This Article Abstract Full Text (PDF) All Versions of this Article: 90/6/3491    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Moffett, S. P. Search for Related Content PubMed PubMed Citation Articles by Moffett, S. P. Related Collections Calcium and Bone Metabolism Female Endocrinology

Tumor Necrosis Factor- Polymorphism, Bone Strength Phenotypes, and the Risk of Fracture in Older Women

Department of Epidemiology (S.P.M., J.M.Z., J.I.O., J.A.C.), University of Pittsburgh, Pittsburgh, Pennsylvania 15261; Department of Radiology (T.J.B.), The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205-2196; Department of Medicine (K.L.S., L.-Y.L.), University of California, San Francisco, San Francisco, California 94143; Department of General Internal Medicine (K.E.E.), Veterans Affairs Medical Center, Minneapolis, Minnesota 55417; Kaiser Permanente Center for Health Research Northwest/Hawaii (T.A.H.), Portland, Oregon 97227; Department of Medicine and Epidemiology and Preventive Medicine (M.C.H.), University of Maryland School of Medicine, Baltimore, Maryland 21201; Axys Pharmaceuticals (P.M.), La Jolla, California 92037; Roche Palo Alto (G.P.), Palo Alto, California 94304-1397; Roche Molecular Systems (D.G.), Alameda, California 94588; and Research Institute (S.R.C.), California Pacific Medical Center, San Francisco, California 94120-7999

Address all correspondence and requests for reprints to: Susan P. Moffett, Ph.D., Department of Epidemiology, Graduate School of Public Health, University of Pittsburgh, 130 DeSoto Street, Pittsburgh, Pennsylvania 15261. E-mail: susan.moffett{at}hgen.pitt.edu.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
TNF is a proinflammatory cytokine that promotes osteoclastic bone resorption. We evaluated the association between a G-308A polymorphism (rs1800629) at the TNFA locus and osteoporosis phenotypes in 4306 older women participating in the Study of Osteoporotic Fractures. Femoral neck bone mineral density (BMD) and structural geometry were measured using dual-energy x-ray absorptiometry and hip structural analysis. Incident fractures were confirmed by physician adjudication of radiology reports. Despite similar femoral neck BMD, women with the A/A genotype had greater subperiosteal width (P = 0.01) and endocortical diameter (P = 0.03) than those with the G/G genotype. The net result of these structural differences was that there was a greater distribution of bone mass away from the neutral axis of the femoral neck in women with the A/A genotype, resulting in greater indices of bone bending strength (cross-sectional moment of inertia: P = 0.004; section modulus: P = 0.003). Among 376 incident hip fractures during 12.1 yr of follow-up, a 22% decrease in the risk of hip fracture was seen per copy of the A allele (relative risk 0.78; 95% confidence interval 0.63, 0.96), which was not influenced by adjustments for potential confounding factors, BMD, or bone strength indices. The G-308A polymorphism was not associated with a reduced risk of other fractures. These results suggest a potential role of genetic variation in TNF in the etiology of osteoporosis.

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
OSTEOPOROSIS IS AN important clinical and public health problem that over a lifetime results in fractures in 40% of women (1). Hip fractures are the most important manifestation of osteoporosis and one of the most important causes of disability and death among elderly women. Hip fractures also represent a substantial economic burden with recent estimates of the annual health care costs for hip fractures at $8.6 billion (2). Compounding the problem, the number of fractures is expected to increase considerably during the next 25 yr, primarily as a result of increases in the elderly population (3).

The vast majority of hip fractures result from fall-related trauma to a proximal femur that is weakened by low bone mineral density (BMD), and low bone density is an established and very powerful risk factor for hip fracture (4, 5, 6). Moreover, numerous clinical risk factors influence hip fracture propensity independent of low bone density (4, 7). Osteoporosis and hip fractures also appear to be under strong genetic control (8). For example, a maternal history of fracture confers a 2-fold increased risk of hip fracture that is independent of bone density (4). There has been rapid progress in identifying genes and alleles that may determine bone density in recent years but little progress in identifying genetic determinants of hip fracture risk (9).

TNF is a proinflammatory cytokine that affects bone metabolism by encouraging bone resorption and inhibiting osteoblast differentiation (10). During bone resorption, osteoclast precursors are recruited from monocytic cells by TNF, an effect that is mediated through the TNF receptor (TNFR) 1 (11). The TNF family member receptor activator of nuclear factor-B ligand causes differentiation of these precursor cells into active osteoclasts (12). The gene for TNF lies in the class III region of the major histocompatability complex on chromosome 6p between the lymphotoxin-ß (TNFß) and lymphotoxin- genes (13, 14). Many microsatellite markers and single-nucleotide polymorphisms (SNPs) have been identified in this cluster including the G to A substitution at position –308 in the 5' region of the TNF gene (rs1800629) (15, 16, 17). This variant has been associated with multiple infectious and inflammatory disorders including cerebral malaria, severe septic shock, acute graft rejection, rheumatoid arthritis, obesity, and increased TNF levels in vivo (16, 18, 19, 20).

In the present analysis, we evaluated the relationship between the G-308A polymorphism (rs1800629) in TNF and BMD, bone strength-related phenotypes, and the risk of hip and other fractures in a large community-based cohort of older women.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Subjects

All women were participants in the Study of Osteoporotic Fractures (SOF), a prospective study of 9704 community-dwelling white women who were at least 65 yr of age at study entry. Women were recruited for SOF between 1986 and 1988 from population-based listings, such as voter registration lists, at four clinical centers in the United States: Baltimore, MD; Minneapolis, MN; Monongahela Valley, PA; and Portland, OR (21). Women were excluded from SOF if they reported bilateral hip replacements or were unable to walk unassisted. African-American women were excluded because of their low risk of hip fracture. The institutional review boards at each institution approved the study. All women provided written informed consent at entry into the study and at each clinical examination.

In 1989–1990, buffy coat specimens were collected from participants who returned for a second examination. In addition, whole blood samples were collected during 1997–1998 in women who had not previously provided buffy coat samples. Among the 6795 participants who provided samples, genotyping was performed in a subsample of 4490 with sufficient buffy coat samples available and adequate consent to perform genotyping as of January 1999. Of the 4490 samples genotyped, 101 samples did not have genotype data and 83 women were excluded because they reported corticosteroid use at the baseline visit, leaving 4306 women in the final sample.

Hip BMD and structure

Femoral neck BMD was measured by dual-energy x-ray absorptiometry (DXA) (QDR 1000; Hologic, Inc., Bedford, MA). Details of these methods and quality control procedures have been reported elsewhere (22, 23, 24). The cross-sectional area, subperiosteal width (outer diameter), and cross-sectional moment of inertia (CSMI) were measured directly from mineral mass distributions in a random subsample of 2189 women with suitable DXA scans using the Hip Structural Analysis Program (25). The program uses the distribution of mineral mass in a line of pixels across the bone axis to measure geometric properties for cross-sections in cut planes traversing the bone at that location. Current versions of this program average measurements for a series of five parallel mass profiles spaced approximately 1 mm apart along the bone axis. Section moduli (Z) were calculated as CSMI divided by the distance from the center of mass to the medial or lateral surface, whichever is greater. Assumptions of cross-sectional shape are not required for the above measurements but are needed to estimate average cortical thickness (26). As in previous studies, the cortices of the femoral neck were modeled as circular annuli with 100% of the measured mass in the cortex (27). The quality control procedures including CV measurements have been reported elsewhere (26, 28).

Fracture ascertainment

Details of the method for identifying fractures have been published (29). Briefly, participants were contacted every 4 months by postcard or telephone to ask whether they had sustained a fracture. More than 98% of these contracts were completed. All fractures are adjudicated by radiographic report. Fractures that occurred because of major trauma such as motor vehicle accidents were excluded.

Baseline lateral radiographs of the thoracic and lumbar spine were taken and interpreted by radiographic morphometry at the first clinic visit (1986–1988). The system for the diagnosis of vertebral fractures has been described elsewhere (30). To determine whether a specific vertebra was fractured, three height ratios were calculated for each vertebral level. If any of the height ratios fell more than 3 SD below this study population-specific mean, the vertebra was considered fractured (31, 32). All nonvertebral fractures were analyzed as a group, and hip, wrist, and vertebral fractures were analyzed separately.

Other measures

Body weight was measured (after removal of shoes and heavy outer clothing) using a balance beam scale. Height was measured without shoes using a Harpenden stadiometer (Holtain Ltd., Dyved, UK). Height and weight were used to calculate body mass index (BMI, kilograms per square meter). Maternal history of fractures, ancestry, self-reported health status, smoking status, and physical activity were assessed by questionnaire that was reviewed with the participant by a trained interviewer. Women were also asked about whether they were currently taking oral estrogen or calcium supplements.

Genotyping

Samples from 3454 women were genotyped for the G-308A polymorphism (rs1800629) in the TNFA promoter at Axys Sequanna Pharmaceuticals, Inc. (South San Francisco, CA) using the 5' exonuclease assay (33). The assay is based on the PCR and uses the 5' exonuclease activity of Taq DNA polymerase. Allele-specific oligonucleotide probes are added to the PCR and are cleaved by the 5' exonuclease activity of Taq polymerase only if genomic DNA includes the corresponding variant of the polymorphism. The probes are labeled at the 5' end with the reporter dye (FAM or TET) and at the 3' end with the quencher dye (TAMRA). When the probes are degraded by Taq polymerase, the genotypes can be determined by measuring the increase in one or both of the fluorescent reporter dyes. The PCR primers used were 5'-CCTGCATCCTGTCTGGAAGTTAGAAG in the forward direction and 5'-TGGGCCACTGACTGATTTGTGTGT in the reverse direction. The probe used for the G allele was AACCCCGTCCCCATGCCCCTC and for the A allele AACCCCGTCCTCATGCCCCTCAA. The PCR mixtures included 20 ng of genomic DNA in a 10-µl reaction volume and the following concentration of other reagents: probes (100 nM each), primers (900 nM each), 1x TaqMan PCR Master Mix (PE Applied Biosystems, Foster City, CA). PCR cycling conditions consisted of a preincubation period of 2 min at 50 C, an initial denaturation period of 10 min at 95 C, and an annealing period of 30 sec at 62 C, followed by a denaturation period of 30 sec at 95 C for 40 cycles. We used the ABI Prism 7700 sequence detector (PE Applied Biosystems) for data acquisition.

For the remaining subjects, genotyping assays were done at Roche Molecular Systems (Pleasanton, CA) using multiplex PCR amplification and allele-specific SNP detection by probe hybridization. Multiplex PCR was used to amplify the region encompassing the SNP. Primers were purchased from Operon (Alameda, CA) and were modified at the 5' phosphate by conjugation with biotin. PCR amplification was performed in a total reaction volume of 50 µl containing the following reagents: 40 mmol/liter KCl; 15 mmol/liter Tris-HCl (pH 8.0 at 25 C); 3 mmol/liter MgCl₂; 0.1 ng/µl purified human genomic DNA; 0.2 µmol/liter each primer; 200 µmol/liter each of dATP, dCTP, and dGTP; and a 400 µmol/liter mix of 90% deoxyuridine 5-triphosphate and 10% dTTP, and 0.25 U/µl AmpliTaq Gold DNA polymerase. Amplification was carried out in a GeneAmp PCR System 9600 thermal cycler (PE Biosystems) using the following specific temperature cycling profile: an initial hold at 94 C for 7 min; 33 cycles of 95 C for 15 sec, 60 C for 60 sec; and a final extension step of 68 C for 5 min. The detection of allelic variants at each SNP was performed by stringent hybridization of the biotinylated PCR products to the immobilized sequence-specific probes, followed by visualization using an enzyme-catalyzed color development step. The procedure was as described in Cheng et al. (34) except that hybridization and washing were performed at 53 C. A panel of 40 samples was run using both methods and showed 100% agreement.

Statistical analysis

Allele frequencies were estimated by the gene counting method, and departures from Hardy-Weinberg equilibrium were tested using a ² test. We compared characteristics of women by genotype using ANOVA for continuous measures and ² tests for categorical variables. We analyzed BMD and femoral neck structural phenotypes by genotype using ANOVA. To determine the relationship between genotype and the incidence of first occurrence of hip, wrist, and nonspine nontraumatic fractures, we used Cox proportional hazards models to estimate relative risks (RRs) and 95% confidence intervals (CIs) for the associations between TNFA genotype and fracture (SAS version 8.2; SAS Institute, Cary, NC). The wild-type G/G genotype served as the referent group in these analyses. We adjusted models for age and characteristics that differed by genotype. Population stratification has been cited as a potential cause of unreplicated and false-positive associations in candidate gene studies; thus, we also adjusted models for study center and northern European ancestry (35).

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
The frequency of the TNFA –308 A allele in the SOF cohort was 0.1635 and was similar to the frequency observed in other studies of Caucasians (36, 37). Seventy percent (70.1%) of the women carried the wild-type G/G genotype, 27.1% were heterozygous, and 2.8% had the A/A genotype. Genotype frequencies conformed to Hardy-Weinberg equilibrium (² = 0.37, P = 0.54).

The average age of women was 73 yr and did not differ across genotype (Table 1). Women with the A/A genotype were significantly taller and had slightly greater body weight than those with the G/G genotype such that BMI was similar across genotype. There were no other important differences in subject characteristics by genotype.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

 
The present study examined the association between a G-308A polymorphism in the promoter region of the TNF gene, bone density, and structural geometry and the incidence of fracture in a large prospective cohort of older white women. Despite similar cortical thickness and BMD at the femoral neck, women with the –308 A/A genotype had significantly greater indices of bending strength than women with the G/G genotype. These women also had a 63% lower age-adjusted risk of hip fracture, compared with women with the G/G genotype. The hip fracture result is based on a small number of observations because there were only four women with the A/A genotype who suffered a hip fracture, but the association is supported by the additive model showing a 22% decrease in hip fracture risk per copy of the A allele. These associations were independent of potential confounding factors, BMD, and femoral neck structural phenotypes.

Our results are consistent with several smaller studies demonstrating that other polymorphisms at positions –1031 and –863 in the TNFA promoter region are associated with bone-related phenotypes (38, 39, 40). In particular, Wennberg (40) found that the TNFA C-863A genotype was associated with lumbar spine and femoral neck cross-sectional area in female adolescents. Sibling pair analyses have also provided evidence in support of a role of the TNFA locus in postmenopausal osteoporosis (41). We extend the findings of these reports by showing that the G-308A genotype is associated with greater bone strength indices at the femoral neck and significantly lower hip fracture risk over 12 yr among older women. Moreover, Albagha et al. (42) recently found that a specific haplotype at the receptor for TNF, TNFR2 (TNFRSF1B) is associated with bone mass among perimenopausal women. Taken together, these results suggest that allelic variation at the TNFA locus in particular, and the TNF signaling pathway in general, may play a role in the genetic susceptibility to skeletal fragility.

Most osteoporosis candidate gene studies have focused on the potential genetic influences on DXA measures of BMD; however, BMD is not the only determinant of bone strength (8, 43). For example, the overall size and geometry of bone also determine bone mechanical strength, and such measures predict the risk of fracture independent of BMD (44, 45, 46, 47, 48). As much as 60–80% of the variance in these measures of proximal femur geometry, such as femoral neck cross-sectional area may be due to genetic differences among individuals (49). Our results indicate that TNFA genotype may contribute at least in part to the genetic regulation of femoral neck structural geometry but not femoral neck cortical thickness or BMD. Moreover, our results illustrate the importance of considering bone structural phenotypes in addition to, or perhaps even instead of, DXA measures of areal BMD; otherwise, important genetic associations might be disregarded. Nonetheless, the association between TNFA genotype and hip fracture was independent of body size and bone geometry suggesting that TNFA genotype might also influence bone quality or material properties.

TNF may influence bone metabolism by both stimulating osteoclast precursors and promoting bone resorption (11, 50, 51). TNF has also been shown to play an important role in estrogen deficiency-induced bone loss (52). With aging, TNF and other cytokines may mediate at least some of the osteoclastic resorption at the endosteal bone surface; however, this bone loss may be offset by age-related periosteal bone formation (53). Our findings suggest that women with the –308 A/A genotype have greater average endocortical diameter at the femoral neck, consistent with increased endocortical resorption, but may also have greater average subperiosteal width, consistent with increased periosteal bone formation. Moreover, we found no difference in femoral neck BMD or cortical thickness across TNFA genotype. Thus, bone mass in women with the TNFA –308 A/A genotype was distributed farther from the neutral axis of the femoral neck. The net result of these genotype-related differences is a wider and stronger bone among women with the A/A genotype, an observation that was consistent with the reduced risk of hip fractures among women carrying this genotype.

The TNFA G-308A polymorphism was significantly associated with hip but not wrist, vertebral, or nonvertebral fractures in the current analysis, although a nonsignificant trend in wrist fracture risk reduction was observed. The epidemiologic patterns for hip fractures are known to differ from other fractures (4, 54, 55). Also, recent studies in inbred strains of mice indicate that genetic regulation of bone strength is skeletal site specific (56). Our findings are consistent with a model whereby different genetic loci may influence bone fragility at different anatomical sites.

Part of the difficulty in evaluating circulating cytokines as potential biomarkers of long-term fracture risk is their short half-life. For example, increases in serum concentrations of TNF are usually transient (57). Hence, concentrations of TNF are unstable and may not provide a reliable indicator of TNF activity. On the other hand, genetically determined differences in TNFA expression or function may be a more reliable indicator of long-term TNF activity. This is supported by the association between the TNFA G-308A polymorphism and the risk of fracture over an average of 12 yr of follow-up in the present study.

Several studies have shown that the –308 A allele is associated with higher circulating levels of TNF in vivo; however, functional studies of this variant have yielded conflicting results (19, 20, 58). Whereas there is some evidence to support increased transcription by the –308 A allele, other studies have failed to reproduce these results or found that the A allele was associated with lower levels of TNF transcription (58, 59). None of these studies accessed the G-308A polymorphism in bone cells, so it is difficult to predict its functional significance in the bone microenvironment. To complicate interpretation of these results, there are several other SNPs in the 5' region of the TNF gene, several of which may also be functionally significant. Thus, it will be important to define the relationship between TNFA promoter haplotypes and bone density, structure, and the risk of fracture in future studies.

We also observed significantly greater stature among women with the A/A, compared with G/G genotypes in the present analysis. The TNF signaling pathway appears to be important for embryonic development and early skeletal morphogenesis (60, 61). For example, interruption of nuclear factor-B, a transcription factor in the TNF signaling pathway, decreases overall limb size (60). TNF also induces neovascularization and may stimulate vascular invasion of the growth plate (62). Our results raise the possibility that genetically mediated differences in TNF production or activity might contribute to interindividual differences in linear bone growth. Nonetheless, our findings of increased hip fracture risk among women with the TNFA A/A genotype were not explained by differences in height in multivariate analyses.

Our study has several notable strengths including its large, prospective design with excellent follow-up rates and nearly complete adjudication of fractures over an extended period of time. There are also several potential limitations to our study. Participants in the present analysis were community-dwelling North American Caucasian women aged 65 yr and older, and our findings may not be generalizable to women of other races, men, or institutionalized subjects. However, Caucasian women experience the greatest risk osteoporosis in the population and the majority of this risk comes after age 65, when hip fracture rates begin an exponential increase. Finally, only about 3% of the women were homozygous for the A allele and confidence limits for the hip fracture association were relatively wide. Larger studies of the TNFA G-308A polymorphism and the TNFA locus in general will be needed to replicate our findings.

Population stratification is an often cited limitation of candidate gene studies because population stratification can contribute to false-positive associations and an inability to reproduce findings (35). Women in the present study were recruited from several clinical centers in the United States, and any resultant population stratification could have in principle produced false-positive results. However, adjusting for ancestry and study center had no effect on our findings. Small sample size and low statistical power are also frequent limitations of candidate gene association studies (63). Our study included more than 4000 women and had adequate statistical power to detect even modest associations.

In summary, our finding suggest that older white women with the TNFA –308 A/A genotype may have greater indices of femoral neck bending strength and lower risk of hip fracture, despite having similar BMD, compared with women with the TNFA G/G genotype. Our findings require confirmation in other populations but suggest that the TNFA G-308A promoter polymorphism, or a closely linked allelic variant, may be a novel genetic marker for femoral neck fragility among older women. The identification of additional genetic markers of hip fracture susceptibility may be particularly useful as life-long indicators of risk and may be important in helping to identify optimal therapies in patients at increased risk.

	Footnotes

 
This work was supported by Public Health Service Grants AG05407, AR35582, AG05394, AR35584, and AR35583. S.P.M. was supported by National Institute on Aging Grant T32 AG00181–13.

First Published Online March 29, 2005

Abbreviations: BMD, Bone mineral density; BMI, body mass index; CI, confidence interval; CSMI, cross-sectional moment of inertia; DXA, dual-energy x-ray absorptiometry; RR, relative risk; SNP, single-nucleotide polymorphism; SOF, Study of Osteoporotic Fractures; TNFR, TNF receptor.

Received November 15, 2004.

Accepted March 21, 2005.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Melton 3rd LJ, Chrischilles EA, Cooper C, Lane AW, Riggs BL 1992 Perspective. How many women have osteoporosis? J Bone Miner Res 7:1005–1010[Medline]
2. Ray NF, Chan JK, Thamer M, Melton 3rd LJ 1997 Medical expenditures for the treatment of osteoporotic fractures in the United States in 1995: report from the National Osteoporosis Foundation. J Bone Miner Res 12:24–35[CrossRef][Medline]
3. Cooper C, Campion G, Melton 3rd LJ 1992 Hip fractures in the elderly: a world-wide projection. Osteoporos Int 2:285–289[CrossRef][Medline]
4. Cummings SR, Nevitt MC, Browner WS, Stone K, Fox KM, Ensrud KE, Cauley J, Black D, Vogt TM 1995 Risk factors for hip fracture in white women. Study of Osteoporotic Fractures Research Group. N Engl J Med 332:767–773
5. Greenspan SL, Myers ER, Maitland LA, Resnick NM, Hayes WC 1994 Fall severity and bone mineral density as risk factors for hip fracture in ambulatory elderly. JAMA 271:128–133[Abstract]
6. Cummings SR, Black DM, Nevitt MC, Browner W, Cauley J, Ensrud K, Genant HK, Palermo L, Scott J, Vogt TM 1993 Bone density at various sites for prediction of hip fractures. The Study of Osteoporotic Fractures Research Group. Lancet 341:72–75[CrossRef][Medline]
7. Riggs BL, Melton 3rd LJ, O’Fallon WM 1996 Drug therapy for vertebral fractures in osteoporosis: evidence that decreases in bone turnover and increases in bone mass both determine antifracture efficacy. Bone 18:197S–201S[Medline]
8. Zmuda JM, Cauley JA, Ferrell RE 1999 Recent progress in understanding the genetic susceptibility to osteoporosis. Genet Epidemiol 16:356–367[CrossRef][Medline]
9. Huang QY, Recker RR, Deng HW 2003 Searching for osteoporosis genes in the post-genome era: progress and challenges. Osteoporos Int 14:701–715[CrossRef][Medline]
10. Nanes MS 2003 Tumor necrosis factor-: molecular and cellular mechanisms in skeletal pathology. Gene 321:1–15[CrossRef][Medline]
11. Li P, Schwarz EM, O’Keefe RJ, Ma L, Looney RJ, Ritchlin CT, Boyce BF, Xing L 2004 Systemic tumor necrosis factor mediates an increase in peripheral CD11bhigh osteoclast precursors in tumor necrosis factor -transgenic mice. Arthritis Rheum 50:265–276[CrossRef][Medline]
12. Katagiri T, Takahashi N 2002 Regulatory mechanisms of osteoblast and osteoclast differentiation. Oral Dis 8:147–159[CrossRef][Medline]
13. Spies T, Morton CC, Nedospasov SA, Fiers W, Pious D, Strominger JL 1986 Genes for the tumor necrosis factors and ß are linked to the human major histocompatibility complex. Proc Natl Acad Sci USA 83:8699–8702[Abstract/Free Full Text]
14. Nedwin GE, Naylor SL, Sakaguchi AY, Smith D, Jarrett-Nedwin J, Pennica D, Goeddel DV, Gray PW 1985 Human lymphotoxin and tumor necrosis factor genes: structure, homology and chromosomal localization. Nucleic Acids Res 13:6361–6373[Abstract/Free Full Text]
15. Wilson AG, di Giovine FS, Blakemore AI, Duff GW 1992 Single base polymorphism in the human tumour necrosis factor (TNF) gene detectable by NcoI restriction of PCR product. Hum Mol Genet 1:353[Free Full Text]
16. Hajeer AH, Hutchinson IV 2001 Influence of TNF gene polymorphisms on TNF production and disease. Hum Immunol 62:1191–1199[CrossRef][Medline]
17. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW 1997 Effects of a polymorphism in the human tumor necrosis factor promoter on transcriptional activation. Proc Natl Acad Sci USA 94:3195–3199[Abstract/Free Full Text]
18. Bidwell J, Keen L, Gallagher G, Kimberly R, Huizinga T, McDermott MF, Oksenberg J, McNicholl J, Pociot F, Hardt C, D’Alfonso S 1999 Cytokine gene polymorphism in human disease: on-line databases. Genes Immun 1:3–19[CrossRef][Medline]
19. Appoloni O, Dupont E, Vandercruys M, Andriens M, Duchateau J, Vincent JL 2001 Association of tumor necrosis factor-2 allele with plasma tumor necrosis factor- levels and mortality from septic shock. Am J Med 110:486–488[CrossRef][Medline]
20. Bouma G, Crusius JB, Oudkerk Pool M, Kolkman JJ, von Blomberg BM, Kostense PJ, Giphart MJ, Schreuder GM, Meuwissen SG, Pena AS 1996 Secretion of tumour necrosis factor and lymphotoxin in relation to polymorphisms in the TNF genes and HLA-DR alleles. Relevance for inflammatory bowel disease. Scand J Immunol 43:456–463[CrossRef][Medline]
21. Cummings SR, Black D 1995 Bone mass measurements and risk of fracture in Caucasian women: a review of findings from prospective studies. Am J Med 98:24S–28S[CrossRef]
22. Ensrud KE, Palermo L, Black DM, Cauley J, Jergas M, Orwoll ES, Nevitt MC, Fox KM, Cummings SR 1995 Hip and calcaneal bone loss increase with advancing age: longitudinal results from the study of osteoporotic fractures. J Bone Miner Res 10:1778–1787[Medline]
23. Steiger P, Cummings SR, Black DM, Spencer NE, Genant HK 1992 Age-related decrements in bone mineral density in women over 65. J Bone Miner Res 7:625–632[Medline]
24. Orwoll ES, Oviatt SK 1991 Longitudinal precision of dual-energy x-ray absorptiometry in a multicenter study. The Nafarelin/Bone Study Group. J Bone Miner Res 6:191–197[Medline]
25. Beck TJ, Ruff CB, Warden KE, Scott Jr WW, Rao GU 1990 Predicting femoral neck strength from bone mineral data. A structural approach. Invest Radiol 25:6–18[CrossRef][Medline]
26. Beck TJ, Stone KL, Oreskovic TL, Hochberg MC, Nevitt MC, Genant HK, Cummings SR 2001 Effects of current and discontinued estrogen replacement therapy on hip structural geometry: the study of osteoporotic fractures. J Bone Miner Res 16:2103–2110[CrossRef][Medline]
27. Beck TJ, Looker AC, Ruff CB, Sievanen H, Wahner HW 2000 Structural trends in the aging femoral neck and proximal shaft: analysis of the Third National Health and Nutrition Examination Survey dual-energy x-ray absorptiometry data. J Bone Miner Res 15:2297–2304[CrossRef][Medline]
28. Beck TJ, Oreskovic TL, Stone KL, Ruff CB, Ensrud K, Nevitt MC, Genant HK, Cummings SR 2001 Structural adaptation to changing skeletal load in the progression toward hip fragility: the study of osteoporotic fractures. J Bone Miner Res 16:1108–1119[CrossRef][Medline]
29. Nevitt MC, Cummings SR, Browner WS, Seeley DG, Cauley JA, Vogt TM, Black DM 1992 The accuracy of self-report of fractures in elderly women: evidence from a prospective study. Am J Epidemiol 135:490–499[Abstract/Free Full Text]
30. Black DM, Palermo L, Nevitt MC, Genant HK, Epstein R, San Valentin R, Cummings SR 1995 Comparison of methods for defining prevalent vertebral deformities: the Study of Osteoporotic Fractures. J Bone Miner Res 10:890–902[Medline]
31. Black DM, Cummings SR, Stone K, Hudes E, Palermo L, Steiger P 1991 A new approach to defining normal vertebral dimensions. J Bone Miner Res 6:883–892[Medline]
32. Genant HK, Jergas M, Palermo L, Nevitt M, Valentin RS, Black D, Cummings SR 1996 Comparison of semiquantitative visual and quantitative morphometric assessment of prevalent and incident vertebral fractures in osteoporosis The Study of Osteoporotic Fractures Research Group. J Bone Miner Res 11:984–996[Medline]
33. Morin PA, Saiz R, Monjazeb A 1999 High-throughput single nucleotide polymorphism genotyping by fluorescent 5' exonuclease assay. Biotechniques 27:538–540, 542, 544 passim[Medline]
34. Cheng S, Pallaud C, Grow MA, Scharf SJ, Erlich HA, Klitz W, Pullinger CR, Malloy MJ, Kane JP, Siest G, Visvikis S 1998 A multilocus genotyping assay for cardiovascular disease. Clin Chem Lab Med 36:561–566[CrossRef][Medline]
35. Cardon LR, Palmer LJ 2003 Population stratification and spurious allelic association. Lancet 361:598–604[CrossRef][Medline]
36. Hoffstedt J, Eriksson P, Hellstrom L, Rossner S, Ryden M, Arner P 2000 Excessive fat accumulation is associated with the TNF-308 G/A promoter polymorphism in women but not in men. Diabetologia 43:117–120[CrossRef][Medline]
37. Herrmann SM, Ricard S, Nicaud V, Mallet C, Arveiler D, Evans A, Ruidavets JB, Luc G, Bara L, Parra HJ, Poirier O, Cambien F 1998 Polymorphisms of the tumour necrosis factor- gene, coronary heart disease and obesity. Eur J Clin Invest 28:59–66[CrossRef][Medline]
38. Ota N, Nakajima T, Ezura Y, Iwasaki H, Suzuki T, Hosoi T, Orimo H, Inoue S, Ito H, Emi M 2002 Association of a single nucleotide variant in the human tumour necrosis factor promoter region with decreased bone mineral density. Ann Hum Biol 29:550–558[CrossRef][Medline]
39. Furuta I, Kobayashi N, Fujino T, Kobamatsu Y, Shirogane T, Yaegashi M, Sakuragi N, Cho K, Yamada H, Okuyama K, Minakami H 2004 Bone mineral density of the lumbar spine is associated with TNF gene polymorphisms in early postmenopausal Japanese women. Calcif Tissue Int 74:509–515[CrossRef][Medline]
40. Wennberg P, Nordstrom P, Lorentzon R, Lerner UH, Lorentzon M 2002 TNF- gene polymorphism and plasma TNF- levels are related to lumbar spine bone area in healthy female Caucasian adolescents. Eur J Endocrinol 146:629–634[Abstract]
41. Ota N, Hunt SC, Nakajima T, Suzuki T, Hosoi T, Orimo H, Shirai Y, Emi M 2000 Linkage of human tumor necrosis factor- to human osteoporosis by sib pair analysis. Genes Immun 1:260–264[CrossRef][Medline]
42. Albagha OM, Tasker PN, McGuigan FE, Reid DM, Ralston SH 2002 Linkage disequilibrium between polymorphisms in the human TNFRSF1B gene and their association with bone mass in perimenopausal women. Hum Mol Genet 11:2289–2295[Abstract/Free Full Text]
43. Fox KM, Cummings SR, Powell-Threets K, Stone K 1998 Family history and risk of osteoporotic fracture. Study of Osteoporotic Fractures Research Group. Osteoporos Int 8:557–562[CrossRef][Medline]
44. Peacock M, Turner CH, Liu G, Manatunga AK, Timmerman L, Johnston Jr CC 1995 Better discrimination of hip fracture using bone density, geometry and architecture. Osteoporos Int 5:167–173[CrossRef][Medline]
45. Faulkner KG, Cummings SR, Black D, Palermo L, Gluer CC, Genant HK 1993 Simple measurement of femoral geometry predicts hip fracture: the study of osteoporotic fractures. J Bone Miner Res 8:1211–1217[Medline]
46. Gluer CC, Cummings SR, Pressman A, Li J, Gluer K, Faulkner KG, Grampp S, Genant HK 1994 Prediction of hip fractures from pelvic radiographs: the study of osteoporotic fractures. The Study of Osteoporotic Fractures Research Group. J Bone Miner Res 9:671–677[Medline]
47. Gilsanz V, Loro ML, Roe TF, Sayre J, Gilsanz R, Schulz EE 1995 Vertebral size in elderly women with osteoporosis. Mechanical implications and relationship to fractures. J Clin Invest 95:2332–2337
48. Bouxsein ML, Myers ER, Hayes WC 1996 Biomechanics of age-related fractures. In: Marcus R, Feldman D, Kelsey JL, eds. Osteoporosis. San Diego: Academic Press; 373–393
49. Slemenda CW, Turner CH, Peacock M, Christian JC, Sorbel J, Hui SL, Johnston CC 1996 The genetics of proximal femur geometry, distribution of bone mass and bone mineral density. Osteoporos Int 6:178–182[Medline]
50. Bertolini DR, Nedwin GE, Bringman TS, Smith DD, Mundy GR 1986 Stimulation of bone resorption and inhibition of bone formation in vitro by human tumour necrosis factors. Nature 319:516–518[CrossRef][Medline]
51. Johnson RA, Boyce BF, Mundy GR, Roodman GD 1989 Tumors producing human tumor necrosis factor induced hypercalcemia and osteoclastic bone resorption in nude mice. Endocrinology 124:1424–1427[Abstract]
52. Kimble RB, Bain S, Pacifici R 1997 The functional block of TNF but not of IL-6 prevents bone loss in ovariectomized mice. J Bone Miner Res 12:935–941[CrossRef][Medline]
53. Seeman E 2003 Periosteal bone formation—a neglected determinant of bone strength. N Engl J Med 349:320–323[Free Full Text]
54. Kelsey JL, Browner WS, Seeley DG, Nevitt MC, Cummings SR 1992 Risk factors for fractures of the distal forearm and proximal humerus. The Study of Osteoporotic Fractures Research Group. Am J Epidemiol 135:477–489[Abstract/Free Full Text]
55. Vogt MT, Cauley JA, Tomaino MM, Stone K, Williams JR, Herndon JH 2002 Distal radius fractures in older women: a 10-year follow-up study of descriptive characteristics and risk factors. The study of osteoporotic fractures. J Am Geriatr Soc 50:97–103[CrossRef][Medline]
56. Beamer WG, Shultz KL, Donahue LR, Churchill GA, Sen S, Wergedal JR, Baylink DJ, Rosen CJ 2001 Quantitative trait loci for femoral and lumbar vertebral bone mineral density in C57BL/6J and C3H/HeJ inbred strains of mice. J Bone Miner Res 16:1195–1206[CrossRef][Medline]
57. Aderka D, Engelmann H, Shemer-Aviny Y, Hornik V, Galil A, Sarov B, Wallach D 1992 Variation in serum levels of the soluble TNF receptors among healthy individuals. Lymphokine Cytokine Res 11:157–159[Medline]
58. Abraham LJ, Kroeger KM 1999 Impact of the –308 TNF promoter polymorphism on the transcriptional regulation of the TNF gene: relevance to disease. J Leukoc Biol 66:562–566[Abstract]
59. Bayley JP, Ottenhoff TH, Verweij CL 2004 Is there a future for TNF promoter polymorphisms? Genes Immun 5:315–329[CrossRef][Medline]
60. Bushdid PB, Brantley DM, Yull FE, Blaeuer GL, Hoffman LH, Niswander L, Kerr LD 1998 Inhibition of NF-B activity results in disruption of the apical ectodermal ridge and aberrant limb morphogenesis. Nature 392:615–618[CrossRef][Medline]
61. Kanegae Y, Tavares AT, Izpisua Belmonte JC, Verma IM 1998 Role of Rel/NF-B transcription factors during the outgrowth of the vertebrate limb. Nature 392:611–614[CrossRef][Medline]
62. Price JS, Oyajobi BO, Russell RG 1994 The cell biology of bone growth. Eur J Clin Nutr 48(Suppl 1):S131–S149
63. Lohmueller KE, Pearce CL, Pike M, Lander ES, Hirschhorn JN 2003 Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. Nat Genet 33:177–182[CrossRef][Medline]

This Article Abstract Full Text (PDF) All Versions of this Article: 90/6/3491    most recent Author Manuscript (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Moffett, S. P. Search for Related Content PubMed PubMed Citation Articles by Moffett, S. P. Related Collections Calcium and Bone Metabolism Female Endocrinology