| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Splice Variants in the Medial Mamillary Nucleus of Alzheimers Disease Patients: Identification of a Novel MB1 Isoform
Netherlands Institute for Brain Research (T.A.I., D.F.S., D.F.F.), 1105 AZ Amsterdam, The Netherlands; and Department of Histology, Embryology, and Cell Biology (T.A.I.), Kursk State Medical University, 305033 Kursk, Russia
Address all correspondence and requests for reprints to: D. F. Swaab, M.D., Ph.D., Director, Professor of Neurobiology, Netherlands Institute for Brain Research, Meibergdreef 33, 1105 AZ Amsterdam, The Netherlands. E-mail: dfswaab{at}nih.knaw.nl.
| Abstract |
|---|
|
|
|---|
(ER
) in the medial mamillary nucleus (MMN) in Alzheimers disease (AD). In the present study, we addressed the presence of specific ER
mRNA splice variants in this brain area of five AD cases compared with five controls using the RT-PCR and quantitative RT-PCR approach. Indeed, the occurrence of isoforms with the deletion of exons 7 (del.7), 4 (del.4), or 2 (del.2) was determined in all patients. However, there were no significant differences in the relative transcription levels of each of the mentioned splice variants between AD and control cases, although the ratio of the del.7 isoform to the canonical ER
mRNA was higher in controls. Given that exons 7 and 4 encode the ligand-binding domain of the ER
, whereas exon 2 encodes the DNA-binding domain, abundant expression of these splice variants suggests that much of the available ER
in the MMN of AD and elderly control patients is nonfunctional because they will be unable to bind either the ligand (del.7 and del.4 variants) or the estrogen-responsive elements on appropriate DNA (del.2 variant). Yet, the wild-type ER
mRNA appeared to be 2- to 3-fold up-regulated in AD, confirming the rise in the nuclear immunocytochemical staining and pointing to the potential for a beneficial effect of estrogen replacement therapy on the MMN-associated cognitive functions in AD because it represents the availability of potentially functional ER
in the MMN. Noteworthy, the expression of the wild-type, del.7, and del.2 mRNAs declined with advanced age in both AD and control patients. Interestingly, we have identified in two AD and two control patients a novel ER
splice variant that we called MB1 (mamillary body, exon 1) with a 168-nucleotide deletion corresponding to a U2-type intron inside exon 1 encoding the major portion of the transactivation function 1 domain of the receptor. | Introduction |
|---|
|
|
|---|
(ER
) in several brain areas that are involved in cognition and that are affected in AD, i.e. the cholinergic basal forebrain (1, 2, 3) and in the medial mamillary nucleus (MMN) (4). Initially, these findings suggested the availability of ERs in these brain regions that made them potential targets for estrogen replacement therapy (ERT) in AD. However, considering the reported absence of clear beneficial effects of ERT in AD in several trials (5, 6), this phenomenon required further investigation. Therefore, we addressed the question whether specific splice variants of the ER
mRNA might occur in AD patients and, if so, whether they might explain the remarkable rise in the nuclear ER
and possibly also the negative findings in ERT trials.
The human ER
belongs to the nuclear hormone receptor superfamily and acts as a ligand-binding-dependent transcription factor (7). The open reading frame of the classical ER
comprises eight exons (8, 9). Exon 1 and a part of the exon 2 encode the N-terminal transcriptional activation function AF1 (10). Exons 2 and 3 encode the DNA-binding domain, which is essential for sequence-specific DNA binding and transcriptional activation through canonical estrogen response elements. Exons 48 encode the ligand-binding domain of the ER
protein and include determinants for heat-shock protein association in the cytoplasm, ligand-dependent receptor dimerization, activation function AF2 to promote gene transcription by recruiting coactivators, and estrogen and antiestrogen ligand binding (10). In addition to the wild-type ER
mRNA, these exons generate many isoforms/splice variants that were recently classified into seven types (7). The most frequent alternatively spliced products are the exon-skipping variants, where one or more entire exons are omitted during the processing of the primary transcript (11). It was furthermore reported that in normal tissues, mostly single exon-skipping variants were observed, whereas half of the ER isoforms expressed in tumor tissues are devoid of more than one exon (11, 12). Nearly all of the described variants are expressed in both normal and neoplastic tissues in concomitance to the canonical full-length transcript but may be present at undetectable levels (11). Most attention has been paid to the ER
splice process in tumors and cell lines, and no data concerning the brain and AD are available so far.
Therefore, in the present study we examined the occurrence of the ER
splice variants in the hypothalamic MMN of AD and elderly control patients (Table 1
) using the RT-PCR and quantitative RT-PCR (Q-PCR) approach that implied RT-PCR amplification of the two halves of the ER
cDNA 1) comprising exons 14 and 2) spanning exons 48 followed by sequencing of the resulting products and their quantification with the Q-PCR. The MMN was chosen for this investigation because it showed an enhanced nuclear ER
immunostaining in AD (4) and can be easily determined and isolated from the frozen brain tissue required for the application of the mentioned techniques.
|
| Subjects and Methods |
|---|
|
|
|---|
Frozen hypothalami (stored at 80 C) containing the mamillary body were obtained at autopsy in the framework of The Netherlands Brain Bank from five AD and five control patients that were matched for age (P = 0.841), sex (P = 1.000), and postmortem delay (P = 0.421) (Table 1
). In addition, pilot experiments were carried out on the mamillary body of an AD male (no. 11) (Table 1
). In all cases, written consent was received for the brain autopsy and the use of the material and clinical information for research purposes. Medical history of the control cases did not reveal any sign of cognitive disability. The demented patients were clinically assessed and diagnosed as probable AD by excluding other possible causes of dementia by history, physical examination, and laboratory tests according to the National Institute of Neurological and Communicative Disorders and Stroke-The Alzheimers Disease and Related Disorders Association (NINCDS-ADRDA) criteria (13). Severity of AD was indicated by the Reisberg scale 7 in all AD cases (14). Neuropathological examination of AD patients showed extensive neocortical and hippocampal senile plaques, neurofibrillary tangles, and dystrophic neurites. On the basis of the distribution of neurofibrillary tangles, Braak stages were assigned as 01 in controls and as 56 in AD patients (15) (Table 1
).
RNA isolation and cDNA synthesis
Mamillary bodies were excised with a sterile blade (new for each case) from the frozen hypothalami of AD and control patients as they could be clearly visualized behind the optic chiasm (1). Localization of the anterior commissure and of the sulcus hypothalamicus was also helpful for anatomical orientation. Total RNA samples were extracted from the entire mamillary body of each case with Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. RNA concentrations were determined by 260-nm spectrophotometry. RT reactions were carried out for each RNA sample with approximately 1.5 µg of total RNA using the hexanucleotide mix (Roche Diagnostics, GmbH, Mannheim, Germany). RNA samples were heated to 70 C for 10 min, cooled on ice, and mixed with 5x first-strand buffer (Invitrogen), 100 mM dithiothreitol, 10 mM each of dATP, dCTP, dGTP, and dTTP (Invitrogen), and 1 µl RNase OUT ribonuclease inhibitor (Invitrogen). RT reactions were performed with 200 U of the Superscript II RNase H reverse transcriptase (Invitrogen) in a final volume of 20 µl for 1.5 h at 42 C.
RT-PCR
Two microliters of the single-strand cDNA were then used as the template to amplify fragments 1) from exon 1(2) to exon 4 (Fig. 1
and Tables 2
and 3
); 2) from exon 4 to exon 8 (Fig. 2
and Tables 2
and 3
); 3) from exon 2 to exon 5 (Fig. 3
and Tables 2
and 3
); 4) from exon 2 to exon 4 (Fig. 4
and Tables 2
and 3
); 5) from exon 3 to exon 5 (Fig. 5
and Tables 2
and 3
). RT-PCR was performed in a final volume of 50 µl containing forward and reverse primers (Table 2
), 0.25 mM dNTPs, SuperTaq buffer, 1.5 mM MgCl2 and 5 U of Taq DNA polymerase (HT Biotechnology Ltd., Cambridge, UK). The optimal conditions for amplification were as follows: initial denaturation at 94 C for 2 min, 36 cycles corresponding to denaturation at 94 C for 20 sec, primer hybridization at 52 C for 30 sec, and elongation at 72 C for 2 min; then final elongation at 72 C for 7 min. No-template (sterile water) controls were always negative. Extra internal and a negative control with omitted reverse transcriptase were unnecessary because we performed sequencing of all of the observed RT-PCR bands and no introns were found in any of the RT-PCR products (see below). The resulting RT-PCR products were loaded on a 2% agarose gel stained with ethidium bromide, subjected to electrophoresis at 80 V in Tris-acetate-EDTA buffer and photographed (Sony CCD videocamera; Fotodyne Inc. Foto/Analyst Visionary, Tokyo, Japan) under 300-nm UVB light (Pharmacia LKB MacroVue; Pharmacia, Uppsala, Sweden) (Figs. 15![]()
![]()
![]()
![]()
). The clearest bands (Table 3
) were cut out from the gels with a sterile blade, and the DNA was subsequently isolated according to the QIAEX II agarose gel extraction protocol. The purified DNA was amplified under the same conditions and sequenced to examine the inclusion or exclusion of exons 7, 2, and 4 (Fig. 6
and Table 3
). Sequencing was carried out on an ABI 3100 (Applied Biosystems, Foster City, CA) using the Big Dye Terminator kit 1.1. Base calling was performed using the program phred 0.020425 (16).
|
|
|
|
|
|
|
|
Based on the obtained sequences the MMN levels of the wild-type transcripts encoding intact ligand-binding (exon 7) or DNA-binding (exon 2) domains, exon 7 deletion (del.7) and del.2 splice variants ER
mRNA were assayed by Q-PCR using the primer sets (Table 4
) designed with the Primer Express software (Applied Biosystems). It is noteworthy that in all of these primer pairs except for the one spanning exons 7 and 8, one of the primers was superimposed exactly over the link between the exons. For normalization of the target cDNAs, the following reference genes and primers were selected: ribosomal protein S27a (forward, GGTTAAGCTGGCTGTCCTGAA; reverse, AGAAGGGCACTCTCGACGAA), elongation factor 1
(forward, AAGCTGGAAGATGGCCCTAAA; reverse, AAGCGACCCAAAGGTGGAT), and E2D 2 ubiquitin-conjugating enzyme Ube2d2 (forward, CTGAAGAGAATCCACAAGGAATTGA; reverse, CTCCAACAGGACCTGCTGAAC) (17). Q-PCR was carried out in the GeneAmp 5700 sequence detection system (Applied Biosystems) in a final volume of 20 µl containing 0.1 µl cDNA and the SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK). The thermal cycling conditions entailed an initial denaturation step at 95 C for 10 min followed by 40 cycles of 15 sec at 95 C and 1 min at 60 C. All samples were tested in duplicate. The specificity of the Q-PCR was checked by determining the melting point. No-template (sterile water) Q-PCR was negative for each of the primer sets.
|
The efficiency of individual primers was calculated using cDNA dilution curves and linear regression as described in Refs. 17 and 18 . The magnitude of changes in the expression of the wild-type ER
mRNA and del.7 and del.2 transcripts in AD compared with control patients was calculated according to the method of Pfaffl (19) using the following formula:
![]() |
Ct is the difference in the cycle threshold between control and AD cases for the target (wild-type, del.7, and del.2 isoforms of the ER
) and reference (ribosomal S27a, elongation factor 1
, and Ube2d2) transcripts. The relative transcription levels were assessed from the raw data by calculating the amount of starting template using the formula: (target-gene-specific efficiency)Ct/(reference gene efficiency)Ct, where Ct is cycle threshold (Table 5
mRNA (amplicons spanning exons 6 and 7 and exons 7 and 8) and the ratio of the del.2 isoform to the transcripts connecting exons 2 and 3.
|
| Results |
|---|
|
|
|---|
In the present study, the entire sequence of the cDNA from the wild-type ER
mRNA (GI:4503602) could not be amplified with RT-PCR and visualized by agarose gel electrophoresis probably because of the low abundance of high quality mRNA in the human postmortem material. Therefore, we chose to examine it in two halves, i.e. from exon 1(2) to exon 4 (Fig. 1
) and from exon 4 to exon 8 (Fig. 2
). In addition, we determined the transcript from exon 2 to exon 5 (Fig. 3
) to study the inclusion of exon 4, and two smaller fragments of the ER
cDNA to exclude the presence of the del.3 splice variant, and to confirm the existence of the del.4 splice variant (from exon 2 to exon 4) [Fig. 4
], (from exon 3 to exon 5) [Fig. 5
and Tables 2
and 3
].
Exons 1(2)4
The fragment of the ER
cDNA (GI:4503602) comprising exons 1(2)4 was the most difficult for RT-PCR amplification, which resulted in weak ethidium bromide signals on agarose gel (Fig. 1
). A number of bands that were observed and sequenced from two AD patients, nos. 9 and 11 (94-028 and 99-138), included an approximately 1000-bp amplicon that contained exons 1, 2, and 3; an approximately 800-bp transcript that comprised exons 1, 2, and 3 and appeared to be a novel MB1 splice variant with the exonic intron type U2 between nucleotides 573 and 741 being skipped (Fig. 6A
); an approximately 600-bp amplicon containing exons 2 and 3; an approximately 500-bp amplicon that had exons 1(2) (partially), 2, 3, and 4 (partially); an approximately 300-bp transcript that included a part of the exon 1(2), exon 3, and exon 4 (partially) with exon 2 being omitted (del.2 variant) and with exon 1(2) spliced directly to exon 3 (Fig. 6B
).
MB1: a novel ER
splice variant
Importantly, we identified for the first time in the MMN of an AD case, no. 9 (99138), the 800-bp transcript with a 168-nucleotide deletion in exon 1 complementary to the sequence between 573 and 741 of the human ER
mRNA (GI:4503602) (Fig. 7
). The omitted sequence of exon 1 corresponds to an exonic intron type U2 according to the nomenclature of Sharp and Burge (20). Apparently, the classical ER
mRNA has retained this intron (21). Its 3' splice site with AG and 5' splice site (GT) do not conform to the optimal consensus sequence causing the inefficient splicing. The latter explains why this variant was not observed previously in either human or animal species, although the splice sites are conserved in the mouse, rat, and chimpanzee (Fig. 8
) (22). The resulting protein most likely has up to a 4-fold decrease in transactivation function 1 (AF1) as predicted on the basis of studies of A/B deletion mutants in chicken embryo fibroblasts and yeast models (23). Because this novel variant was sequenced from the mamillary body and is located in exon 1, we designated it hereafter MB1 (mamillary body, exon 1). In addition, the MB1 variant was clearly detected in the MMN of two control cases, nos. 2 and 4 (02008 and 00127) (Table 3
and Fig. 1
), and in the thalamus of an AD patient, no. 11 (94028). These observations mean that the MB1 splice variant is not specific for AD or the MMN and may be present in other brain areas.
|
|
Amplification of the transcripts including exons 2, 3, and 4 resulted in a clear band about 350 bp in size that was present in all patients (Table 3
and Fig. 4
). The ethidium bromide signal was stronger in the AD group compared with controls. The absence of other bands excludes the occurrence of the del.3 splice variant in the MMN of the patients under investigation.
Exons 35
RT-PCR of the ER
CDNA fragment between exons 3 and 5 showed two major products: 1) the approximately 580-bp transcripts comprising exons 3, 4, and 5 and 2) the approximately 220-bp amplicons with exons 3 and 5 present for a major part as expected from the primer design but lacking exon 4 (del.4 splice variant) (Table 3
and Fig. 5
).
Exons 25
Amplification of the region between exons 2 and 5 produced the transcripts of 1) approximately 780 bp containing exons 2, 3, 4, and 5 of the ER
gene and 2) approximately 400 bp, which is an ER
mRNA isoform lacking exon 4 (Figs. 3
and 6C
). In addition, the amplicon of approximately 600 bp noted in the AD man of 65 yr of age contained the appropriate exons from 25 but showed a 57-nucleotide deletion in exon 4 (Table 3
and Fig. 3
).
Exons 48
RT-PCR of the fragment from exon 4 to exon 8 resulted in the formation of the two major products: 1) approximately 800 bp that contained a part of exon 4 and exons 5, 6, 7, and 8 completely and 2) approximately 600 bp in which exons 4, 5, 6, and 8 were included but exon 7 was omitted (del.7 variant) (Fig. 6D
). Remarkably, the expression of the del.7 ER
isoform (
600 bp) was clearly high in all patients compared with the MB1, del.2, and del.4 splice variants (Table 3
and Fig. 2
).
There was no strong evidence for the occurrence of del.3, del.5, and del.6 isoforms in any of the patients based on the RT-PCR analysis, although the possibility of the minimal expression levels of splice variants different from those detected in the present study cannot be excluded.
Q-PCR
The magnitude of AD-related changes was determined separately for the following couples: cases 1 and 6, 2 and 7, 3 and 8, 4 and 9, and 5 and 10 and relative to each of the mentioned reference genes. The wild-type ER
mRNA as judged from the transcripts at the junction of exons 1) 6 and 7, 2) 7 and 8, and 3) 2 and 3 (i.e. encoding intact ligand- or DNA-binding domains) was 2- to 3-fold up-regulated in AD (P = 0.05). It is noteworthy that AD females tended to have less wild-type ER
mRNA than AD males (P = 0.058) in support of the more prominent rise in the nuclear ER
immunoreactivity observed in the MMN of AD men (4). The expression of the del.7 ER
mRNA isoform was 4070% higher in AD patients 7 and 10 compared with controls 2 and 5, respectively. The AD-favoring differences in the del.2 variant were observed in two pairs: 4 and 9 and 5 and 10, where they ranged between 1.3- and 4.5-fold increase. The del.2 isoform was less abundant than the del.7 and del.4 as judged from the RT-PCR (Table 3
and Figs. 15![]()
![]()
![]()
![]()
) and the cycle threshold in the Q-PCR analysis.
There were no significant differences in the relative expression of either del.7 or del.2 splice variants between AD and control cases when all 10 patients were pooled (Table 5
). However, the ratio of the del.7 isoform to the wild-type ER
mRNA was reduced in AD (P = 0.037), whereas the ratio of the del.2 splice variant was not changed (P = 0.841). Furthermore, relative transcription levels of the wild-type ER
mRNA and del.7 isoform decreased with advanced age in both AD (r = 1.000; P = 0.0001) and control patients (r = 0.900 and P = 0.037 for the amplicon between exons 2 and 3; r = 1.000 and P = 0.0001 for the del.7 and the amplicon between exons 7 and 8). The del.2 isoform showed an age-dependent decline only in the control group (r = 1.000; P = 0.0001).
| Discussion |
|---|
|
|
|---|
mRNA splice variants in the MMN of AD and elderly control patients using the RT-PCR and Q-PCR approach. Furthermore, a novel MB1 isoform was identified in exon 1, and evidence was found for the occurrence of small deletions in the human ER
mRNA such as the 57-nucleotide deletion in exon 4 of the AD man no. 7. The latter was also observed for the glial fibrillary acidic protein splice forms in AD (24).
The expression of the wild-type ER
mRNA was substantially up-regulated in AD, confirming our previous observation of the increased nuclear ER
immunoreactivity in the MMN of AD patients (4). The lack of both plasma and locally synthesized estrogen in the MMN of AD patients (25) may explain the increase in the ER
protein and mRNA expression by a feedback loop. In other words, both the ER
protein and mRNA can be up-regulated in the absence of estrogen (26). Relatively high levels of the wild-type ER
mRNA expression together with the increased nuclear ER
immunoreactivity in AD patients demonstrate the potential for a beneficial effect of ERT on the MMN-associated cognitive functions in AD, such as on recent memory, learning, emotions, the acquisition of spatial discriminations and skills, and offensive behavior (1, 4).
The results of this investigation concerning the alternative splicing of the ER
mRNA support earlier reports showing that in comparison with other splice variants, del.4, del.2, and in particular del.7 isoforms are expressed at the highest levels in normal and neoplastic tissues close to those observed for the full-length transcripts (11, 12, 27, 28) and provide new data concerning ER
mRNA splice variants in AD and aging. Although there were no statistically significant differences in the relative transcription levels of del.7, del.4, and del.2 splice variants between AD and control subjects, high variability between patients should be taken into account. For instance, the del.7 isoform was about 2-fold up-regulated in AD cases 7 and 10 compared with their matched controls 2 and 5 and was either not changed or decreased in the others. Similarly, the del.2 splice variant was increased by 30% to 4-fold in AD patients 9 and 10 compared with control subjects 4 and 5 and was not changed or decreased in the rest of the AD group. With regard to the absence of significant differences in the del.7 and del.4 between AD and control cases, it is noteworthy that the expression of these variants was also equivalent in normal and cancer breast and endometrial tissues (12, 29).
The del.7 variant
It is of particular interest that exon 7, which is involved in the coding of the ligand-binding domain of the ER
protein, is most commonly skipped in the MMN of elderly and AD patients. In agreement with this finding, del.7 was also shown to be the major splice variant in human nontumor and tumor lung tissues (28). The loss of exon 7 implies the elimination of a significant portion of the hormone-binding domain with ligand-dependent transactivation function AF2 that causes the inability of the del.7 variant to bind ligands, its insensitivity to estrogens and antiestrogens, and the lack of association with coactivators (10). Unexpectedly, this receptor isoform also shows a strong defect in estrogen-responsive elements recognition and DNA binding (10). Moreover, del.7 ER
is known as the dominant negative splice variant that, when expressed at high levels relative to wild-type ER
and ERß, may profoundly inhibit binding of wild-type receptors to their responsive elements and, consequently, the estrogen-dependent transcriptional activation by both classical ERs (10). In this respect it is noteworthy that in the present study, the ratio of the del.7 isoform to the wild-type ER
mRNA was higher in control than in AD patients. Apparently, this observation means a profound reduction in functionally active ER
and consequently fewer or no effects of ERT on the MMN neurons and glial cells in the elderly controls. On the other hand, it was suggested that the dominant negative function of the ER
splice variants might protect the tissue from excessive estrogenic signals, the conclusion based on the 30-fold higher expression of the del.3 variant in normal than in breast cancer tissues (11, 30). Indeed, estradiol treatment decreased the wild-type and increased the del.7 variant ER
protein expression in the human endometrial adenocarcinoma grown in nude mice (27). It might be relevant to mention here that in the selected population of the Womens Health Initiative Memory Study, estrogen plus progestin doubled the risk of dementia in women 6579 yr of age (6, 31). Although progestin effects should be, of course, considered as confounding factors, there are other clinical observations showing that ERT begun after the onset of AD symptoms was without substantial benefit or harm (31). Collectively, these findings seem to be in agreement with the present data showing more wild-type ER
mRNA and less nonfunctional splice variants in the MMN of AD patients compared with the elderly controls (6184 yr of age).
The del.4 variant
In addition to del.7, the del.4 isoform was also described as one of the most frequent human ER
splice variants because of a particular affinity of exon 3 donor (5' splice site) and exon 5 acceptor (3' splice site) sites (11). The del.4 appears to be a silent variant. It maintains most of the receptor sequences intact, because the missing exon does not alter the reading frame (11). Nonetheless, this variant does not exert activity on its own and was proposed not to influence the normal receptor function (32, 33), although the dominant negative role was conferred upon it, too (34). Because the del.4 isoform does not bind estrogens or estrogen-responsive elements (32), it can be reasonably assumed that high expression of the del.4 and del.7 variants would suppress estrogen signaling via ER
in the MMN of elderly and AD patients.
The del.2 variant
The occurrence of the del.2 ER
mRNA splice variant points to alterations in the DNA-binding domain of the ER
protein and, hence, inability for some of the receptors to activate transcription via estrogen-responsive elements in the MMN of the elderly and AD patients. Indeed, exon 2 deletion in the ER
-
2 knockout mice caused a complete and unambiguous inactivation of ER
(35). In the present study, it cannot be ruled out that at least some of the del.2 isoforms could be combined with del.7 in the same mRNA variant. In this case, the effect of alternative splicing on the proportion of the protein isoforms with compromised DNA-binding domain would be significantly less because del.7 variants are transcriptionally inert (10). ER
isoforms lacking a single exon 2 may play a role in the cytoplasm because they retain the ability to bind ligands.
In the functional study of Bollig and Miksicek (36), del.2, del.4, and del.7 mutant ER
proteins were unable to bind 3H-labeled estradiol and to translocate to the nucleus and activate transcription via estrogen-responsive elements in Cos7 cells. According to these authors, the mentioned splice variants may represent a pool of cytoplasmic ER
receptors observed by immunocytochemistry (36). These data may strengthen our conclusions, because in the previous study (4), we reported increased nuclear ER
staining in the MMN of AD patients, and in the present work, we demonstrate that they are mostly wild-type ER
. However, the del.7 variant is able to form heterodimers with both wild-type ER
and -ß in a ligand-independent manner (10) and in this way may also be present in the nucleus of AD or elderly control patients.
Although there was no evidence for the high expression rate of other splice variants, including the dominant negative del.3 isoform (11, 12, 30), it is plausible that they were present at undetectable levels.
Intriguingly, the expression of the wild-type and del.7 and del.2 ER
splice variants showed an age-dependent decline in the MMN of both AD and control patients, indicating an overall reduction in the transcription levels in the elderly. A relatively lower expression of the del.7 isoform in AD patients points to the attenuated efficiency of alternative splicing in AD.
Conclusions
In the present study, we have for the first time identified in the MMN and thalamus of two AD and two control patients a novel MB1 splice variant of the human ER
mRNA that is characterized by splicing of the 168-nucleotide exonic intron in exon 1. Apparently, the canonical wild-type ER
mRNA contains a skipped exonic intron because of intron retention. The resulting protein will presumably show up to a 4-fold decrease in the transcriptional activation function 1 and may thus be proposed to be dominant negative. The wild-type ER
mRNA was more abundantly expressed in the MMN of AD cases compared with controls and decreased with advanced age in both groups. The del.7 isoform was the major splice variant of the ER
mRNA in the MMN of both AD and control patients and showed a high level of expression close to or even exceeding that of the wild type with an age-dependent decline. There was no difference in the occurrence of del.7, del.4, and del.2 splice variants in the MMN between AD patients and controls, although the ratio of the del.7 isoform to the wild-type ER
mRNA was higher in the elderly controls than in AD cases. Consequently, the alterations in the transcriptional activation function 1 (MB1) and DNA-binding (del.2) and ligand-binding (del.7 and del.4) domains of the ER
protein can be predicted in both AD and elderly control patients. It can be thus concluded that much of the ER
receptors in the MMN may not be able to bind estrogens or to activate transcription via estrogen-responsive elements. Taken together, these findings contribute to the explanation of the pitfalls of ERT in the elderly and AD. However, relatively high levels of the wild-type ER
mRNA expression in AD patients point to a possibility of improvement of the MMN-associated cognitive functions after ERT in AD.
| Acknowledgments |
|---|
| Footnotes |
|---|
This study was supported by the Internationale Stichting Alzheimer Onderzoek, Nederlandse Alzheimer Stichting, and by the Research Institute for Diseases in the Elderly, funded by the Ministry of Education & Science and the Ministry of Health, Welfare and Sports, through The Netherlands Organization for Scientific Research (NWO) (D.F.S.).
First Published Online March 8, 2005
Abbreviations: AD, Alzheimers disease; ER, estrogen receptor; ERT, estrogen replacement therapy; MMN, medial mamillary nucleus; Q-PCR, quantitative RT-PCR.
Received September 22, 2004.
Accepted February 25, 2005.
| References |
|---|
|
|
|---|
e7 suppresses estrogen-dependent transcriptional activation by both wild type ER
and ERß. Endocrinology 144:29672976
primary transcript: mechanisms of exon skipping. Int J Mol Med 12:355363[Medline]
mRNAs is increased in breast cancer tissues. J Steroid Biochem Mol Biol 78:459469[CrossRef][Medline]
protein in an estradiol-resistant, tamoxifen-sensitive human endometrial adenocarcinoma grown in nude mice. Gynecol Oncol 84:271279[CrossRef][Medline]
and ß estrogen receptors in human nontumor and tumor lung tissue. Mol Cell Endocrinol 188:125140[CrossRef][Medline]
3) in breast cancer and the consequences of its reexpression: interference with estrogen-stimulated properties of malignant transformation. Mol Endocrinol 11:20042015
may be dispensable to mediate the effect of estradiol on endothelial NO production in mice. Proc Natl Acad Sci USA 99:22052210
splicing variant mediates both positive and negative effects on gene transcription. Mol Endocrinol 14:634649This article has been cited by other articles:
![]() |
J. Wong and C. S. Weickert Transcriptional Interaction of an Estrogen Receptor Splice Variant and ErbB4 Suggests Convergence in Gene Susceptibility Pathways in Schizophrenia J. Biol. Chem., July 10, 2009; 284(28): 18824 - 18832. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus The Hair Follicle as an Estrogen Target and Source Endocr. Rev., October 1, 2006; 27(6): 677 - 706. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |