM-1 immunostaining was similar in normal and inflamed or hemorrhagic decidua. In cultured DCs, optimal concentrations of IL-1ß, TNF
, and thrombin elevated secreted IL-8 levels by 1083 ± 261-, 370 ± 77-, and 45 ± 15-fold, respectively (mean ± SEM; P < 0.05; n = 8). The effects were dose dependent and were unaffected by medroxyprogesterone acetate. Western blotting confirmed the ELISA results, and corresponding effects on IL-8 mRNA levels were observed.
Conclusions: Cytokine/thrombin-enhanced DC IL-8 expression interacts with constitutively expressed ICAM-1 in decidual endothelium to modulate neutrophil trafficking into hemorrhagic and inflamed first trimester decidua.
| Introduction |
|---|
|
|
|---|
Control of leukocyte trafficking involves the concerted actions of chemokines and adhesion molecules (5). The best studied of these are IL-8, a nonglycosylated, 8-kDa protein member of the C-X-C chemokine subfamily (6), and intercellular adhesion molecule-1 (ICAM-1), a member of the Ig superfamily (7, 8). IL-8-mediated chemotaxis and activation play a primary role in promoting adherence of neutrophils to endothelial cell-expressed ICAM-1 before transendothelial cell migration (5, 6, 7, 8).
Previous reports demonstrated prominent ICAM-1 immunostaining in human endometrial endothelium across the menstrual cycle (9, 10, 11) and in the first trimester of pregnancy (12, 13). Because leukocytes are a rich source of proinflammatory cytokines (3, 5), they can reasonably be expected to enhance the transcription of ICAM-1 via cis-acting elements on the gene promoter (14). Therefore, the current study determined whether the intensity of endothelial cell immunostaining for ICAM-1 is affected by the perivascular proximity of leukocytes.
Recently, we found that IL-8 mRNA and protein levels are inhibited during progestin-induced decidualization of human stromal cells derived from cycling endometrium and that the hemostatic/proinflammatory agent, thrombin, reversed this inhibition (15). The current study extends these observations by evaluating the separate and interactive effects of estradiol (E2), medroxyprogesterone acetate (MPA), thrombin, and the classic proinflammatory cytokines, IL-1ß and TNF
on IL-8 expression in leukocyte-free, first trimester DCs.
| Materials and Methods |
|---|
|
|
|---|
Decidual specimens for cell culture were obtained from elective terminations (n = 8) between 6 and 12 wk at Bellevue Hospital (New York, NY) with institutional review board approval. A small portion of each specimen was formalin-fixed and paraffin-embedded, then examined histologically to rule out underlying acute and chronic inflammation. The remainder was used for decidual cell isolation. Additional first trimester specimens for immunohistochemical studies were obtained after elective terminations at Bellevue Hospital (n = 4) and after spontaneous losses associated with inflammation and/or bleeding from the Yale-New Haven Hospital (n = 4) with approval of the respective institutional review board and human investigation committees.
Isolation of first trimester decidual cells
Tissues were minced and digested with 0.1% collagenase type IV as well as 0.01% deoxyribonuclease in RPMI 1640 containing 20 µg/ml penicillin/streptomycin, and 1 µl/ml fungizone (Invitrogen Life Technologies, Inc., Grand Island, NY) in a 37 C shaking water bath for 30 min. After washing with sterile PBS, the digestate was washed three times and subjected to consecutive filtration through 100-, 70-, and 40-µm pore size filters (Millipore Corp., Bedford, MA). Cells were then resuspended in RPMI 1640 and seeded on polystyrene tissue culture dishes. Cells were harvested using trypsin/EDTA and analyzed by flow cytometric analysis with anti-CD45 and anti-CD14 monoclonal antibodies (BD Pharmingen, San Diego, CA) to monitor the presence of leukocytes after each passage. After three or four passages, cell cultures were found to be leukocyte free (<1%). Cell aliquots were then frozen in fetal calf serum/dimethylsulfoxide (9:1; Sigma-Aldrich Corp., St. Louis, MO) and stored in liquid nitrogen.
DC cultures
Thawed cells were incubated in basal medium, a phenol red-free 1:1 (vol/vol) mix of DMEM (Invitrogen Life Technologies, Inc.) and Hams F-12 (Flow Laboratories, Rockville, MD), with 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml fungizone that was supplemented with 10% charcoal-stripped calf serum (BMS). After two additional passages, confluent cultures were incubated in parallel in BMS containing either 108 mol/liter E2 or E2 plus 107 mol/liter medroxyprogesterone acetate (MPA; Sigma-Aldrich Corp.) added in 0.1% ethanol with one change of medium after 4 d. Because circulating levels of progesterone are relatively high during the first trimester compared with the background level of E2, the latter was used as the control incubation for evaluating the effects of the progestin, MPA. After 7 d, the cultures were washed twice with HBSS, then switched to a defined medium (DM) consisting of BM plus ITS+ (Collaborative Research, Waltham, MA), 5 µM FeSO4, 50 µM ZnSO4, 1 nM CuSO4, 20 nM Na2SeO3, trace elements (Invitrogen Life Technologies, Inc.), 50 µg/ml ascorbic acid (Sigma-Aldrich Corp.), and 50 ng/ml epidermal growth factor (BD Biosciences, Bedford, MA). Experimental incubations were carried out in DM supplemented with steroid(s) added with or without thrombin (American Diagnostica, Greenwich, CT) or IL-1ß or TNF
(R&D Systems, Inc., Minneapolis, MN). After the experimental test period, the harvested cell pellets were extracted in ice-cold lysis buffer. Cell lysates and conditioned DM supernatants were stored at 70 C. In parallel incubations, total RNA was extracted from cultured decidual cells with Tri-Reagent (Sigma-Aldrich Corp.).
Biochemical assay
Immunoreactive IL-8 was measured in conditioned medium by ELISA (R&D Systems, Inc.). The ELISA has a sensitivity of 3.5 pg/ml and intra- and interassay coefficients of variation of 4.6% and 6.7%, respectively. The protein content of the cell lysates was determined by the Bio-Rad assay (Bio-Rad Laboratories, Inc., Hercules, CA). Western blot analysis was carried out on supernatants of conditioned DM subjected to electrophoresis on a 1020% sodium dodecyl sulfate-polyacrylamide linear gradient gel (Bio-Rad Laboratories, Inc.). The gel was electroblotted onto a 0.2-µm pore size nitrocellulose membrane (Bio-Rad Laboratories, Inc.). After transfer, the membrane was blocked overnight in PBS (Sigma-Aldrich Corp.) with 1% casein and then incubated for 2 h with a 1:333 dilution of a mouse antihuman IL-8 monoclonal antibody (R&D Systems, Inc.). Membranes were rinsed in PBS and 0.2% Tween 20 before and after incubation with horseradish peroxidase-conjugated antimouse IgG (ICN Biomedicals, Aurora, OH). Chemiluminescence was detected with enhanced chemiluminescence reagents (PerkinElmer Life Sciences, Boston, MA) and audioradiography film (Amersham Biosciences, Little Chalfont, UK) according to the manufacturers instructions.
Real-time quantitative RT-PCR
To verify that the IL-8 and ß-actin probes yielded the correct bands, extracted RNA from experimental cell incubations were subjected to semiquantitative RT-PCR using a kit from Invitrogen Life Technologies, Inc. (Carlsbad, CA), carrying out 35 cycles with the Eppendorf MasterCycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, RT was initially carried out with avian myeloblastosis virus reverse transcriptase (Invitrogen Life Technologies, Inc.) according to the manufacturers recommendations using oligo(deoxythymidine) primers, also supplied by that company. A quantitative standard curve was created between 500 pg and 250 ng cDNA with a Light Cycler (Roche, Indianapolis, IN) by monitoring the increasing fluorescence of PCR products during amplification. Upon establishing the standard curve, quantitation of the unknowns was determined with the Roche Light Cycler and adjusted to the quantitative expression of ß-actin from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The following primers were synthesized and gel-purified at the Yale DNA Synthesis Laboratory, Critical Technologies (abbreviated sense, 5' to 3'; antisense, 5' to 3'): ß-actin, CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG (452 bp); and IL-8, GACAAGAGCCAGGAAGAAAC CTACAACAGACCCACACAATAC (459 bp).
Immunohistochemistry (IHC)
Decidual specimens were fixed in 4% paraformaldehyde and embedded in paraffin. Four-micrometer sections were deparaffinized, rehydrated, and washed in Tris-buffered saline (20 mmol/liter Tris-HCl and 150 mmol/liter NaCl, pH 7.6), which was used for all washes and for dilution of the antibodies. Antigen retrieval was carried out by incubating sections in Target Retrieval Solution (DakoCytomation, Carpinteria, CA) in a 9599 C water bath for 30 min. The sections were then rinsed in 3% hydrogen peroxide to block endogenous peroxidase and incubated for 1 h at room temperature with either a goat polyclonal ICAM-1 (CD54) antibody (R&D Systems, Inc.) or a monoclonal antibody to the platelet endothelial cell adhesion molecule (PECAM; CD31; DakoCytomation). This specific endothelial cell antigen marker was used to confirm localization of ICAM to endothelial cells. Neutrophils were detected with a mouse monoclonal anti-CD15 (granulocyte) antibody (Zymed Laboratories, South San Francisco, CA). Staining was visualized using the avidin-biotin peroxidase complex (Vectastain ABC kit, Vector Laboratories, Inc., Burlingame, CA) and the 3,3'-diaminobenzidine tetrahydrochloride (Sigma-Aldrich Corp.) chromogen substrate. Hematoxylin was used for counterstaining. Negative controls for each tissue section consisted of substituting the corresponding preimmune serum for the primary antibody.
Statistical analysis
Statistical analyses included the Kruskal-Wallis ANOVA on ranks with the Student-Newman-Keuls post hoc test for pairwise comparisons or by t test, with P < 0.05 considered significant. Experimental results are presented as the mean ± SEM. The intensity of ICAM-1 and PECAM staining was evaluated by a semiquantitative four-point rating scale ranging from 0 for least staining to 3 for maximum intensity of staining. To determine the interrater reliability of this scale, two independent judges scored a series of 35 separate fields on slides from four separate patient samples. The degree of concordance was then assessed by use of Cohens
. The value for ICAM-1 was 0.6, and the corresponding value for PECAM was 0.57, indicating good agreement between the judges in assessing immunostaining for both endothelial cell-specific markers (16).
| Results |
|---|
|
|
|---|
Figure 1
demonstrates prominent immunostaining for ICAM-1 in the endothelium of first trimester decidua. That decidual endothelial cell ICAM-1 expression is constitutive is suggested by similar staining intensity in the vessels in normal decidua (Fig. 1A
) compared with that in decidua displaying infiltration of leukocytes (Fig. 1B
). Figure 1C
indicates that immunostaining for the endothelial cell-specific marker PECAM (CD31) is comparable to that of ICAM-1 in both intensity and specificity for endothelial cells.
|
values of 0.67 and 0.57 for ICAM-1 and PECAM, respectively (see Materials and Methods for details).
|
Figure 3
indicates that in monolayers of first trimester decidual cells, E2 and MPA did not significantly enhance IL-8 output compared with E2 alone, whereas the addition of thrombin (2.5 U/ml) resulted in statistically significant increases in IL-8 output under both steroid treatments. Evaluating the results as net fold changes revealed that the addition of thrombin increased IL-8 expression by 35.3 ± 14.5-fold in E2-treated cultures and by 43.5 ± 14.3-fold in E2- plus MPA-treated cultures (n = 8; P < 0.05).
|
, and IL-1ß were evaluated on DCs that were primed with and then maintained in E2 and MPA. Dose-response effects on IL-8 output are shown for thrombin between 0.1 and 2.5 U/ml (Fig. 4A
and IL-1ß from 0.0110.0 ng/ml (Fig. 4B
> thrombin. Specifically, IL-1ß and TNF
increased IL-8 levels by 1083 ± 261- and 370 ± 77-fold, respectively (n = 8; P < 0.05), whereas the hemostatic agent, thrombin, increased IL-8 levels by 45 ± 15-fold (P < 0.05).
|
, or IL-1ß (Fig. 5
|
Figure 6
depicts levels of IL-8 mRNA, as measured by quantitative RT-PCR, in parallel cultures of first trimester DCs primed with E2 or E2 plus MPA, then maintained in the steroids alone or together with thrombin, TNF
, or IL-1ß. The results are plotted on a log scale and normalized for ß-actin mRNA. They indicate that, as is the case with secreted IL-8 protein levels, IL-1ß produced the largest increase in steady-state IL-8 mRNA levels, followed by TNF
and then thrombin.
|
| Discussion |
|---|
|
|
|---|
The current study confirms a report on the decidua of uncomplicated pregnancies that demonstrated prominent endothelial cell ICAM-1 staining in all vessel types and weak staining in the stroma and glands that was essentially negative (12), and extends this work to show that ICAM-1 is constitutively expressed in the endothelium of inflammation-complicated decidua. This conclusion is underscored by the immunostaining results obtained for hemorrhagic, acutely inflamed, regressing gestational endometrium. In these specimens, similar immunoreactive ICAM-1 levels were observed in the endothelium of blood vessels regardless of whether they were enveloped by or were completely free of surrounding leukocytes. In cultured endothelial cells, transcription of the ICAM-1 gene can be regulated by leukocyte-derived cytokines (19, 20). Our observation that ICAM-1 is constitutively expressed in the endothelial cells of first trimester human decidua suggests that factors such as cell-cell or cell-matrix interactions may inhibit cytokine responses in vivo.
Although the promoter region of the ICAM-1 and IL-8 genes predicts responsiveness to proinflammatory stimuli, regulation of ICAM-1 and IL-8 gene expression has been shown to depend on both tissue and cell type as well as the nature of the inflammatory stimulus. For example, the potent oxidative stress initiator, H2O2, induces IL-8, but not ICAM-1, in epithelial cells. Conversely, H2O2 induces ICAM-1 in endothelial cells, whereas IL-8 is constitutively expressed in these cells. However, TNF
, whose proinflammatory activity depends on reactive oxygen species formation, induces IL-8 and ICAM-1 in both endothelial and epithelial cells (reviewed in Ref.14).
Previously, we showed that IL-8 expression is markedly inhibited during progestin-induced decidualization of stromal cells from cycling endometrium (15). By comparison, the current study indicates that progestin elicited a small, nonsignificant increase in IL-8 expression in leukocyte-free, passaged, first trimester DC cultures. Unlike this marginal response to progestin, the classic proinflammatory cytokines, IL-1ß and TNF
, and the hemostatic agent, thrombin, up-regulated IL-8 protein expression in cultured DCs 45- to 1000-fold. Extrapolation of this striking up-regulation in IL-8 expression in vitro to gestational decidua in vivo may account for the ineffectiveness of high levels of endogenous or exogenous gestational progesterone to impede neutrophil infiltration in association with hemorrhagic and inflammatory abortions. Interestingly, IL-8 levels in products of conception were found to increase in association with the occurrence of spontaneous compared with elective abortions (21). The absence of a significant progestin effect on IL-8 expression in cultured DCs does not reflect a general loss in progestin responsiveness by these cultures, because progestin markedly up-regulates the expression of type 1 plasminogen activator inhibitor and down-regulates that of matrix metallproteinase-1 (22, 23).
In summary, the results presented in this study suggest that the interactive effects of constitutive endothelial cell ICAM-1 and rapid alterations in DC-derived IL-8 output in response to T helper cell type 1 cytokines and excess thrombin generation promote infiltration of neutrophils into the decidua. Our findings suggest a mechanism by which aberrant T helper cell type 1 cytokine expression and thrombophilia-induced thrombin generation mediate spontaneous abortions associated with hemorrhage or inflammation (24, 25, 26, 27).
| Footnotes |
|---|
First Published Online May 24, 2005
Abbreviations: DC, Decidual cell; DM, defined medium; E2, estradiol; ICAM-1, intercellular adhesion molecule-1; IHC, immunohistochemistry; MPA, medroxyprogesterone acetate; PECAM, platelet endothelial cell adhesion molecule.
Received December 23, 2004.
Accepted May 13, 2005.
| References |
|---|
|
|
|---|
B. Int J Mol Med 3:223230 (Review)
This article has been cited by other articles:
![]() |
C. J. LOCKWOOD, G. KRIKUN, R. CAZE, M. RAHMAN, L. F. BUCHWALDER, and F. SCHATZ Decidual Cell-expressed Tissue Factor in Human Pregnancy and Its Involvement in Hemostasis and Preeclampsia-related Angiogenesis Ann. N.Y. Acad. Sci., April 1, 2008; 1127(1): 67 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lockwood, P. Toti, F. Arcuri, E. Norwitz, E. F. Funai, S.-T. J. Huang, L. F. Buchwalder, G. Krikun, and F. Schatz Thrombin Regulates Soluble fms-Like Tyrosine Kinase-1 (sFlt-1) Expression in First Trimester Decidua: Implications for Preeclampsia Am. J. Pathol., April 1, 2007; 170(4): 1398 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.P. Hess, A.E. Hamilton, S. Talbi, C. Dosiou, M. Nyegaard, N. Nayak, O. Genbecev-Krtolica, P. Mavrogianis, K. Ferrer, J. Kruessel, et al. Decidual Stromal Cell Response to Paracrine Signals from the Trophoblast: Amplification of Immune and Angiogenic Modulators Biol Reprod, January 1, 2007; 76(1): 102 - 117. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |