help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Journal of Clinical Endocrinology & Metabolism , doi:10.1210/jc.2004-1980
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M. B.
Right arrow Articles by Steinberg, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M. B.
Right arrow Articles by Steinberg, G. R.
Related Collections
Right arrow Lipid
Right arrow Diabetes and Insulin
Right arrow Metabolism
Right arrow Obesity
The Journal of Clinical Endocrinology & Metabolism Vol. 90, No. 6 3665-3672
Copyright © 2005 by The Endocrine Society

Impaired Activation of AMP-Kinase and Fatty Acid Oxidation by Globular Adiponectin in Cultured Human Skeletal Muscle of Obese Type 2 Diabetics

Michael B. Chen, Andrew J. McAinch, S. Lance Macaulay, Laura A. Castelli, Paul E. O’Brien, John B. Dixon, David Cameron-Smith, Bruce E. Kemp and Gregory R. Steinberg

St. Vincent’s Institute and Department of Medicine (M.B.C., B.E.K., G.R.S.), University of Melbourne, Fitzroy, Victoria 3065 Australia; Commonwealth Scientific and Industrial Research Organization (S.L.M., L.A.C., B.E.K.), Health Sciences and Nutrition, Parkville, Victoria 3052 Australia; School of Exercise and Nutrition Sciences (A.J.M., D.C.-S.), Deakin University, Burwood, Victoria 3125, Australia; and Centre of Obesity Research and Education (P.E.O., J.B.D.), Monash University, Alfred Hospital, Melbourne, Victoria 3181, Australia

Address all correspondence and requests for reprints to: Gregory R. Steinberg, Ph.D., St. Vincent’s Institute, 9 Princes Street, Fitzroy, Victoria 3065, Australia. E-mail: gsteinberg{at}svi.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Adiponectin is an adipocyte-derived hormone associated with antidiabetic actions. In rodent skeletal muscle, globular adiponectin (gAD) activates AMP-kinase (AMPK) and stimulates fatty acid oxidation effects mediated through the adiponectin receptors, AdipoR1 and AdipoR2. In the present study, we examined the mRNA expression of adiponectin receptors and the effects of gAD on AMPK activity and fatty acid oxidation in skeletal muscle myotubes from lean, obese, and obese type 2 diabetic subjects. Myotubes from all groups expressed approximately 4.5-fold more AdipoR1 mRNA than AdipoR2, and obese subjects tended to have higher AdipoR1 expression (P = 0.052). In lean myotubes, gAD activates AMPK{alpha}1 and -{alpha}2 by increasing Thr172 phosphorylation, an effect associated with increased acetyl-coenzyme A carboxylase (ACCß) Ser221 phosphorylation and enhanced rates of fatty acid oxidation, effects similar to those observed after pharmacological AMPK activation by 5-aminoimidazole-4-carboxamide riboside. In obese myotubes, the activation of AMPK signaling by gAD at low concentrations (0.1 µg/ml) was blunted, but higher concentrations (0.5 µg/ml) stimulated AMPK{alpha}1 and -{alpha}2 activities, AMPK and ACCß phosphorylation, and fatty acid oxidation. In obese type 2 diabetic myotubes, high concentrations of gAD stimulated AMPK{alpha}1 activity and AMPK phosphorylation; however, ACCß phosphorylation and fatty acid oxidation were unaffected. Reduced activation of AMPK signaling and fatty acid oxidation in obese and obese diabetic myotubes was not associated with reduced protein expression of AMPK{alpha} and ACCß or the expression and activity of the upstream AMPK kinase, LKB1. These data suggest that reduced activation of AMPK by gAD in obese and obese type 2 diabetic subjects is not caused by reduced adiponectin receptor expression but that aspects downstream of the receptor may inhibit AMPK signaling.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
THE RAPID ESCALATION in rates of obesity in Western society represents a significant health concern because of associations with the development of type 2 diabetes. In recent years there has been significant interest in the potential role of adipokines such as TNF{alpha}, leptin, and adiponectin in regulating skeletal muscle insulin sensitivity. Adiponectin is secreted exclusively from adipose tissue and is an abundant plasma protein that is reduced in obese and type 2 diabetic humans (1). Structurally, adiponectin is related to the complement 1q family and contains a carboxyl-terminal globular domain and an amino-terminal collagenous domain (2). Globular adiponectin (gAD) treatment has been shown to reverse skeletal muscle insulin resistance in models of genetic and diet-induced obesity. These effects are attributed to the activation of AMP-kinase (AMPK) (3, 4) by adiponectin receptor 1 (AdipoR1) (5) resulting in increased acetyl-coenzyme A carboxylase (ACCß) phosphorylation, reduced malonyl-coenzyme A production, and increased carnitine-palmitoyl-transferase-1 activity and mitochondrial fatty acid oxidation (6, 7). AMPK activity is regulated allosterically by alterations in the AMP:ATP ratio and covalently by phosphorylation at Thr172 by the upstream AMPK kinase (AMPKK)/LKB1 (8, 9).

In skeletal muscle from obese and type 2 diabetic humans, suppressed rates of fatty acid oxidation (10, 11, 12), combined with increased rates of fatty acid uptake (13) and esterification (14), contribute to the accumulation of im lipid and is a key factor in the development of skeletal muscle insulin resistance. Recent studies in both rodent (15) and human (16) skeletal muscle demonstrate reduced AdipoR1 mRNA expression in type 2 diabetes, suggesting blunted adiponectin signaling may contribute to suppressed rates of fatty acid oxidation in obesity and diabetes. The purpose of this study was to investigate the effects of gAD on fatty acid oxidation and AMPK activity in primary myotubes derived from lean, obese, and type 2 diabetic skeletal muscle. We hypothesized that gAD would activate AMPK signaling in skeletal muscle myotubes from lean subjects but that this effect would be blunted in myotubes from obese subjects and obese subjects with type 2 diabetes.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

The participants were seven lean (five male and two female), obese (five male and two female), and obese type 2 diabetic (four male and three female) subjects undergoing abdominal surgery. Written informed consent was obtained from all participants after approval by the Human Ethics Research committee of Deakin University, the Avenue Hospital, and Cabrini Hospital, Melbourne. After a fast (12–18 h), general anesthesia was induced with a short-acting propofol and maintained by a fentanyl and rocuronium volatile anesthetic mixture, and a biopsy of rectus abdominus muscle was removed.

Cell culture

Primary skeletal muscle cell culture was established according to the method described by Blau and Webster (17) and modified by Gaster et al. (18). All cell culture reagents were purchased from Invitrogen (Melbourne, Australia) unless otherwise stated. In brief, muscle samples, weighing approximately 50–100 mg, were washed in Hams F-10 medium, minced and enzymatically dissociated with 0.05% trypsin/EDTA. Cells were then collected through centrifugation and resuspended in {alpha}-MEM supplemented with 10% fetal bovine serum (FBS) (vol/vol), 0.5% penicillin (vol/vol), and 0.5% Fungizone (vol/vol) in a 37 C incubator with 5% CO2 throughout the incubation. These incubation conditions were used throughout the study. Cells were cultured on an uncoated flask for 30 min before transferring the cell media to a flask coated with extracellular matrix (from Sigma Chemical Co., Sydney, Australia). Growth medium was changed every other day. Cells were passaged at approximately 80% confluence. On passage four, cells were resuspended in growth medium and seeded on extracellular matrix-coated, 10-cm, six-well plates (Greiner, Longwood, FL) and grown to confluence before differentiation for 6 d in {alpha}-MEM, 2% horse serum, 1% penicillin, streptomycin, and amphotericin B (PSA) for all experimental procedures. On the evening before experiments, cells were serum starved overnight in {alpha}-MEM, containing 0.1% FBS and 1% PSA.

AdipoR1 and AdipoR2 mRNA expression

Total cellular RNA was extracted using RNABee (Tel-Test, Friendswood, TX). First-strand cDNA was generated from 0.5 µg RNA using an alfalfa mosaic virus RT kit (Promega, Madison, WI). PCR was performed using the ABI PRISM 5700 sequence detection system (Applied Biosystems, Foster City, CA). PCR were performed using SYBR Green I chemistry (Applied Biosystems). Forward and reverse primers and cDNA (12 ng) were run for 40 cycles of PCR in a total volume of 20 µl. To compensate for variations in input RNA amounts, and efficiency of RT, cyclophilin (GenBank accession no. X52851) mRNA was quantified, and all results were normalized to these values. Cyclophilin expression did not differ between groups. Fluorescent emission data were analyzed for the critical threshold (CT) values, with the expression of the gene of interest normalized to cyclophilin and expressed as 2{Delta}CT (19). Primers were designed using Primer Express software package version 1.0 (Applied Biosystems) from gene sequences obtained from GenBank. The sequences of the forward (F) and reverse (R) primers are listed from 5' to 3' and are as follows: AdipoR1, (NM_015999) (F) CGCCATGGAGAAGATGGAA, (R) TCATATGGGATGACCCTCCAA; AdipoR2 (NM_024551) (F) GGATCCCCGAACGCTTTTT, (R) TGAGACACCA-TGGAAGTGAACAA, and cyclophilin (X52851) (F) CATCTGCACTGCCAAGACTGA, (R) TTCATGCCTTCTTTCACTTTGC.

Production of recombinant gAD

gAD was produced as a C-terminal glutathione-S-transferase fusion protein (GST-gAD). The sequence encoding gAD, amino acid residues 108–244, was produced by PCR from the full-length human adiponectin (gift from Jon Whitehead, University of Queensland, St. Lucia, Queensland, Australia) with oligonucleotides gcggatccggtgcctatgtataccgctcag and gcgaattctcagttggtgtcatggtagagaag, 5' to 3', and inserted as a BamH1-EcoR1 fragment into pGEX4T. Protein was produced after transformation of this plasmid into Escherichia coli strain BL21DE3, with ampicillin selection. The fusion protein was purified on glutathione-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) using standard procedures (20). Protein production was induced with 0.1 mM ispropyl ß-D-thiogalactoside for 2 h. Protein was extracted from the cells by sonication; lysis in PBS (pH 7.4), 1% Triton X-100, 1 mM mercaptoethanol, 200 U/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin, and 200 mM phenylmethylsulfonyl fluoride; and centrifugation at 12,000 x g for 10 min. Protein in the supernatant was purified on glutathione-Sepharose. GST-gAD was eluted from the resin with four 0.5-ml washes of 100 mM reduced glutathione in PBS. The GST-gAD was then dialyzed in two changes of 500 ml PBS, and the final preparation was concentrated on a YM30 centricon (Amicon, Beverly, MA). GST was produced from the same vector and was used as a vehicle control in all experiments. In preliminary experiments, the effects of GST (0.2 µg/ml) alone were examined and found to have no effect on AMPK signaling or fatty acid oxidation (n = 8; data not shown). In addition, experiments were conducted demonstrating that cleaved gAD resulted in similar stimulation of AMPK activity in lean myotubes as that obtained from GST-gAD (n = 8; data not shown). We used the GST-gAd at concentrations of 0.2 and 1.0 µg/ml, which represented absolute quantities of gAd of 0.1 and 0.5 µg/ml, respectively.

AMPK activity

For the determination of AMPK-related activity, cells were cultured in 10-cm plates and treated with vehicle (GST, 0.2 µg/ml), 5-aminoimidazole-4-carboxamide riboside (AICAR, 2 mM) or low (gAD-L, 0.1 µg/ml) and high (gAD-H, 0.5 µg/ml) concentrations of gAD. The gAD and AICAR concentrations and time points used in this study were the same as previously demonstrated to maximally activate AMPK in rodent skeletal muscle (3) and primary human muscle cells, respectively (21). After treatment, myotubes were washed once with ice-cold PBS and lysed in 250 µl of ice-cold lysis buffer [20 mM HEPES (pH 7.5), 2 mM EDTA, 50 mM NaF, 5 mM Na4P2O7, and 1% Nonidet P-40 plus 1% protease inhibitor cocktail (Complete; Roche, Castle Hill, Australia)] on ice, scraped, snap frozen in liquid nitrogen, and stored at –80 C until analysis. Frozen cell lysates were centrifuged at 14,000 x g for 25 min and an aliquot (100 µl) removed for the measurement of LKB1 activity (see below), AMPK Thr172 phosphorylation and AMPK{alpha} expression after the determination of protein content by the bicinchoninic acid method (Bio-Rad, Hercules, CA). The remaining supernatant was removed for determination of AMPK{alpha}1 and -{alpha}2 activities in immunocomplex and ACCß expression and phosphorylation using reagents and procedures described previously (22).

LKB1 activity

Sheep anti-LKB1 antibody (Upstate, Lake Placid, NY) prebound to protein A beads were incubated with the muscle lysates for 2 h at 4 C. AMPKK assays were performed on the beads using a two-step reaction with full-length, bacterially expressed, human AMPK ({alpha}1, ß1, and {gamma}1) as substrate (Jennings, I. G., and B. E. Kemp, unpublished data). The AMPKK buffer contained 20 mM Tris-HCl (pH 7.5), 0.1% Tween 20, 10 mM dithiothreitol, 8 mM MgCl2 with 0.4 mM ATP, 0.12 mM AMP, and AMPK ({alpha}1, ß1, and {gamma}1) (3 µM) in 18 µl was incubated with 12 µl of the muscle homogenate at 30 C for 30 min. The AMPK ({alpha}1, ß1, and {gamma}1) activity was then determined using the AMPK SAMS peptide assay (22). A 20-µl aliquot of the AMPKK reaction mixture was added to the peptide phosphorylation reaction to give a final volume of 40 µl and assayed as described above. The remaining beads were placed in sample buffer and exposed to SDS-PAGE.

Fatty acid oxidation

Fatty acid oxidation was measured in myotubes cultured on 10-cm plates (23). Briefly, cells were preincubated with 3 ml of 4% fatty-acid-free bovine albumin (ICN Biochemicals, Aurora, OH), 1 mM palmitate (Sigma-Aldrich Co., St. Louis, MO), 0.1% FBS, 1% PSA, and {alpha}-MEM at 37 C for 1 h. Cells were then treated with the same medium but with the addition of 1 µCi/ml of [1-14C]palmitate (Amersham Biosciences, Little Chalfont, UK) with vehicle (GST, 0.2 µg/ml), AICAR (2 mM), or gAD-L (0.1 µg/ml) or gAD-H (0.5 µg/ml) for 2 h. After the incubation, 1 ml of the medium, in duplicate, was delivered into glass scintillation vials to determine CO2 release. 14CO2 trapped within the medium was liberated by the addition of 1 ml of 1 M acetic acid and captured over 60 min in 400 µl of benzethonium hydroxide (Sigma-Aldrich). Small centrifuge tubes containing benzethonium hydroxide were then placed in liquid scintillation cocktail (Packard Bioscience Co., Meriden, CT) and counted. For the determination of acid-soluble metabolites, the same myotubes used for the determination of fatty acid oxidation were washed twice with ice-cold PBS and lysed in 250 µl of ice-cold methanol, scraped, snap frozen, and extracted as described (24). Total palmitate oxidation was calculated by the addition of aqueous phase counts representing acid-soluble metabolites to 14CO2 counts captured within the benzethonium hydroxide. The quantity of palmitate oxidized was calculated from the specific activity of labeled palmitate in the incubation medium (24).

Calculations and statistical analysis

All data are reported as mean ± SE. Results were analyzed using ANOVA procedures, and a Tukey’s post hoc test was used to test for significant differences revealed by the ANOVA. Significance was accepted at P ≤ 0.05.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Clinical characteristics for lean, obese, and obese type 2 diabetic subjects are listed in Table 1Go. Lean subjects had no family history of diabetes. Obese subjects had significantly greater body mass and body mass index (BMI) than lean or obese type 2 diabetic subjects and had elevated fasting plasma insulin levels relative to lean controls. Two of the seven obese subjects had a family history of diabetes, but because responses to gAD and basal AMPK expression/activity and fatty acid oxidation were similar between these individuals and the rest of the group, their data were included in the analysis. Neither lean nor obese subjects were taking any medications known to alter carbohydrate or fatty acid metabolism. Type 2 diabetic patients had significantly greater fasting plasma insulin, glucose, and triglyceride concentrations than lean and obese subjects and had elevated body mass and BMI relative to lean controls. Six of the obese type 2 diabetic subjects had been diagnosed with diabetes in the previous 2 yr with the exception of one subject who had been a diabetic for 15 yr. All obese diabetic subjects were taking metformin, which has been demonstrated to activate AMPK in type 2 diabetic skeletal muscle (25). Because all cells were passaged four times and maintained in culture for over 7 d before experiments, the effects of these previous treatments were expected be minimal, and indeed we found no evidence of altered basal AMPK expression or activity in obese diabetic subjects (see below).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Participant characteristics

 
AdipoR1 mRNA expression was significantly greater then AdipoR2 expression (Fig. 1Go) in myotubes from all groups. The ratio of AdipoR1 to AdipoR2 was similar between groups (lean, 8.11 ± 3.44; obese, 7.62 ± 2.72; obese diabetic, 6.41 ± 1.18). Obese myotubes had a tendency for greater AdipoR1 expression relative to lean myotubes (P = 0.052). AdipoR2 expression was not significantly different between groups.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. AdipoR1 and AdipoR2 mRNA expression in cultured myotubes from lean, obese, and obese type 2 diabetic subjects under basal conditions. a, Significantly different from AdipoR1 (P < 0.05). Data are shown as means ± SEM; n = 7.

 
In agreement with previous findings in skeletal muscle (22, 26), AMPK{alpha} and ACCß protein expression relative to lean controls were unaltered (Fig. 2Go, A and B). Similarly, the expression of the upstream AMPKK, LKB1, was not altered in skeletal muscle culture from obese or type 2 diabetic skeletal muscle relative to lean controls (Fig. 2Go, A and B). LKB1 activity was unaltered by obesity or type 2 diabetes and was not activated in response to AICAR or gAD treatment (Fig. 2CGo).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 2. A, Representative Western blot and (B) quantification of ACCß, AMPK{alpha}, and LKB1 in cultured myotubes from lean (L), obese (Ob), and obese type 2 diabetic (Ob D) subjects under basal conditions. –, negative control; +, positive control. C, LKB1 activity in myotubes from lean, obese, and obese type 2 diabetic subjects treated with vehicle (GST, 0.2 µg/ml), AICAR (2 mM), gAD-L (0.1 µg/ml), or gAD-H (0.5 µg/ml). Data are shown as means ± SEM; n = 7.

 
AICAR stimulated AMPK{alpha}2 activity (Fig. 3BGo), AMPK Thr172 phosphorylation (Fig. 4BGo), ACCß Ser221 phosphorylation (Fig. 4CGo), and palmitate oxidation (Fig. 5Go) in lean, obese, and obese type 2 diabetic myotubes. In muscle from lean subjects, there was also a trend for AICAR to stimulate AMPK{alpha}1 activity (Fig. 3AGo).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. AMPK activity in cultured myotubes from lean, obese, and obese type 2 diabetic subjects measured in immune complexes isolated by immunoprecipitation using AMPK{alpha}1 (A) and AMPK{alpha}2 (B) antibodies after 15 min of treatment with vehicle (GST, 0.2 µg/ml), AICAR (2 mM), gAD-L (0.1 µg/ml), or gAD-H (0.5 µg/ml). Data are shown as means ± SEM; n =7. a, Significantly different from vehicle.

 


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. Representative Western blot of AMPK Thr172 and ACCß Ser221 phosphorylation corrected to total AMPK{alpha} and ACCß expression, respectively (A), and quantification (B and C) in myotubes from lean, obese, and obese type 2 diabetic subjects after 15 min of treatment with vehicle (Veh) (GST, 0.2 µg/ml), AICAR (Aic) (2 mM), gAD-L (LAd) (0.1 µg/ml), or gAD-H (HAd) (0.5 µg/ml). Data are shown as means ± SEM; n = 7. a, Significantly different from vehicle.

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. Palmitate oxidation in cultured myotubes from lean, obese, and obese type 2 diabetic subjects treated with vehicle (GST, 0.2 µg/ml), AICAR (2 mM), gAD-L (0.1 µg/ml), or gAD-H (0.5 µg/ml) for 120 min. Data are shown as means ± SEM; n = 7. a, Significantly different from vehicle.

 
In skeletal muscle culture from lean subjects, both gAD-H and gAD-L increased AMPK{alpha}1 (Fig. 3AGo) and AMPK{alpha}2 activities (Fig. 3BGo). Increased AMPK activity was associated with elevated AMPK Thr172 phosphorylation (Fig. 4Go, A and B) and ACCß phosphorylation (Fig. 4Go, A and C) and elevated rates of fatty acid oxidation (Fig. 5Go).

In obese skeletal muscle, gAD-H increased AMPK{alpha}1 (Fig. 3AGo) and AMPK{alpha}2 activity (Fig. 3BGo). Unlike skeletal muscle from lean subjects, gAD-L failed to increase either AMPK{alpha}1 or -{alpha}2 activities. AMPK Thr172 phosphorylation was increased by both gAD-L and gAD-H (Fig. 4BGo). ACCß phosphorylation was significantly elevated with gAD-H (Fig. 4CGo). In line with increased ACCß phosphorylation with gAD-H, palmitate oxidation was also increased (Fig. 5Go).

AMPK{alpha}2 activity was not stimulated in myotubes from obese type 2 diabetic subjects with gAD-L or gAD-H (Fig. 3BGo), although gAD-H increased AMPK{alpha}1 activity (Fig. 3AGo). AMPK Thr172 phosphorylation was also elevated by gAD-H (Fig. 4Go, A and B) but did not result in a significant increase in ACCß phosphorylation (Fig. 4Go, A and C) or palmitate oxidation (Fig. 5Go).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Recent studies in rodents have suggested an important role for the adipocyte-derived protein adiponectin (Acrp30, AdipoQ), in regulating skeletal muscle insulin sensitivity through activation of AMPK and the stimulation of fatty acid oxidation (3, 4). Although there are significant associative data in humans suggesting an important role of adiponectin in regulating fatty acid oxidation and insulin sensitivity, direct evidence of a role for adiponectin in human skeletal muscle does not exist. In this study, we have used cultured primary myotubes derived from skeletal muscle of lean, obese, and type 2 diabetic subjects to directly examine the role of gAD on skeletal muscle fatty acid oxidation and AMPK activity. The use of primary myotubes represents an excellent model to study the effects of gAD on AMPK signaling and fatty acid oxidation because they express protein characteristics of differentiated muscle cells, and previous studies have demonstrated that obese insulin-resistant and type 2 diabetic skeletal muscle maintain the metabolic phenotypes of suppressed fatty acid oxidation (10) and reduced insulin-stimulated glucose uptake (27, 28, 29) characteristic of these conditions in vivo. In addition, they provide the advantage of being able to study obesity and diabetes in the absence of alterations in the hormonal milieu, therefore making it possible to directly assess the effects of hormones in isolation.

The principal findings of this study are that gAD stimulates AMPK{alpha}1 and -{alpha}2 activities, ACCß phosphorylation, and fatty acid oxidation in skeletal muscle myotubes from lean subjects. The increased activation of AMPK in skeletal muscle was not associated with alterations in LKB1 activity. Although the effects of low concentrations of gAD on AMPK signaling were blunted in myotubes of obese subjects, higher concentrations of gAD stimulated AMPK signaling and palmitate oxidation. In obese type 2 diabetic subjects, the effects of gAD-L and gAD-H on downstream activation of ACCß phosphorylation and fatty acid oxidation were ablated.

To investigate mechanisms that may contribute to the reduced activation of AMPK in obese and obese type 2 diabetic myotubes, we measured adiponectin receptor expression. Adiponectin signaling is mediated by two classes of adiponectin receptors (5). Elegant studies by Yamauchi et al. (5) demonstrated that AdipoR1 was expressed primarily in skeletal muscle and bound gAD with high affinity, whereas AdipoR2 was expressed primarily in hepatic tissue and primarily bound full-length adiponectin. These data helped elucidate previous observations in skeletal muscle demonstrating a more potent effect of gAD on stimulating AMPK and fatty acid oxidation in skeletal muscle, whereas full-length adiponectin was capable of activating AMPK only in liver (3, 7, 30). Two reports (16, 31) in human skeletal muscle and a recent study in primary human myotubes (32) suggest that skeletal muscle contains abundant levels of both AdipoR1 and AdipoR2. In the present study, we demonstrate that AdipoR1 mRNA is expressed at higher levels relative to AdipoR2 (~7- to 8-fold) and that the ratio of AdipoR1 to AdiopR2 is not altered between groups. Taken together, these data suggest that the blunted activation of AMPK and fatty acid oxidation by gAD in obese and obese type 2 diabetic myotubes is not attributed to alterations in adiponectin receptor expression.

AMPK is a ubiquitously expressed {alpha}ß{gamma} heterotrimer consisting of a catalytic subunit ({alpha}) and two noncatalytic subunits (ß and {gamma}). The activation of AMPK is mediated allo-sterically by elevation of the AMP:ATP ratio, or covalently by LKB1, and initiates catabolic pathways, such as fatty acid oxidation, while inhibiting energy-consuming anabolic pathways such as cholesterol and triglyceride synthesis. We (22), and others (33), have recently demonstrated that the mRNA and protein expression of AMPK isoforms is not altered in skeletal muscle of obese (22) or type 2 diabetic subjects (33) (34). The factors regulating AMPK protein expression are currently unknown, but it is feasible that AMPK expression may be regulated by factors that are altered within the hormonal milieu of obese and obese type 2 diabetic subjects that may limit the interpretation of these previous findings in skeletal muscle. Our findings demonstrating that AMPK{alpha} protein expression is unaltered in primary myotubes suggest that there are no genetic differences in AMPK expression between groups. In addition, in agreement with previous reports demonstrating normal activation of AMPK of obese and type 2 diabetic skeletal muscle in response to endurance exercise (34) and AICAR (21, 22, 35), we demonstrate that AMPK activation by AICAR is also maintained in myotubes.

Previous studies in a variety of cell systems (8, 9, 36, 37) indicate that LKB1 is the primary kinase phosphorylating AMPK at Thr172 within the {alpha}-catalytic subunit. These studies (8, 9, 36, 37) and a recent report in rodent skeletal muscle (38) demonstrate that LKB1 is constitutively active despite large alterations in AMPK Thr172 phosphorylation, suggesting that alterations in the accessory proteins MO25 and STRAD may be critical for the regulation of LKB1/AMPK interactions. We extend on previous findings by demonstrating that LKB1 is not activated in human primary myotubes in response to gAD despite significant increases in AMPK activity and Thr172 phosphorylation. In addition, we also demonstrate that LKB1 expression is not altered in skeletal muscle myotubes of obese or type 2 diabetic subjects relative to lean controls.

The most significant findings of this study are that gAD activation of AMPK is blunted with obesity and in obese type 2 diabetics. We demonstrate that in obese myotubes, only high doses of gAD activated AMPK signaling and fatty acid oxidation. These effects are not caused by altered AMPK signaling capacity, because AICAR activation of AMPK{alpha}2, ACCß phosphorylation, and fatty acid oxidation are maintained in both obese and obese type 2 diabetic myotubes. In addition, we have shown that adiponectin receptor expression is unaltered. Taken together, these data suggest a similar situation to that observed within the skeletal muscle of obese subjects, which displays resistance to the metabolic effects of leptin (14, 22), despite normal expression of the leptin receptor (39). Future studies examining adiponectin receptor signaling are required to understand mechanisms that may contribute to the reduced signaling capacity observed in myotubes of obese and obese type 2 diabetic subjects.

In addition to the blunted activation of AMPK signaling by low doses of gAD in obese type 2 diabetic subjects, these subjects treated with high doses of gAD displayed an increase only in the {alpha}1 isoform of AMPK. Interestingly, the activation of AMPK{alpha}1 in obese type 2 diabetic myotubes by high doses of gAD was not sufficient to stimulate phosphorylation of ACCß or increase fatty acid oxidation, suggesting substrate specificity between the AMPK isoforms. ACCß is bound to the outer mitochondrial membrane by its hydrophobic N terminus and through this association regulates mitochondrial fatty acid oxidation by the production of malonyl-coenzyme A, which inhibits carnitine palmitoyltransferase-1 (40). It may be possible that differential subcellular localization of the AMPK isoforms may alter their ability to phosphorylate ACCß in vivo. Indeed, several lines of evidence support an important role of AMPK{alpha}2, but not {alpha}1, in the regulation of fatty acid metabolism, because both leptin (41) and endurance exercise (42) increase fatty acid oxidation and preferentially activate the AMPK{alpha}2 isoform without altering AMPK{alpha}1 activity. In addition, AMPK{alpha}2 also appears to be critical for the regulation of insulin sensitivity as AMPK{alpha}2 null mice are resistant to AICAR-stimulated glucose uptake (43) and develop whole-body insulin resistance (44), whereas AMPK{alpha}1 null mice appear normal. It is interesting to speculate that differential subcellular localization of the AMPK isoforms may result in altered sensitivity to adiponectin, but additional studies are required to examine the intracellular mechanisms by which adiponectin and other cytokines activate AMPK.

One of the limitations of the present study was that because of the difficulty in recruiting younger obese type 2 diabetic subjects, this group was significantly older than the obese group, which also displayed blunted AMPK signaling. In humans, aging is associated with mitochondrial dysfunction (45); therefore we cannot discount the possibility that our findings demonstrating reduced phosphorylation of ACCß and stimulation of palmitate oxidation by gAD in obese type 2 diabetic subjects, but not in obese subjects, may be a caused in some part by mitochondrial dysfunction. However, it should be noted that the obese type 2 diabetic group was matched in age to the lean group, which displayed normal activation of AMPK signaling, ACCß phosphorylation, and fatty acid oxidation. In addition, we detected no relationship between age and degree of stimulation of fatty acid oxidation after high doses of gAD (R2 = 0.00263; P = 0.495). Taken together, these data suggest that the blunted effects of gAD on ACCß phosphorylation and fatty acid oxidation are not attributable to an age-independent effect. In future studies, it would be interesting to observe whether defective adiponectin-stimulated AMPK signaling is observed in lean diabetic myotubes independent of obesity.

In conclusion, the present study is the first to illustrate that gAD stimulates AMPK activity and fatty acid oxidation in cultured skeletal muscle myotubes of lean subjects. Importantly, we demonstrate that despite the pronounced effects of gAD in lean subjects, obese subjects display a blunted activation of AMPK, an effect that is exasperated in obese type 2 diabetic skeletal muscle myotubes. We demonstrate that this defect is not attributable to reduced adiponectin receptor expression or altered AMPK signaling, because pharmacological activation of AMPK is maintained in obese and obese type 2 diabetic subjects. Future studies are required to examine the molecular mediators that may contribute to the suppressed activation of AMPK by gAD in obesity.


    Acknowledgments
 
We gratefully acknowledge the invaluable contributions of the surgeons, Dr. Simon Woods, FRACS, Monash University Academic Surgery Unit, Cabrini Hospital; and Dr. Mark Lawrance, Network Director, Obstetrics and Gynaecology, Bayside Health.


    Footnotes
 
This study was supported by the National Health and Medical Research Council (to D.C.-S. and B.E.K.) and Australian Research Council (ARC) (to B.E.K.). G.R.S was supported by a Natural Sciences and Engineering Research Council of Canada postdoctoral Fellowship and is presently supported by a ‘Target Obesity’ Fellowship from the Canadian Institutes of Health Research and the Heart and Stroke Foundation. B.E.K. is an ARC Federation Fellow.

First Published Online March 15, 2005

Abbreviations: ACCß, Acetyl-coenzyme A carboxylase; AdipoR, adiponectin receptor; AICAR, 5-aminoimidazole-4-carboxamide riboside; AMPK, AMP-kinase; BMI, body mass index; FBS, fetal bovine serum; gAD, globular adiponectin; gAD-H, high concentration of gAD; gAD-L, low concentration of gAD; GST, glutathione-S-transferase; PSA, penicillin, streptomycin, and amphotericin B.

Received October 11, 2004.

Accepted March 8, 2005.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, Tataranni PA 2001 Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 86:1930–1935[Abstract/Free Full Text]
  2. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF 1995 A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270:26746–26749[Abstract/Free Full Text]
  3. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med 8:1288–1295[CrossRef][Medline]
  4. Tomas E, Tsao T-S, Saha AK, Murrey HE, Zhang CC, Itani SI, Lodish HF, Ruderman NB 2002 Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl-CoA carboxylase inhibition and AMP-activated protein kinase activation. Proc Natl Acad Sci USA 99:16309–16313[Abstract/Free Full Text]
  5. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423:762–769[CrossRef][Medline]
  6. Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, Uchida S, Ito Y, Takakuwa K, Matsui J, Takata M, Eto K, Terauchi Y, Komeda K, Tsunoda M, Murakami K, Ohnishi Y, Naitoh T, Yamamura K, Ueyama Y, Froguel P, Kimura S, Nagai R, Kadowaki T 2003 Globular adiponectin protected ob/ob mice from diabetes and ApoE-deficient mice from atherosclerosis. J Biol Chem 278:2461–2468[Abstract/Free Full Text]
  7. Fruebis J, Tsao TS, Javorshi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF 2001 Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 98:2004–2010
  8. Hawley S, Boudeau J, Reid J, Mustard K, Udd L, Makela T, Alessi D, Hardie DG 2003 Complexes between the LKB1 tumor suppressor, STRAD{alpha}/ß and MO25{alpha}/ß are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2:28[CrossRef][Medline]
  9. Woods A, Johnstone SR, Dickerson K, Leiper FC, Fryer LG, Neumann D, Schlattner U, Wallimann T, Carlson M, Carling D 2003 LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr Biol 13:2004–2008[CrossRef][Medline]
  10. Gaster M, Rustan AC, Aas V, Beck-Nielsen H 2004 Reduced lipid oxidation in skeletal muscle from type 2 diabetic subjects may be of genetic origin: evidence from cultured myotubes. Diabetes 53:542–548[Abstract/Free Full Text]
  11. Kelley DE, Simoneau JA 1994 Impaired free fatty acid utilization by skeletal muscle in non-insulin-dependent diabetes mellitus. J Clin Invest 94:2349–2356
  12. Hulver MW, Berggren JR, Cortright RN, Dudek RW, Thompson RP, Pories WJ, MacDonald KG, Cline GW, Shulman GI, Dohm GL, Houmard JA 2003 Skeletal muscle lipid metabolism with obesity. Am J Physiol 284:E741–E732
  13. Bonen A, Parolin ML, Steinberg GR, Calles-Escandon J, Tandon NN, Glatz JFC, Luiken JJFP, Heigenhauser GJF, Dyck DJ 2004 Triacylglycerol accumulation in human obesity and type 2 diabetes is associated with increased rates of skeletal muscle fatty acid transport and increased sarcolemmal FAT/CD36. FASEB J 18:1144–1146[Abstract/Free Full Text]
  14. Steinberg GR, Parolin ML, Heigenhauser GJ, Dyck DJ 2002 Leptin increases FA oxidation in lean but not obese human skeletal muscle: evidence of peripheral leptin resistance. Am J Physiol 283:E187–E192
  15. Tsuchida A, Yamauchi T, Ito Y, Hada Y, Maki T, Takekawa S, Kamon J, Kobayashi M, Suzuki R, Hara K, Kubota N, Terauchi Y, Froguel P, Nakae J, Kasuga M, Accili D, Tobe K, Ueki K, Nagai R, Kadowaki T 2004 Insulin/Foxo1 pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity. J Biol Chem 279:30817–30822[Abstract/Free Full Text]
  16. Civitarese AE, Jenkinson CP, Richardson D, Bajaj M, Cusi K, Kashyap S, Berria R, Belfort R, DeFronzo RA, Mandarino LJ, Ravussin E 2004 Adiponectin receptors gene expression and insulin sensitivity in non-diabetic Mexican Americans with or without a family history of type 2 diabetes. Diabetologia 47:816–820[CrossRef][Medline]
  17. Blau HM, Webster C 1981 Isolation and characterization of human skeletal muscle cells. Proc Natl Acad Sci USA 78:5623–5627[Abstract/Free Full Text]
  18. Gaster M, Beck-Nielsen H, Schroder HD 2001 Proliferation conditions for human satellite cells. The fractional content of satellite cells. APMIS 109:726–734[CrossRef][Medline]
  19. Schmittgena TD, Zakrajseka BA, Millsb AG, Gornb V, Singerb MJ, Reedb MW 2000 Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Ann Biochem 285:194–204
  20. Rose MD, Winston F, Heister P 1990 Assay of ß-galactosidase in yeast. In: Methods in yeast genetics. Cold Spring Harbor, NY: Cold Spring Harbor Press; 155–159
  21. McIntyre EA, Halse R, Yeaman SJ, Walker M 2004 Cultured muscle cells from insulin-resistant type 2 diabetes patients have impaired insulin, but normal 5-amino-4-imidazolecarboxamide riboside-stimulated, glucose uptake. J Clin Endocrinol Metab 89:3440–3448[Abstract/Free Full Text]
  22. Steinberg GR, Smith AC, van Denderen BJW, Chen Z, Murthy S, Campbell DJ, Heigenhauser GJF, Dyck DJ, Kemp BE 2004 AMP-activated protein kinase is not down-regulated in human skeletal muscle of obese females. J Clin Endocrinol Metab 89:4575–4580[Abstract/Free Full Text]
  23. Petersen EW, Carey AL, Sacchetti M, Steinberg GR, Macaulay SL, Febbraio MA, Pedersen BK 2005 Acute IL-6 treatment increases fatty acid turnover in elderly humans in vivo and in tissue culture in vitro. Am J Physiol 288:E155–E162
  24. Steinberg GR, Dyck DJ 2000 Development of leptin resistance in rat soleus muscle in response to high-fat diets. Am J Physiol 279:E1374–E1382
  25. Musi N, Hirshman MF, Nygren J, Svanfeldt M, Bavenholm P, Rooyackers O, Zhou G, Williamson JM, Ljunqvist O, Efendic S, Moller DE, Thorell A, Goodyear LJ 2002 Metformin increases AMP-activated protein kinase activity in skeletal muscle of subjects with type 2 diabetes. Diabetes 51:2074–2081[Abstract/Free Full Text]
  26. Hojlund K, Mustard KJ, Staehr P, Hardie DG, Beck-Nielsen H, Richter EA, Wojtaszewski JFP 2004 AMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes. Am J Physiol 286:E239–E244
  27. Gaster M, Petersen I, Hojlund K, Poulsen P, Beck-Nielsen H 2002 The diabetic phenotype is conserved in myotubes established from diabetic subjects: evidence for primary defects in glucose transport and glycogen synthase activity. Diabetes 51:921–927[Abstract/Free Full Text]
  28. Vollenweider P, Menard B, Nicod P 2002 Insulin resistance, defective insulin receptor substrate 2-associated phosphatidylinositol-3' kinase activation, and impaired atypical protein kinase C ({zeta}/{lambda}) activation in myotubes from obese patients with impaired glucose tolerance. Diabetes 51:1052–1059[Abstract/Free Full Text]
  29. Henry RR, Ciaraldi TP, Abrams-Carter L, Mudaliar S, Park KS, Nikoulina SE 1996 Insulin-dependent diabetes mellitus subjects. biochemical and molecular mechanisms. J Clin Invest 98:1231–1236[Medline]
  30. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, Kadowaki T 2001 The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7:941–946[CrossRef][Medline]
  31. Debard C, Laville M, Berbe V, Loizon E, Guillet C, Morio-Liondore B, Boirie Y, Vidal H 2004 Expression of key genes of fatty acid oxidation, including adiponectin receptors, in skeletal muscle of type 2 diabetic patients. Diabetologia 47:917–925[CrossRef][Medline]
  32. Staiger H, Kaltenbach S, Staiger K, Stefan N, Fritsche A, Guirguis A, Peterfi C, Weisser M, Machicao F, Stumvoll M, Haring HU 2004 Expression of adiponectin receptor mRNA in human skeletal muscle cells is related to in vivo parameters of glucose and lipid metabolism. Diabetes 53:2195–2201[Abstract/Free Full Text]
  33. Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG, Kemp BE, Kiens B, Richter EA 2003 Regulation of 5'AMP-activated protein kinase activity and substrate utilization in exercising human skeletal muscle. Am J Physiol 284:E813–E822
  34. Musi N, Fujii N, Hirshman MF, Ekberg I, Froberg S, Ljungqvist O, Thorell A, Goodyear LJ 2001 AMP-activated protein kinase (AMPK) is activated in muscle of subjects with type 2 diabetes during exercise. Diabetes 50:921–927[Abstract/Free Full Text]
  35. Koistinen HA, Galuska D, Chibalin AV, Yang J, Zierath JR, Holman GD, Wallberg-Henriksson H 2003 5-Amino-imidazole carboxamide riboside increases glucose transport and cell-surface GLUT4 content in skeletal muscle from subjects with type 2 diabetes. Diabetes 52:1066–1072[Abstract/Free Full Text]
  36. Lizcano JM, Goransson O, Toth R, Deak M, Morrice NA, Boudeau J, Hawley SA, Udd L, Makela TP, Hardie DG, Alessi DR 2004 LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1. EMBO J 23:833–843[CrossRef][Medline]
  37. Shaw RJ, Kosmatka M, Bardeesy N, Hurley RL, Witters LA, DePinho RA, Cantley LC 2004 The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proc Natl Acad Sci USA 101:3329–3335[Abstract/Free Full Text]
  38. Sakamoto K, Goransson O, Hardie DG, Alessi DR 2004 Activity of LKB1 and AMPK-related kinases in skeletal muscle: effects of contraction, phenformin and AICAR. Am J Physiol 287:E310–E317
  39. Myers Jr MG 2004 Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog Horm Res 59:287–304[Abstract/Free Full Text]
  40. Abu-Elheiga L, Brinkley WR, Zhong L, Chirala SS, Woldegiorgis G, Wakil SJ 2000 The subcellular localization of acetyl-CoA carboxylase 2. Proc Natl Acad Sci USA 97:1444–1449[Abstract/Free Full Text]
  41. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415:339–343[CrossRef][Medline]
  42. Chen X-P, McConell GK, Michell BJ, Snow RJ, Canny BJ, Kemp BE 2000 AMPK signaling in contracting human skeletal muscle: acetyl-CoA carboxylase and NO synthase phosphorylation. Am J Physiol 279:E1202–E1206
  43. Jorgensen SB, Viollet B, Andreelli F, Frosig C, Birk JB, Schjerling P, Vaulont S, Richter EA, Wojtaszewski JFP 2003 Knockout of the {alpha}-2 but not {alpha}-1 5'AMP-activated protein kinase isoform abolishes AICAR- but not contraction-induced glucose uptake in skeletal muscle. J Biol Chem 279:1070–1079
  44. Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R, Vaulont S 2003 The AMP-activated protein kinase {alpha}2 catalytic subunit controls whole-body insulin sensitivity. J Clin Invest 111:91–98[CrossRef][Medline]
  45. Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW, Shulman GI 2003 Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science 300:1140–1142[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
G. R. Steinberg and B. E. Kemp
AMPK in Health and Disease
Physiol Rev, July 1, 2009; 89(3): 1025 - 1078.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B. G. Drew, S. J. Duffy, M. F. Formosa, A. K. Natoli, D. C. Henstridge, S. A. Penfold, W. G. Thomas, N. Mukhamedova, B. de Courten, J. M. Forbes, et al.
High-Density Lipoprotein Modulates Glucose Metabolism in Patients With Type 2 Diabetes Mellitus
Circulation, April 21, 2009; 119(15): 2103 - 2111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. L. Mullen, J. Pritchard, I. Ritchie, L. A. Snook, A. Chabowski, A. Bonen, D. Wright, and D. J. Dyck
Adiponectin resistance precedes the accumulation of skeletal muscle lipids and insulin resistance in high-fat-fed rats
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R243 - R251.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. B. Thrush, G. J. Heigenhauser, K. L. Mullen, D. C. Wright, and D. J. Dyck
Palmitate acutely induces insulin resistance in isolated muscle from obese but not lean humans
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1205 - R1212.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Blume, P. M. Benz, U. Walter, J. Ha, B. E. Kemp, and T. Renne
AMP-activated Protein Kinase Impairs Endothelial Actin Cytoskeleton Assembly by Phosphorylating Vasodilator-stimulated Phosphoprotein
J. Biol. Chem., February 16, 2007; 282(7): 4601 - 4612.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
R. J. Loos, S. Ruchat, T. Rankinen, A. Tremblay, L. Perusse, and C. Bouchard
Adiponectin and adiponectin receptor gene variants in relation to resting metabolic rate, respiratory quotient, and adiposity-related phenotypes in the Quebec Family Study
Am. J. Clinical Nutrition, January 1, 2007; 85(1): 26 - 34.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J.-M. Ye, N. Dzamko, A. J. Hoy, M. A. Iglesias, B. Kemp, and E. Kraegen
Rosiglitazone Treatment Enhances Acute AMP-Activated Protein Kinase-Mediated Muscle and Adipose Tissue Glucose Uptake in High-Fat-Fed Rats.
Diabetes, October 1, 2006; 55(10): 2797 - 2804.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. R. Steinberg, A. J. McAinch, M. B. Chen, P. E. O'Brien, J. B. Dixon, D. Cameron-Smith, and B. E. Kemp
The Suppressor of Cytokine Signaling 3 Inhibits Leptin Activation of AMP-Kinase in Cultured Skeletal Muscle of Obese Humans
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3592 - 3597.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Zang, S. Xu, K. A. Maitland-Toolan, A. Zuccollo, X. Hou, B. Jiang, M. Wierzbicki, T. J. Verbeuren, and R. A. Cohen
Polyphenols Stimulate AMP-Activated Protein Kinase, Lower Lipids, and Inhibit Accelerated Atherosclerosis in Diabetic LDL Receptor-Deficient Mice.
Diabetes, August 1, 2006; 55(8): 2180 - 2191.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. K. Bandyopadhyay, J. G. Yu, J. Ofrecio, and J. M. Olefsky
Increased Malonyl-CoA Levels in Muscle From Obese and Type 2 Diabetic Subjects Lead to Decreased Fatty Acid Oxidation and Increased Lipogenesis; Thiazolidinedione Treatment Reverses These Defects.
Diabetes, August 1, 2006; 55(8): 2277 - 2285.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. J. Watt, G. R. Steinberg, Z.-P. Chen, B. E. Kemp, and M. A. Febbraio
Fatty acids stimulate AMP-activated protein kinase and enhance fatty acid oxidation in L6 myotubes
J. Physiol., July 1, 2006; 574(1): 139 - 147.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Bluher, J. W. Bullen Jr., J. H. Lee, S. Kralisch, M. Fasshauer, N. Kloting, J. Niebauer, M. R. Schon, C. J. Williams, and C. S. Mantzoros
Circulating Adiponectin and Expression of Adiponectin Receptors in Human Skeletal Muscle: Associations with Metabolic Parameters and Insulin Resistance and Regulation by Physical Training
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2310 - 2316.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. J. Lessard, Z.-P. Chen, M. J. Watt, M. Hashem, J. J. Reid, M. A. Febbraio, B. E. Kemp, and J. A. Hawley
Chronic rosiglitazone treatment restores AMPK{alpha}2 activity in insulin-resistant rat skeletal muscle
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E251 - E257.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. R. Bruce, V. A. Mertz, G. J.F. Heigenhauser, and D. J. Dyck
The Stimulatory Effect of Globular Adiponectin on Insulin-Stimulated Glucose Uptake and Fatty Acid Oxidation Is Impaired in Skeletal Muscle From Obese Subjects
Diabetes, November 1, 2005; 54(11): 3154 - 3160.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M. B.
Right arrow Articles by Steinberg, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M. B.
Right arrow Articles by Steinberg, G. R.
Related Collections
Right arrow Lipid
Right arrow Diabetes and Insulin
Right arrow Metabolism
Right arrow Obesity


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals